We thank Shanghai Tolo Biotech for their technical assistance during the development of the C-Brick standard. This work was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB19040200).

1. Preparation of crRNA
<ol>
	<li>Preparation of crRNA templates
	<ol>
		<li>Re-suspend individual oligonucleotides (Table 1) in RNase-free water to a concentration of 10 &#181;M.</li>
		<li>Add 22.5 &#181;L of top-strand oligonucleotide (T7-F in Table 1), 22.5 &#181;L of bottom-strand oligonucleotide (Table 1), and 5 &#181;L of 10x annealing buffer to a 0.2 mL PCR tube. Ensure that the total volume is 50 &#181;L. 
		NOTE: Six different bottom-strand oligonucleotides are shown in Table 1, each of which should be individually paired with the top-strand T7-F. The lowercase letters in Table 1 represent the sequence to be transcribed into the guide sequence of crRNA. 10x Taq PCR buffer can be used instead of the 10x annealing buffer.</li>
		<li>Place the PCR tube into a thermocycler.</li>
		<li>Run the annealing program: initial denaturation at 95 &#176;C for 5 min and then a cooldown from 95-20 &#176;C, with a 1 &#176;C decrease per min on the thermocycler. 
		NOTE: Immediately use the samples for step 1.2.1.</li>
	</ol>
	</li>
	<li>Transcription and purification of crRNA
	<ol>
		<li>Add 38 &#181;L of RNase-free water, 8 &#181;L of the template from step 1.1.4, 20 &#181;L of 5x T7 transcription buffer, 20 &#181;L of NTP mixture (10 &#181;M), 4 &#181;L of recombinant RNase inhibitor (RRI), and 10 &#181;L of T7 RNA polymerase to a 1.5 mL microcentrifuge tube. Ensure that the total volume is 100 &#181;L.</li>
		<li>Put the microcentrifuge tube in a 37 &#176;C water bath overnight (for about 16 h).</li>
		<li>Use an RNA cleanup and concentration kit to purify the transcribed RNA; follow the manufacturer&#39;s protocol.</li>
		<li>Quantitate the RNAs with UV-Vis spectrophotometers and dilute the RNA to a concentration of 10 &#181;M. Use the samples immediately or store them at -80 &#176;C. 
		NOTE: The crRNA sequences are listed in Table 2.</li>
	</ol>
	</li>
</ol>
2. Construction of C-Brick Parts ( i.e., the Insertion of Biological Parts into a C-Brick Standard Vector)
NOTE: This step has three sub-steps. For short biological parts (e.g., promoters and terminators), it is best to use the direct PCR method to insert the biological parts into a C-Brick standard vector4. The whole vector sequence is shown in the supplementary data, and the prefix and suffix sequence is shown in Figure 1 (step 2.1, below). For biological parts that can be easily obtained via PCR (e.g., with templates of genomic DNA, plasmids, or de novo synthesized DNA sequences), it is best to use the seamless assembly method to insert the biological parts into a C-Brick standard vector (step 2.2, below). For those parts obtained from BioBrick and BglBrick standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector (step 2.3, below).
<ol>
	<li>Construction via direct PCR amplification
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 5&#39;-end of the oligonucleotide contains the sequence of the DNA part, and 3&#39;-end of the oligonucleotide contains the vector sequence (i.e., &#34;GGATCCACTAGTCTCTAGCTCG&#34; at the 3&#39;-end of the forward strand and &#34;GGATCCTTTCTCCTCTTTCTAG&#34; in the reverse strand). Either no overhang or a ~20-bp overhang can be designed at the 5&#39;-end of the oligonucleotide. Specific examples can be found in a previous study4.</li>
		<li>Re-suspend individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.1.2, 0.5 &#181;L of C-Brick standard vector (50 ng) as a template, and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into a thermocycler and start the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Thermocycler program: one cycle for 3 min at 98 &#176;C; thirty cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C, and 2 min at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Add 9 &#181;L of the mixture from step 2.1.4 to a 1.5 mL microcentrifuge tube.</li>
		<li>Add 1 &#181;L of DpnI and incubate for 1 h in a 37 &#176;C water bath. 
		NOTE:&#12288;If the primers have no overlapping sequences, add 0.5 &#181;L of T4 polynucleotide kinase (PNK) and 0.5 &#181;L of T4 DNA ligase and incubate in a 22 &#176;C water bath for 1 h. Otherwise, if the primers contain a ~20 nt overlapping sequence, directly transform the DpnI-treated products into E. coli (DH10B)-competent cells (step 2.4). The linearized PCR product will be circularized by the recombination system in the host.</li>
		<li>Use the samples immediately or store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via seamless assembly
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 3&#39;-end of the oligonucleotide contains the terminal sequence of the DNA part, and the 5&#39;-end of the oligonucleotide contains the terminal of the linearized C-Brick standard vector sequence (i.e., &#34;CTAGAAAGAGGAGAAAGGATCC&#34; for the 5&#39;-end of the forward strand and &#34;CGAGCTAGAGACTAGTGGATCC&#34; for the 5&#39;-end of the reverse strand). Specific examples can be found in a previous study4.</li>
		<li>Re-suspend the individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.2.2, 0.5 &#181;L of template (20-500 ng), and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into the thermocycler and run the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C. 
		NOTE: Set the thermocycler program to: one cycle for 3 min at 98 &#176;C; 30 cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C (according to the annealing temperature of the primer), and 1 min (according to the length of the biological parts) at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Purify the PCR product using a PCR cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Digest the C-Brick standard vector with BamHI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, and 1 &#181;L of BamHI to the microcentrifuge tube. Incubate for up to 2 h at 37 &#176;C in a water bath.</li>
		<li>Purify the above product using a gel cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Add 2 &#181;L of linearized vector (50 ng) from step 2.2.7, 5 &#181;L of fragment (200 ng) from step 2.2.4, 2 &#181;L of 5x seamless assembly buffer, and 1 &#181;L of seamless assembly enzyme from a seamless assembly kit to a 1.5-mL microcentrifuge tube.Ensure that the total volume is 10 &#181;L.</li>
		<li>Place this in a 37 &#176;C water bath for 30 min. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation. 
	NOTE: For those parts obtained from the BioBrick (step 2.3.4-2.3.7) and BglBrick (step 2.3.1-2.3.3) standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector.
	<ol>
		<li>Digest the BglBrick standard parts with BamHI and BglII: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer 3, 0.5 &#181;L of BamHI, and 0.5 &#181;L of BglII to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment using a gel cleanup system kit.</li>
		<li>Ligate the fragment and the C-Brick standard vector: add 2 &#181;L of linearized vector (50 ng) from step 2.1.12 and 6 &#181;L of fragment (200 ng) from step 2.3.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10 x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Digest the BioBrick standard parts with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Digest the C-Brick standard vector with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment from step 2.3.4 and the linearized vector from step 2.3.5 with a gel cleanup system kit; following the manufacturer&#39;s protocol.</li>
		<li>Ligate the fragment and the C-Brick vector: add 2 &#181;L of linearized vector (50 ng) from step 2.3.5 and 6 &#181;L of fragment (200 ng) from step 2.3.4 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Add 10 &#181;L of the products from step 2.1.8, 2.2.9, 2.3.3, or 2.3.7 for chemical transformation into the competent cells of E. coli (DH10B).</li>
	<li>Pick-up several clones to a 5-mL liquid Luria-Bertani (LB) tube and incubate at 37 &#176;C on a shaker (220 rpm) overnight.</li>
	<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
	<li>Identify the correct clones by Sanger sequencing11.</li>
</ol>
3. C-Brick Assembly (Figure 2)
<ol>
	<li>Digestion of the C-Brick vector with Cpf1
	<ol>
		<li>Add 22.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of the plasmid from step 2.6 (1 &#181;g), 0.5 &#181;L of RRI, and 1 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube. 
		NOTE: Cpf1 can be purchased commercially or purified following the protocol in a previous study4.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T2 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T1 (10 &#181;M) and Cpf1 (5 &#181;M) for another 30 min. 
		NOTE: Alternatively, to insert a foreign DNA fragment into the T3 and T4 sites, add 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T4 (10 &#181;M) for another 30 min.</li>
		<li>Add 1 &#181;L of thermosensitive alkaline phosphatase and incubate the tube in a 37 &#176;C water bath for another 1 h.</li>
		<li>Run an agarose gel electrophoresis and purify the vector using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Digestion of the DNA fragment with Cpf1
	<ol>
		<li>Add 21.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of plasmid from step 2.6 (2 &#181;g), 0.5 &#181;L of RRI, and 2 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T1 (10 &#181;M) and 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h. 
		NOTE: Alternatively, add 1 &#181;L of crRNA-T2 (10 &#181;M) and 1 &#181;L of crRNA-T4 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h.</li>
		<li>Run an agarose gel electrophoresis and purify the fragment using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>C-Brick assembly and further verification
	<ol>
		<li>Ligate the foreign DNA fragment and C-Brick vector: add 2 &#181;L of the linearized vector (50 ng) from step 3.1.4 and 6 &#181;L of the DNA fragment (200 ng) from step 3.2.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Add 10 &#181;L of the ligation products (step 3.3.1) for chemical transformation into E. coli (DH10B)-competent cells.</li>
		<li>Add several clones to a 5 mL liquid LB tube and incubate overnight on a shaker at 220 rpm and 37 &#176;C.</li>
		<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
		<li>Identify correct clones by Sanger sequencing11.</li>
	</ol>
	</li>
	<li>Perform a new round of C-Brick assembly. Correct clones from step 3.3.4 can be used as a new C-Brick vector or DNA part for further iterative C-Brick assembly, following the same protocol from steps 3.1-3.3. 
	NOTE: T2&#39; and T3&#39; sites are designed as the backup of T2 and T3 sites (Figure 1a). For plasmids obtained from step 2.3.7, only T2&#39; and T3&#39; can be used for the C-Brick standard assembly.</li>
</ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

The authors have nothing to disclose.

This protocol describes a procedure for the DNA assembly standard C-Brick. The most important step in this protocol is the linearization of the C-Brick standard vector; incomplete cleavage of the vector could seriously affect the success rate. Additionally, although Cpf1 mainly cleaves target DNA sequences in the &#34;18-23&#34; cleavage pattern, inaccurate cleavage near the two bases was also detected4, which can cause a small number of mutations after DNA assembly. Therefore, Sanger sequencing i...

The standardization of DNA biological parts is important for the development of synthetic biology1. The development of a DNA assembly procedure can replace ad hoc experimental designs and remove many of the unexpected outcomes that arise during the assembly of genetic components into larger systems. The BioBrick standard (BBF RFC 10) was one of the earliest proposed DNA assembly standards. It uses the prefix sequence (containing EcoRI and XbaI cutting sites) and the suffix sequence (containing SpeI and PstI cutting sites)2,3. Because XbaI and SpeI have complementary cohesive ends, BioBrick DNA parts that are cut with XbaI and SpeI can be joined together, generating a new BioBrick for further iterative assembly.
Some defects have been identified with the use of the BioBrick standard4. For example, it produces an 8-bp scar between the DNA parts, which does not allow for the construction of in-fusion proteins. Besides, the four abovementioned types of 6-bp restriction sites must be removed from the DNA parts, which is very inconvenient. The BglBrick standard was established to solve the first problem5. It creates a 6-bp &#34;GGATCT&#34; scar, producing Gly-Ser and allowing for the fusion of multiple proteins or protein domains. iBrick was developed to deal with the second problem6. It uses homing endonucleases (HEs) that recognize long DNA sequences. As the HE recognition sites rarely exist in natural DNA sequences, the iBrick standard can be used for the direct construction of iBrick parts without modifying their DNA sequences. However, the iBrick standard leaves a 21 bp scar between the DNA parts, which might be the reason for its unpopularity.
In recent years, the clustered regularly interspaced short palindromic repeats (CRISPR) system has developed rapidly7,8. Among the CRISPR-associated (Cas) proteins, Cas9 endonuclease from Streptococcus pyogenes is now widely used. It mostly introduces double-stranded DNA breaks (DSBs) with blunt ends9.
In 2015, Zhang and coworkers characterized Cpf1 (CRISPR from Prevotella and Francisella 1) for the first time. It belongs to the class 2 type V CRISPR-Cas system and is a CRISRP RNA (crRNA)-guided endonuclease10. Unlike Cas9, Cpf1 introduces a DSB with a 4 or 5 nt 5&#39; overhang10. Based on this characteristic, Cpf1 was used to develop a DNA assembly standard, C-Brick4. On a C-Brick standard vector, four Cpf1 target sites of prefixed T1/T2 and suffixed T3/T4 flank the biological parts; this is similar to the BioBrick standard. As the cleavage of T2 and T3 sites produces complementary sticky ends, it is possible to perform the iterative assembly of DNA parts while generating a &#34;GGATCC&#34; scar between the parts. Notably, the C-Brick standard has two main advantages: recognizing long target sequences and leaving short scars. The 6 bp &#34;GGATCC&#34; scar generated by C-Brick encodes Gly-Ser, which allows for the construction of fusion proteins. Moreover, the C-Brick standard is also partially compatible with the BglBrick and BioBrick standards.

<table><tbody><tr><td>Comercial Oligonucleotide</td><td>Sangon Biotech</td><td></td><td></td></tr><tr><td>10x Taq PCR Buffer</td><td>Transgen</td><td>#J40928</td><td></td></tr><tr><td>Ultra Pure Distilled Water</td><td>Invitrogen</td><td>10977-015</td><td></td></tr><tr><td>5x RNA Transcription Buffer</td><td>Thermo Scientific</td><td>K0441</td><td></td></tr><tr><td>T7 RNA polymerase</td><td>Thermo Scientific</td><td>#EP0111</td><td></td></tr><tr><td>NTP mixture</td><td>Sangon</td><td>#ND0056</td><td></td></tr><tr><td>RRI (Recombinant RNase Inhibitor)</td><td>Takara</td><td>2313A</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td></td></tr><tr><td>UV-Vis Spectrometer</td><td>Thermo Scientific</td><td>Nano-Drop 2000c</td><td></td></tr><tr><td>2x Phanta Max Buffer</td><td>Vazyme</td><td>PB505</td><td>PCR buffer</td></tr><tr><td>dNTPs</td><td>Transgen</td><td>AD101</td><td></td></tr><tr><td>Phanta Max Super-Fidelity DNA Polymerase</td><td>Vazyme</td><td>P505-d1</td><td></td></tr><tr><td>Ezmax for One-step Cloning</td><td>Tolobio</td><td>24303-1</td><td>seamless assembly kit</td></tr><tr><td>5x Buffer for Ezmax One-step Cloning</td><td>Tolobio</td><td>32006</td><td></td></tr><tr><td>BamHI</td><td>NEB</td><td>#R0136L</td><td></td></tr><tr><td>BamHI-HF</td><td>NEB</td><td>#R3136L</td><td></td></tr><tr><td>BglII&amp;nbsp;</td><td>NEB</td><td>#R0144L</td><td></td></tr><tr><td>XbaI</td><td>NEB</td><td>#R0145L</td><td></td></tr><tr><td>SpeI</td><td>NEB</td><td>#R3133L</td><td></td></tr><tr><td>10x Buffer 3</td><td>NEB</td><td>#B7003S</td><td></td></tr><tr><td>10x CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>10x T4 DNA ligase Buffer</td><td>Tolobio</td><td>32002</td><td></td></tr><tr><td>T4 PNK</td><td>Tolobio</td><td>32206</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Tolobio</td><td>32210</td><td></td></tr><tr><td>DpnI</td><td>NEB</td><td>#R01762</td><td></td></tr><tr><td>SV Gel and PCR clean-up system</td><td>Promega</td><td>A9282</td><td></td></tr><tr><td>Plasmid Mini Kit I</td><td>Omega</td><td>D6943-02</td><td>plasmid preparation kit</td></tr><tr><td>thermosensitive alkaline phosphatase&amp;nbsp;</td><td>Thermo Scientific</td><td>#EF0651</td><td>FastAP</td></tr><tr><td>10x Cpf1 buffer</td><td>Tolobio</td><td>32008</td><td></td></tr><tr><td>Cpf1</td><td>Tolobio</td><td>32105</td><td>FnCpf1</td></tr><tr><td>thermocycler</td><td>Applied Biosystems</td><td>veriti 96 well</td><td></td></tr><tr><td>C-Brick standard vector</td><td>Tolobio</td><td>98101</td><td></td></tr><tr><td>E. coli [DH10B]</td><td>Invitrogen</td><td>18297010</td><td></td></tr><tr><td>Luria-Bertani media (tryptone)</td><td>Oxoid</td><td>LP0042</td><td></td></tr><tr><td>Luria-Bertani media (yeast extract)</td><td>Oxoid</td><td>LP0021</td><td></td></tr><tr><td>Luria-Bertani media (NaCl)</td><td>Sangon Biotech</td><td>B126BA0007</td><td></td></tr></tbody></table>

protocols for c-brick dna standard assembly using cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this characteristic, Cpf1 has been used for the establishment of a DNA assembly standard called C-Brick, which has the advantage of long recognition sites and short scars. On a standard C-Brick vector, there are four Cpf1 recognition sites &#8211; the prefix (T1 and T2 sites) and the suffix (T3 and T4 sites) &#8211; flanking biological DNA parts. The cleavage of T2 and T3 sites produces complementary sticky ends, which allow for the assembly of DNA parts with T2 and T3 sites. Meanwhile, a short &#34;GGATCC&#34; scar is generated between parts after assembly. As the newly formed plasmid once again contains the four Cpf1 cleavage sites, the method allows for the iterative assembly of DNA parts, which is similar to those of BioBrick and BglBrick standards. A procedure outlining the use of the C-Brick standard to assemble DNA parts is described here. The C-Brick standard can be widely used by scientists, graduate and undergraduate students, and even amateurs.

This protocol demonstrated the assembly of three chromoprotein cassettes (cjBlue (BBa_K592011), eforRed (BBa_K592012), and amilGFP (BBa_K592010)). First, the coding sequences of the three abovementioned genes and terminators were individually cloned into a C-Brick standard vector. Short DNA parts, promoter and terminator, were introduced into the C-Brick vector through PCR amplification using primers containing the short DNA parts on the 5&#39; terminal. This was followed by the self-liga...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Universidad San Sebastian

Research

JoVE Journal

Genetics

8.2K Views.  Chinese Academy of Sciences. CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native &beta;-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFD&alpha; and &beta;, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFD&alpha; and &beta; improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via &beta;-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

Bioengineering

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D DNA nanostructures. Over decades, the rapid development of DNA nanotechnology is attributed to the use of linear DNAs as the source materials. For example, the DAO (double crossover, antiparallel, odd half-turns) tile is well-known as a building block for construction of 2D DNA lattices; the core structure of DAO is made from two linear single-stranded (ss) oligonucleotides, like two ropes making a right hand granny&#160;knot. Herein, a new type of DNA tiles called cDAO (coupled DAO) are built using a small circular ss-DNA of c64nt or c84nt (circular 64 or 84 nucleotides) as the scaffold strand and several linear ss-DNAs as the staple strands. Perfect 1D and 2D nanostructures are assembled from cDAO tiles: infinite nanowires, nanospirals, nanotubes, nanoribbons; and finite nano-rectangles. Detailed protocols are described: 1) preparation by T4 ligase and purification by denaturing PAGE (polyacrylamide gel electrophoresis) of small circular oligonucleotides, 2) annealing of stable circular tiles, followed by native PAGE analysis, 3) assembling of infinite 1D nanowires, nanorings, nanospirals, infinite 2D lattices of nanotubes and nanoribbons, and finite 2D nano-rectangles, followed by AFM (Atomic Force Microscopy) imaging. The method is simple, robust, and affordable for most labs.

This article presents a detailed protocol for T4 ligation and denaturing PAGE purification of small circular DNA molecules, annealing and native PAGE analysis of circular tiles, assembling and AFM imaging of 1D and 2D DNA nanostructures, as well as agarose gel electrophoresis and centrifugation purification of finite DNA nanostructures.

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D ...

Chemistry

Chromosome Conformation Capture (3C) for Undergraduate Research and Teaching

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Author Spotlight: Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates  

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 &#176;C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and ...

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, into close spatial proximity 2-6. Deciphering the relationship between chromosome organization and genome activity will aid in understanding genomic processes, like transcription and replication. However, little is known about how chromosomes fold. Microscopy is unable to distinguish large numbers of loci simultaneously or at high resolution. To date, the detection of chromosomal interactions using chromosome conformation capture (3C) and its subsequent adaptations required the choice of a set of target loci, making genome-wide studies impossible 7-10.
We developed Hi-C, an extension of 3C that is capable of identifying long range interactions in an unbiased, genome-wide fashion. In Hi-C, cells are fixed with formaldehyde, causing interacting loci to be bound to one another by means of covalent DNA-protein cross-links. When the DNA is subsequently fragmented with a restriction enzyme, these loci remain linked. A biotinylated residue is incorporated as the 5' overhangs are filled in. Next, blunt-end ligation is performed under dilute conditions that favor ligation events between cross-linked DNA fragments. This results in a genome-wide library of ligation products, corresponding to pairs of fragments that were originally in close proximity to each other in the nucleus. Each ligation product is marked with biotin at the site of the junction. The library is sheared, and the junctions are pulled-down with streptavidin beads. The purified junctions can subsequently be analyzed using a high-throughput sequencer, resulting in a catalog of interacting fragments.
Direct analysis of the resulting contact matrix reveals numerous features of genomic organization, such as the presence of chromosome territories and the preferential association of small gene-rich chromosomes. Correlation analysis can be applied to the contact matrix, demonstrating that the human genome is segregated into two compartments: a less densely packed compartment containing open, accessible, and active chromatin and a more dense compartment containing closed, inaccessible, and inactive chromatin regions. Finally, ensemble analysis of the contact matrix, coupled with theoretical derivations and computational simulations, revealed that at the megabase scale Hi-C reveals features consistent with a fractal globule conformation.

The Hi-C method allows unbiased, genome-wide identification of chromatin interactions (1). Hi-C couples proximity ligation and massively parallel sequencing. The resulting data can be used to study genomic architecture at multiple scales: initial results identified features such as chromosome territories, segregation of open and closed chromatin, and chromatin structure at the megabase scale.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, ...

Biology

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure. Each chromosome occupies a specific territory, that may change according to stage of development or cell cycle. Gene expression can occur in specialized transcriptional factories where chromatin segments may loop out from various chromosome territories, leading to co-localization of DNA segments which may exist on different chromosomes or far apart on the same chromosome. The Associated Chromosome Trap (ACT) assay provides an effective methodology to identify these long-range DNA associations in an unbiased fashion by extending and modifying the chromosome conformation capture technique. The ACT assay makes it possible for us to investigate mechanisms of transcriptional regulation in trans, and can help explain the relationship of nuclear architecture to gene expression in normal physiology and during disease states.

The associated chromosome trap (ACT) assay is a novel unbiased method for identifying long-range DNA interactions. The characterization of long range DNA interactions will allow us to determine the relationship of nuclear architecture to gene expression in both normal physiology and in diseased states.

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure.  Each chromosome occupies a specific territory, ...

Design and Synthesis of a Reconfigurable DNA Accordion Rack

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m resolution, show great potential in various fields of nanotechnology such as the molecular reactors, drug delivery, and nanoplasmonic systems. The reconfigurable DNA accordion rack, which can collectively manipulate a 2D or 3D nanoscale network of elements, in multiple stages in response to the DNA inputs, is described. The platform has potential to increase the number of elements that DNA nanomachines can control from a few elements to a network scale with multiple stages of reconfiguration.
In this protocol, we describe the entire experimental process of the reconfigurable DNA accordion rack of 6 by 6 meshes. The protocol includes a design rule and simulation procedure of the structures and a wet-lab experiment for synthesis and reconfiguration. In addition, analysis of the structure using TEM (transmission electron microscopy) and FRET (fluorescence resonance energy transfer) is included in the protocol. The novel design and simulation methods covered in this protocol will assist researchers to use the DNA accordion rack for further applications.

We describe the detailed protocol for design, simulation, wet-lab experiments, and analysis for a reconfigurable DNA accordion rack of 6 by 6 meshes.

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m ...

Recombineering Homologous Recombination Constructs in Drosophila

The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a genetic model organism for human-disease related research. Recent years have seen technical advancements like homologous recombination and recombineering. However, generating unequivocal null mutations or tagging endogenous proteins remains a substantial effort for most genes. Here, we describe and demonstrate techniques for using recombineering-based cloning methods to generate vectors that can be used to target and manipulate endogenous loci in vivo. Specifically, we have established a combination of three technologies: (1) BAC transgenesis/recombineering, (2) ends-out homologous recombination and (3) Gateway technology to provide a robust, efficient and flexible method for manipulating endogenous genomic loci. In this protocol, we provide step-by-step details about how to (1) design individual vectors, (2) how to clone large fragments of genomic DNA into the homologous recombination vector using gap repair, and (3) how to replace or tag genes of interest within these vectors using a second round of recombineering. Finally, we will also provide a protocol for how to mobilize these cassettes in vivo to generate a knockout, or a tagged gene via knock-in. These methods can easily be adopted for multiple targets in parallel and provide a means for manipulating the Drosophila genome in a timely and efficient manner.

Recombineering Homologous Recombination Constructs in Drosophila

Homologous recombination techniques greatly advance Drosophila genetics by enabling the creation of molecularly precise mutations. The recent adoption of recombineering allows one to manipulate large pieces of DNA and transform them into Drosophila6. The methods presented here combine these techniques to rapidly generate large homologous recombination vectors.

The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a ...

Protocols for C-Brick DNA Standard Assembly Using Cpf1

Summary

Explore More Videos

Chapters in this video

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Design and Synthesis of a Reconfigurable DNA Accordion Rack

Recombineering Homologous Recombination Constructs in Drosophila