C-Tuğla standardının geliştirilmesi sırasında teknik yardımları için Shanghai Tolo Biotech&#39;e teşekkür ediyoruz. Bu çalışma, Çin Bilimler Akademisinin Stratejik Öncelik Araştırma Programından hibelerle desteklenmiştir (Grund No XDB19040200).

1. crRNA&#39;nın hazırlanması <ol><li> CrRNA şablonlarının hazırlanması <ol><li> Tekli oligonükleotidleri ( Tablo 1 ) RNaz içermeyen suda 10 uM&#39;lik bir konsantrasyona kadar yeniden süspanse edin. </li><li> 22.5 uL üst şeritli oligonükleotid ( Tablo 1&#39;de T7-F), 22.5 uL alt-şeritli oligonükleotid ( Tablo 1 ) ve 5 uL 10x tavlama tamponu 0.2 mL PCR tüpüne ilave edin. Toplam hacmin 50 μL olduğundan emin olun. NOT: Altı farklı alt zincirli oligonükleotidler Tablo 1&#39;de gösterilmiştir, bunların her biri ayrı ayrı üst iplikçikli T7-F ile eşleştirilmelidir. Tablo 1&#39;deki küçük harfler, crRNA&#39;nın rehber dizisine transkribe edilecek sekansı temsil etmektedir. 10x Taq PCR tamponu, 10x tavlama tamponunun yerine kullanılabilir. </li><li> PCR tüpünü bir termostatöre yerleştirin. </li><li> Tavlama programını çalıştırın: İlk denatürasyon için 95 ° C&#39;de5 dakika sonra 95-20 ° C arasında bir cooldown, termosiklörde dakikada 1 ° C düşüş. NOT: Adımları derhal adım 1.2.1 için kullanın. </li></ol></li><li> CrRNA&#39;nın transkripsiyonu ve saflaştırılması <ol><li> RNaz içermeyen suya 38 μL, adım 1.1.4&#39;deki şablondan 8 μL, 5x T7 transkripsiyon tamponu 20 uL, NTP karışımından (10 uM) 20 μL, rekombinant RNaz inhibitöründen (RRI) 4 μL ve 10 μM ML T7 RNA polimeraz&#39;dan 1.5 mL mikrosantrifüj tüpüne aktarıldı. Toplam hacmin 100 μL olduğundan emin olun. </li><li> Mikrosantrifüj tüpünü bir gece boyunca (yaklaşık 16 saat boyunca) 37 ° C&#39;lik bir su banyosuna koyun. </li><li> Transkribe RNA&#39;yı arındırmak için bir RNA temizleme ve konsantrasyon kiti kullanın; Üreticinin protokolünü izleyin. </li><li> RNA&#39;ları UV-Vis spektrofotometreleri ile ölçün ve RNA&#39;yı 10 uM&#39;lik bir konsantrasyona kadar sulandırın. Numuneleri derhal kullanın veya -80 ° C&#39;de saklayın. NOT: crRNA dizisiS Tablo 2&#39;de listelenmiştir . </li></ol></li></ol> 2. C-Tuğla Parçalarının Yapımı ( yani, Biyolojik Parçaların C-Tuğla Standart Vektörüne Yerleştirilmesi) NOT: Bu adımın üç alt aşaması vardır. Kısa biyolojik kısımlar ( örn. Promoterler ve sonlandırıcılar) için biyolojik parçaları C-Brick standart vektör 4&#39;e eklemek için doğrudan PCR yöntemini kullanmak en iyisidir. Bütün vektör sekansı ek veride gösterilir ve önek ve son ek sırası Şekil 1&#39;de gösterilmiştir (aşama 2.1, aşağıda). PCR ile kolaylıkla elde edilebilen biyolojik kısımlar için ( örn., Genomik DNA şablonları, plazmidler veya yeni sentezlenmiş DNA dizileri), biyolojik parçaları bir C-Brick standart vektörüne eklemek için kesintisiz montaj yöntemini kullanmak en iyisidir (Aşama 2.2, aşağıda). BioBrick ve BglBrick standartlarından edinilen parçalar için sınırlamaEnzim aracılı sindirim ve T4 DNA ligaz aracılı ligasyon biyolojik parçaları bir C-Brick standart vektörüne yerleştirmek için kullanılabilir (aşama 2.3, aşağıda). <ol><li> Doğrudan PCR amplifikasyonu ile yapı <ol><li> PCR amplifikasyonu için oligonükleotitler dizayn ve sipariş etmek. NOT: Oligonükleotitin 5&#39;-ucu, DNA bölümünün dizisini içerir ve oligonükleotitin 3 &#39;ucu, vektör dizisini ( yani, ileri bandın 3&#39; ucunda &quot;GGATCCACTAGTCTCTAGCTCG&quot; ve &quot;GGATCCTTTCTCCTCTTTCTAG&quot; Ters yörede). Oligonükleotitin 5&#39;-ucunda çıkıntı veya ~ 20 bp çıkıntı tasarlanamaz. Spesifik örnekler daha önceki bir çalışmada bulunabilir 4 . </li><li> 10 uM&#39;lik bir konsantrasyona kadar ultra saf su içindeki tek tek oligonükleotitleri yeniden süspanse edin. </li><li> 0.2 mL&#39;lik bir PCR tüpünde buz üzerinde PCR reaksiyonları oluşturun: 18 μL ultra saf su ekleyin, 25 μL 2x PCR tamponu, adım 2.1.2&#39;den ileri ve geri primerlerden her biri 2.5 uL (10 uM), şablon olarak 0.5 uL C-Brick standart vektörü (50 ng) ve 0.5 uL&#39;lik bir şablon olarak dNTP&#39;lerin (10 uM) Yüksek doğrulukta DNA polimerazın Toplam hacmin 50 μL olduğundan emin olun. </li><li> Tüpü doğrudan bir termosiklleye yerleştirin ve termosiklör programını çalıştırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li><li> Thermocycler programı: 98 ° C&#39;de 3 dakika süreyle bir devir; 98 ° C&#39;de 10 saniye, 55 ° C&#39;de 20 saniye ve 72 ° C&#39;de 2 dakika için otuz döngü; Ve 72 ° C&#39;de 10 dakika boyunca bir döngü. Numuneyi 16 ° C&#39;de tutun. </li><li> Adım 2.1.4&#39;ten 9 μL karışım 1.5 mL mikrosantrifüj tüpüne ilave edilir. </li><li> 1 uL DpnI ekleyin ve 37 ° C&#39;lik bir su banyosunda 1 saat inkübe edin. NOT: Primerler üst üste binen sekanslara sahip değillerse 0.5 μL T4 polinükleotid kinaz (PNK) ve 0.5 μL T4 DNA ligaz ekleyin ve1 saat boyunca 22 ° C su banyosu. Aksi takdirde, primerler ~ 20 nt örtüşen diziyi içeriyorsa, doğrudan DpnI ile işleme tabi tutulan ürünleri E. coli (DH10B) -kompetent hücrelere dönüştürün (basamak 2.4). Doğrusallaştırılmış PCR ürünü konakçıdaki rekombinasyon sistemi ile dairesize hale getirilecektir. </li><li> Numuneleri hemen kullanın veya -20 ° C&#39;de saklayın. </li></ol></li><li> Dikişsiz montaj ile inşaat <ol><li> PCR amplifikasyonu için oligonükleotitler dizayn ve sipariş etmek. NOT: Oligonükleotitin 3&#39;-ucu, DNA bölümünün terminal dizisini içerir ve oligonükleotitin 5&#39;-ucu, doğrusallaştırılmış C-Brick standart vektör dizisinin terminalini içerir ( yani, 5 &#39;için standart olarak kullanılan &quot;CTAGAAAGAGGAGAAAGGATCC&quot; İleriye doğru ipliğin ucunu ve &quot;CGAGCTAGAGACTAGTGGCCT&quot; ters iplikçikinin 5&#39;-ucu için). Spesifik örnekler daha önceki bir çalışmada bulunabilir 4 . </li><li> Bireyi yeniden askıya alUltra saf sularda 10 uM konsantrasyona kadar ual oligonükleotitler. </li><li> 0.2 mL&#39;lik bir PCR tüpünde buz üzerinde PCR reaksiyonlarını ayarlayın: ultra saf su, 25 μL 2x PCR tamponu, 1 μL dNTPs (10 μM), 2.5 μL ileri ve geri primerlerin her biri (10 μM ), Adım 2.2.2, 0.5 uL şablon (20-500 ng) ve 0.5 uL yüksek-sadakat DNA polimeraz&#39;dan hazırlandı. Toplam hacmin 50 μL olduğundan emin olun. </li><li> Tüpü doğrudan termosiklleye yerleştirin ve termosiklör programını çalıştırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. NOT: Thermocycler programını şu şekilde ayarlayın: 98 ° C&#39;de 3 dakika süreyle bir devir; 98 ° C&#39;de 10 saniye, 55 ° C&#39;de 20 saniye sonra (primerin tavlama sıcaklığına göre) 30 döngü ve 72 ° C&#39;de 1 dakika (biyolojik parçaların uzunluğuna göre) 30 döngü; Ve 72 ° C&#39;de 10 dakika boyunca bir döngü. Numuneyi 16 ° C&#39;de tutun. </li><li> Bir PCR temizleme sistemi kullanarak PCR ürününü arıtınTem kiti; Üreticinin protokolünü izleyin. </li><li> C-Brick standart vektörünü BamHI ile sindirin: 34 μL ultra saf su, 10 μL plazmid (1 μg), 5 μL 10x tampon ve 1 μL BamHI&#39;yi mikrosantrifüj tüpüne ilave edin. Su banyosunda 37 ° C&#39;de 2 saate kadar inkübe edin. </li><li> Bir jel temizleme sistemi kiti kullanarak yukarıdaki ürünü arındırın; Üreticinin protokolünü izleyin. </li><li> Adım 2.2.7&#39;den 2 mcL doğrusallaştırılmış vektör (50 ng), adım 2.2.4&#39;ten 5 uL parça (200 ng), 5x kesintisiz montaj tamponu 2 mcL ve kesintisiz montaj kitinden 1 μL kesintisiz montaj enzimi ekleyin. 1.5 mL&#39;lik mikrosantrifüj tüpüne uygulayın. Toplam hacmin 10 mcL olduğunu kontrol edin. </li><li> Bunu 30 dakika boyunca 37 ° C&#39;lik bir su banyosuna yerleştirin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> Restriksiyon enzim aracılı sindirim ve T4 DNA ligaz aracılı ligasyon yoluyla yapı. NOT: BioBrick (basamak 2.3.4-2.3.7) ve BglBrick (basamak 2.3.1-2.3.3) standartlarından elde edilen parçalar için kısıtlama enzimi aracılı sindirim ve T4 DNA ligaz aracılı ligasyon, Biyolojik parçaları bir C-Tuğla standart vektörüne dönüştürür. <ol><li> BamHI ve BglII ile BglBrick standart parçalarını sindirin: 34 μL ultra saf su, 10 μl plazmid (2 μg), 5 μL 10x tampon 3, 0.5 μL BamHI ve 0.5 μL BglII&#39;yi mikrosantrifüj tüpüne ilave edin. 37 ° C su banyosunda 2 saat inkübe edin. </li><li> % 1 agaroz jel elektroforezi çalıştırın ve bir jel temizleme sistemi kiti kullanarak fragmanı arındırın. </li><li> Parçayı ve C-Brick standart vektörünü ligate edin: Adım 2.1.12&#39;den doğrusallaştırılmış vektörün (50 ng) 2 mL ve adım 2.3.3&#39;ten 6 uL parça (200 ng) 1.5 mL mikrosantrifüj tüpüne ekleyin. 1 uL 10 x T4 DNA ligaz tamponu ve 1 μL T4 DNA ligaz ekleyin. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya buz özütüE -20 ° C&#39;de saklayın. </li><li> XbaI ve SpeI ile BioBrick standart parçalarını sindirin: 34 μL ultra saf su, 10 μL plazmid (2 μg), 5 μL 10x tampon, 0.5 μL Xbal ve 0.5 μL SpeI mikrosantrifüj tüpüne ekleyin. 37 ° C su banyosunda 2 saat inkübe edin. </li><li> C-Brick standart vektörünü XbaI ve SpeI ile sindirin: 34 μL ultra saf su, 10 μL plazmid (1 μg), 5 μL 10x tampon, 0.5 μL Xbal ve 0.5 μL SpeI mikrosantrifüj tüpüne ekleyin . 37 ° C su banyosunda 2 saat inkübe edin. </li><li> % 1 agaroz jel elektroforezi çalıştırın ve safha 2.3.4 adımından ve adım 2.5.5&#39;deki doğrusallaştırılmış vektörü jel temizleme sistemi kitiyle saflaştırın; Üreticinin protokolünü izleyerek. </li><li> Parçayı ve C-Brick vektörünü ligate edin: Adım 2.3.5&#39;den 2 mcL doğrusallaştırılmış vektör (50 ng) ve adım 2.3.4&#39;ten 6 uL parça (200 ng) 1.5 mL mikrosantrifüj tüpüne ekleyin. ilanD 1 uL 10x T4 DNA ligaz tamponu ve 1 uL T4 DNA ligazı. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> E. coli&#39;nin yetkili hücrelerine (DH10B) kimyasal transformasyon için adım 2.1.8, 2.2.9, 2.3.3 veya 2.3.7&#39;den 10 uL ürün ekleyin. </li><li> Birkaç klonu 5 mL sıvı Luria-Bertani (LB) tüpü içine alın ve gece boyunca çalkalayıcıda (220 rpm) 37 ° C&#39;de inkübe edin. </li><li> Bir plazmid hazırlama kiti kullanarak plazmid ayıklayın; Üreticinin protokolünü izleyin. </li><li> Sanger dizilemesi ile doğru klonları tanımlayın 11 . </li></ol> 3. C-Tuğla Montajı ( Şekil 2 ) <ol><li> C-Brick vektörünün Cpf1 ile sindirimi <ol><li> 22.5 uL RNaz içermeyen su, 4 μL 10x Cpf1 tamponu, adım 2.6&#39;dan (1 μg) plazmidden 10 μL, RRI&#39;nin 0.5 μL&#39;si ve 1 μl# 181; L Cpfl&#39;den (5 uM) 1.5 mL&#39;lik bir mikrosantrifüj tüpüne. NOT: Cpf1 ticari olarak satın alınabilir veya önceki bir çalışmada protokolden sonra saflaştırılabilir 4 . </li><li> T1 ve T2 bölgelerine yabancı bir DNA parçası eklemek için, 1 μL crRNA-T2 (10 uM) ilave edin ve 30 dakika boyunca 37 ° C&#39;de bir su banyosunda inkübe edin. Bir dd 1 μL crRNA-T1 (10 uM) ve Cpfl (5 uM) 30 dakika daha. NOT: Alternatif olarak, T3 ve T4 bölgelerine yabancı bir DNA parçası eklemek için 1 μL crRNA-T3 (10 uM) ilave edin ve 30 dakika boyunca 37 ° C&#39;de bir su banyosunda inkübe edin. Başka bir 30 dakika boyunca 1 μL crRNA-T4 (10 uM) ekleyin. </li><li> 1 μL termal duyarlı alkalin fosfataz ekleyin ve tüp 37 ° C su banyosunda 1 saat daha inkübe edin. </li><li> Bir agaroz jel elektroforezi çalıştırın ve bir jel temizleme sistemi kiti kullanarak vektörü arındırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li&gt; <li> DNA parçasının Cpfl ile sindirimi <ol><li> RNase içermeyen 21.5 μL su, 4 μL 10x Cpf1 tamponu, adım 2.6&#39;dan (2 μg) plazmid 10 μL, RRI 0.5 μL ve Cpf1&#39;den (5 μM) 2 mL Tl 1.5 mL mikrosantrifüj tüpüne ekleyin. </li><li> T1 ve T2 bölgeleri içine yabancı bir DNA parçası eklemek için, 1 μL crRNA-T1 (10 μM) ve 1 μL crRNA-T3 (10 μM) ekleyin ve 37 ° C&#39;de 2 saat su banyosunda inkübe edin. NOT: Alternatif olarak, 1 μL crRNA-T2 (10 μM) ve 1 μL crRNA-T4 (10 μM) ekleyin ve 37 ° C&#39;de 2 saat su banyosunda inkübe edin. </li><li> Bir agaroz jel elektroforez çalıştırın ve bir jel temizleme sistemi kiti kullanarak parça saflaştırmak. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> C-Tuğla montajı ve ileri doğrulama <ol><li> Yabancı DNA parçasını ve C-Brick vektörünü ligatlayın: 2 μL doğrusal vektörü ekleyin (50 ng) adım 3.1.4&#39;ten ve 6 mcL DNA fragmanı (200 ng) adım 3.2.3&#39;ten 1.5 mL mikrosantrifüj tüpüne aktarılmıştır. 1 μL 10x T4 DNA ligaz tamponu ve 1 μL T4 DNA ligaz ekleyin. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li><li> E. coli (DH10B) -erkentent hücrelere kimyasal transformasyon için 10 μL ligasyon ürünlerini (adım 3.3.1) ekleyin. </li><li> 5 mL&#39;lik bir sıvı LB tüpüne birkaç klon ekleyin ve gece boyunca 220 rpm ve 37 ° C&#39;de çalkalayıcıda inkübe edin. </li><li> Bir plazmid hazırlama kiti kullanarak plazmid ayıklayın; Üreticinin protokolünü izleyin. </li><li> Sanger dizilemesi ile doğru klonları tanımlayın 11 . </li></ol></li><li> C-Tuğla montajının yeni turunu yapın. Adım 3.3.4&#39;teki doğru klonlar, adım 3.1-3.3&#39;teki aynı protokol izlenerek, tekrar tekrar C-Brick montajı için yeni bir C-Tuğla vektörü veya DNA parçası olarak kullanılabilir. NOT: T2 &#39;ve T3&#39;ünItes, T2 ve T3 bölgelerinin yedeği olarak tasarlanmıştır ( Şekil 1a ). Adım 2.3.7&#39;den elde edilen plasmidler için, sadece C-Tuğla standart montajı için T2 &#39;ve T3&#39; kullanılabilir. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Bu protokol DNA montaj standardı C-Brick için bir prosedürü açıklamaktadır. Bu protokolün en önemli adımı, C-Brick standart vektörünün doğrusallaştırılmasıdır; Vektörün tamamlanmamış bölünmesi başarı oranını ciddi şekilde etkileyebilir. Buna ek olarak, Cpf1 esas olarak &quot;18-23&quot; bölünme paterninde hedef DNA sekanslarını parçalasa da, DNA toplanmasından sonra az sayıda mutasyona neden olabilecek iki baz yakınındaki yanlişlı bölünme 4 de tespit ed...

DNA biyolojik parçalarının standardizasyonu sentetik biyolojinin gelişimi için önemlidir 1 . Bir DNA montaj prosedürünün geliştirilmesi, geçici test tasarımlarının yerini alabilir ve genetik bileşenlerin daha büyük sistemlere montajı sırasında ortaya çıkan beklenmedik sonuçların çoğunu kaldırabilir. BioBrick standardı (BBF RFC 10), önerilen en erken DNA montaj standartlarından biriydi. Önek dizisini (EcoRI ve Xbal kesim bölgeleri içeren) ve son ekleme dizisini (SpeI ve PstI kesme bölgelerini içeren) 2 , 3 kullanır . XbaI ve SpeI&#39;nin birbirine tamamlayıcı uçları olduğu için, XbaI ve SpeI ile kesilen BioBrick DNA parçaları, tekrar tekrar montaj için yeni bir BioBrick üretecek şekilde birleştirilebilir. Bazı kusurlar, BioBrick standardı 4 kullanılarak tanımlanmıştır. Örneğin, 8 bp&#39;lik bir skar üretirFüzyon proteinlerinin inşasına izin vermeyen DNA parçaları arasında. Ayrıca, yukarıda sözü edilen dört 6-bp kısıtlama sahası türü DNA parçalardan çıkarılmalıdır; bu çok rahatsız edicidir. İlk problemi çözmek için BglBrick standardı kuruldu 5 . Gly-Ser üreten ve çoklu proteinlerin veya protein alanlarının kaynaşmasına izin veren 6 bp &quot;GGATCT&quot; skarını oluşturur. IBrick, ikinci problemle başa çıkmak için geliştirildi 6 . Uzun DNA sekanslarını tanıyan homojenleştirme endonükleazları (HE) kullanır. HE tanıma siteleri nadiren doğal DNA dizilerinde mevcut olduğundan, iBrick standardı, DNA dizilerini değiştirmeden iBrick parçalarının doğrudan yapımı için kullanılabilir. Bununla birlikte, iBrick standardı DNA parçaları arasında 21 bp&#39;lik bir skar bırakır ve bu da onun hoşnutsuzluğunun nedeni olabilir. Son yıllarda kümelenmiş düzenli aralıklı kısa palindromik tekrarlar (CRISPR) sistemi hızla gelişti 7 , 8 . CRISPR ile ilişkili (Cas) proteinler arasında, Streptococcus pyogenes&#39;ten Cas9 endonuclease şimdi yaygın olarak kullanılmaktadır . Çoğunlukla künt uçları olan çift sarmal DNA kopmaları (DSB&#39;ler) getirir 9 . 2015&#39;te Zhang ve arkadaşları, Cpf1&#39;i ( Prevotella ve Francisella 1&#39;den CRISPR) ilk kez karakterize etti . Sınıf 2 tip V CRISPR-Cas sistemine aittir ve bir CRISRP RNA (crRNA) rehberli endonükleaz 10&#39;dur . Cas9&#39;un aksine, Cpf1, 4 veya 5 nt 5 &#39;çıkıntı 10 içeren bir DSB&#39;yi sunar. Bu özelliğe dayanarak Cpf1, bir DNA montaj standardı olan C-Brick 4&#39;ü geliştirmek için kullanıldı. Bir C-Tuğla standart vektöründe, ön ek T1 / T2&#39;nin ve bitişik T3 / T4&#39;ün dört Cpf1 hedef bölgesi biyolojik kısımlara kenetlenir; Bu, BioBrick standardına benzer. T2 ve T3 bölmelerinin bölünmesi pTamamlayıcı yapışkan uçları geliştirir, parçaların arasına bir &quot;GGATCC&quot; yara üretirken DNA bölümlerinin yinelemeli montajını gerçekleştirmek mümkündür. Özellikle, C-Brick standardının iki ana avantajı vardır: uzun hedef sekansları tanımak ve kısa izleri bırakmak. C-Brick tarafından üretilen 6 bp&#39;lik &quot;GGATCC&quot; skar, füzyon proteinlerinin oluşturulmasına izin veren Gly-Seriyi kodlar. Ayrıca, C-Brick standardı da kısmen BglBrick ve BioBrick standartlarıyla uyumludur.

<table><tbody><tr><td>Comercial Oligonucleotide</td><td>Sangon Biotech</td><td></td><td></td></tr><tr><td>10x Taq PCR Buffer</td><td>Transgen</td><td>#J40928</td><td></td></tr><tr><td>Ultra Pure Distilled Water</td><td>Invitrogen</td><td>10977-015</td><td></td></tr><tr><td>5x RNA Transcription Buffer</td><td>Thermo Scientific</td><td>K0441</td><td></td></tr><tr><td>T7 RNA polymerase</td><td>Thermo Scientific</td><td>#EP0111</td><td></td></tr><tr><td>NTP mixture</td><td>Sangon</td><td>#ND0056</td><td></td></tr><tr><td>RRI (Recombinant RNase Inhibitor)</td><td>Takara</td><td>2313A</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td></td></tr><tr><td>UV-Vis Spectrometer</td><td>Thermo Scientific</td><td>Nano-Drop 2000c</td><td></td></tr><tr><td>2x Phanta Max Buffer</td><td>Vazyme</td><td>PB505</td><td>PCR buffer</td></tr><tr><td>dNTPs</td><td>Transgen</td><td>AD101</td><td></td></tr><tr><td>Phanta Max Super-Fidelity DNA Polymerase</td><td>Vazyme</td><td>P505-d1</td><td></td></tr><tr><td>Ezmax for One-step Cloning</td><td>Tolobio</td><td>24303-1</td><td>seamless assembly kit</td></tr><tr><td>5x Buffer for Ezmax One-step Cloning</td><td>Tolobio</td><td>32006</td><td></td></tr><tr><td>BamHI</td><td>NEB</td><td>#R0136L</td><td></td></tr><tr><td>BamHI-HF</td><td>NEB</td><td>#R3136L</td><td></td></tr><tr><td>BglII&amp;nbsp;</td><td>NEB</td><td>#R0144L</td><td></td></tr><tr><td>XbaI</td><td>NEB</td><td>#R0145L</td><td></td></tr><tr><td>SpeI</td><td>NEB</td><td>#R3133L</td><td></td></tr><tr><td>10x Buffer 3</td><td>NEB</td><td>#B7003S</td><td></td></tr><tr><td>10x CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>10x T4 DNA ligase Buffer</td><td>Tolobio</td><td>32002</td><td></td></tr><tr><td>T4 PNK</td><td>Tolobio</td><td>32206</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Tolobio</td><td>32210</td><td></td></tr><tr><td>DpnI</td><td>NEB</td><td>#R01762</td><td></td></tr><tr><td>SV Gel and PCR clean-up system</td><td>Promega</td><td>A9282</td><td></td></tr><tr><td>Plasmid Mini Kit I</td><td>Omega</td><td>D6943-02</td><td>plasmid preparation kit</td></tr><tr><td>thermosensitive alkaline phosphatase&amp;nbsp;</td><td>Thermo Scientific</td><td>#EF0651</td><td>FastAP</td></tr><tr><td>10x Cpf1 buffer</td><td>Tolobio</td><td>32008</td><td></td></tr><tr><td>Cpf1</td><td>Tolobio</td><td>32105</td><td>FnCpf1</td></tr><tr><td>thermocycler</td><td>Applied Biosystems</td><td>veriti 96 well</td><td></td></tr><tr><td>C-Brick standard vector</td><td>Tolobio</td><td>98101</td><td></td></tr><tr><td>E. coli [DH10B]</td><td>Invitrogen</td><td>18297010</td><td></td></tr><tr><td>Luria-Bertani media (tryptone)</td><td>Oxoid</td><td>LP0042</td><td></td></tr><tr><td>Luria-Bertani media (yeast extract)</td><td>Oxoid</td><td>LP0021</td><td></td></tr><tr><td>Luria-Bertani media (NaCl)</td><td>Sangon Biotech</td><td>B126BA0007</td><td></td></tr></tbody></table>

protocols for c-brick dna standard assembly using cpf1

CRISPR ile ilişkili protein Cpf1 çift sarmallı DNA&#39;yı CRISPR RNA&#39;nın (crRNA) rehberliğinde parçalayıp yapışkan uçlar üretir. Bu özellikten dolayı Cpf1, C-Brick adı verilen ve uzun tanıma yerleri ve kısa izlerin avantajına sahip bir DNA montaj standardının oluşturulması için kullanılmıştır. Standart bir C-Tuğla vektöründe, dört Cpf1 tanıma bölgesi vardır - ön ek (T1 ve T2 siteleri) ve son ek (T3 ve T4 bölgeleri) - biyolojik DNA parçalarını çevreleyen. T2 ve T3 bölgelerinin bölünmesi tamamlayıcı yapışkan uçlar üretir ve bu da T2 ve T3 bölgeleriyle DNA parçalarının birleştirilmesini sağlar. Bu arada, montajdan sonra parçalar arasında kısa bir &quot;GGATCC&quot; skarı meydana gelir. Yeni oluşturulan plazmid dört kez Cpf1 bölünme yerini bir kez daha içerdiğinden yöntem, DNA parçalarının yinelenen montajını sağlar ve bu da, BioBrick ve BglBrick standartlarına benzer. DNA parçalarını bir araya getirmek için C-Brick standardının kullanımını özetleyen bir prosedürBurada açıklanmaktadır. C-Brick standardı, bilim adamları, lisansüstü öğrenciler ve lisans öğrencileri ve hatta amatörler tarafından yaygın bir şekilde kullanılabilir.

<html> Bu protokol, üç kromoprotein kasetinin (cjBlue (BBa_K592011), red (BBa_K592012) ve amilGFP&#39;nin (BBa_K592010) montajını gösterdi. Birincisi, yukarıda bahsedilen üç genin ve sonlandırıcıların kodlama dizileri ayrı ayrı bir C-Brick standart vektörüne klonlanmıştır. Kısa DNA kısımları, promotör ve terminatör, 5 &#39;terminalindeki kısa DNA kısımlarını içeren primerler kullanılarak PCR amplifikasyonuyla C-Brick vektörüne sokuldu. Bunu self-ligasyon ...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR ile ilişkili protein Cpf1, özel olarak tasarlanmış bir CRISPR RNA (crRNA) yardımıyla, istenilen noktalarda çift sarmallı DNA&#39;yı parçalayıp yapışkan uçlar üretebilir. Bu karakteristiğe dayanarak, bir DNA montaj standardı (C-Brick) oluşturuldu ve kullanımını ayrıntılandıran bir protokol burada açıklandı.

Cpf1&#39;i Kullanarak C-Brick DNA Standart Montajı İçin Protokoller

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Universidad San Sebastian

Research

JoVE Journal

Genetics

8.2K Görüntüleme.  Chinese Academy of Sciences.  CRISPR ile ilişkili protein Cpf1, özel olarak tasarlanmış bir CRISPR RNA (crRNA) yardımıyla, istenilen noktalarda çift sarmallı DNA'yı parçalayıp yapışkan uçlar üretebilir. Bu karakteristiğe dayanarak, bir DNA montaj standardı (C-Brick) oluşturuldu ve kullanımını ayrıntılandıran bir protokol burada açıklandı. 

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native &beta;-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFD&alpha; and &beta;, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFD&alpha; and &beta; improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via &beta;-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

Sulu Ortamlarda Hidrokarbon Dönüşüm Enable A Toolkit

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

Biyomühendislik

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

Dize birleştirme gRNA için özelleştirilebilir bir protokol klonlama (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Genetik

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D DNA nanostructures. Over decades, the rapid development of DNA nanotechnology is attributed to the use of linear DNAs as the source materials. For example, the DAO (double crossover, antiparallel, odd half-turns) tile is well-known as a building block for construction of 2D DNA lattices; the core structure of DAO is made from two linear single-stranded (ss) oligonucleotides, like two ropes making a right hand granny&#160;knot. Herein, a new type of DNA tiles called cDAO (coupled DAO) are built using a small circular ss-DNA of c64nt or c84nt (circular 64 or 84 nucleotides) as the scaffold strand and several linear ss-DNAs as the staple strands. Perfect 1D and 2D nanostructures are assembled from cDAO tiles: infinite nanowires, nanospirals, nanotubes, nanoribbons; and finite nano-rectangles. Detailed protocols are described: 1) preparation by T4 ligase and purification by denaturing PAGE (polyacrylamide gel electrophoresis) of small circular oligonucleotides, 2) annealing of stable circular tiles, followed by native PAGE analysis, 3) assembling of infinite 1D nanowires, nanorings, nanospirals, infinite 2D lattices of nanotubes and nanoribbons, and finite 2D nano-rectangles, followed by AFM (Atomic Force Microscopy) imaging. The method is simple, robust, and affordable for most labs.

This article presents a detailed protocol for T4 ligation and denaturing PAGE purification of small circular DNA molecules, annealing and native PAGE analysis of circular tiles, assembling and AFM imaging of 1D and 2D DNA nanostructures, as well as agarose gel electrophoresis and centrifugation purification of finite DNA nanostructures.

İstikrarlı DNA motifleri, 1D ve 2D nanoyapıların küçük dairesel DNA molekülleri inşa

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D ...

Kimya

Lisans Araştırma ve Öğretimi için Kromozom Konformasyon Yakalama (3C)

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Yazar Spotlight: 3C'lerle A Almak: Lisans Öğrencileri için Kromozom Konformasyonu Yakalama  

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

3C'lerle A Almak: Lisans Öğrencileri için Kromozom Konformasyon Yakalama

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 &#176;C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.

Bimoleküler Floresan tamamlama ile fotoaktive Yerelleştirme Mikroskobu (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and ...

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Robot sıvı işleme derleme modüler DNA cihazların otomatik

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, into close spatial proximity 2-6. Deciphering the relationship between chromosome organization and genome activity will aid in understanding genomic processes, like transcription and replication. However, little is known about how chromosomes fold. Microscopy is unable to distinguish large numbers of loci simultaneously or at high resolution. To date, the detection of chromosomal interactions using chromosome conformation capture (3C) and its subsequent adaptations required the choice of a set of target loci, making genome-wide studies impossible 7-10.
We developed Hi-C, an extension of 3C that is capable of identifying long range interactions in an unbiased, genome-wide fashion. In Hi-C, cells are fixed with formaldehyde, causing interacting loci to be bound to one another by means of covalent DNA-protein cross-links. When the DNA is subsequently fragmented with a restriction enzyme, these loci remain linked. A biotinylated residue is incorporated as the 5' overhangs are filled in. Next, blunt-end ligation is performed under dilute conditions that favor ligation events between cross-linked DNA fragments. This results in a genome-wide library of ligation products, corresponding to pairs of fragments that were originally in close proximity to each other in the nucleus. Each ligation product is marked with biotin at the site of the junction. The library is sheared, and the junctions are pulled-down with streptavidin beads. The purified junctions can subsequently be analyzed using a high-throughput sequencer, resulting in a catalog of interacting fragments.
Direct analysis of the resulting contact matrix reveals numerous features of genomic organization, such as the presence of chromosome territories and the preferential association of small gene-rich chromosomes. Correlation analysis can be applied to the contact matrix, demonstrating that the human genome is segregated into two compartments: a less densely packed compartment containing open, accessible, and active chromatin and a more dense compartment containing closed, inaccessible, and inactive chromatin regions. Finally, ensemble analysis of the contact matrix, coupled with theoretical derivations and computational simulations, revealed that at the megabase scale Hi-C reveals features consistent with a fractal globule conformation.

The Hi-C method allows unbiased, genome-wide identification of chromatin interactions (1). Hi-C couples proximity ligation and massively parallel sequencing. The resulting data can be used to study genomic architecture at multiple scales: initial results identified features such as chromosome territories, segregation of open and closed chromatin, and chromatin structure at the megabase scale.

Hi-C: genomların Üç boyutlu Mimari Eğitim Bir Yöntem.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, ...

Biyoloji

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure. Each chromosome occupies a specific territory, that may change according to stage of development or cell cycle. Gene expression can occur in specialized transcriptional factories where chromatin segments may loop out from various chromosome territories, leading to co-localization of DNA segments which may exist on different chromosomes or far apart on the same chromosome. The Associated Chromosome Trap (ACT) assay provides an effective methodology to identify these long-range DNA associations in an unbiased fashion by extending and modifying the chromosome conformation capture technique. The ACT assay makes it possible for us to investigate mechanisms of transcriptional regulation in trans, and can help explain the relationship of nuclear architecture to gene expression in normal physiology and during disease states.

The associated chromosome trap (ACT) assay is a novel unbiased method for identifying long-range DNA interactions. The characterization of long range DNA interactions will allow us to determine the relationship of nuclear architecture to gene expression in both normal physiology and in diseased states.

Uzun menzilli DNA Etkileşimleri belirlenmesi için İlişkili Kromozom Tuzak

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure.  Each chromosome occupies a specific territory, ...

Cpf1'i Kullanarak C-Brick DNA Standart Montajı İçin Protokoller

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Sulu Ortamlarda Hidrokarbon Dönüşüm Enable A Toolkit

Dize birleştirme gRNA için özelleştirilebilir bir protokol klonlama (STAgR)

İstikrarlı DNA motifleri, 1D ve 2D nanoyapıların küçük dairesel DNA molekülleri inşa

3C'lerle A Almak: Lisans Öğrencileri için Kromozom Konformasyon Yakalama

3C'lerle A Almak: Lisans Öğrencileri için Kromozom Konformasyon Yakalama

3C'lerle A Almak: Lisans Öğrencileri için Kromozom Konformasyon Yakalama

Bimoleküler Floresan tamamlama ile fotoaktive Yerelleştirme Mikroskobu (BiFC-PALM)

Robot sıvı işleme derleme modüler DNA cihazların otomatik

Hi-C: genomların Üç boyutlu Mimari Eğitim Bir Yöntem.

Uzun menzilli DNA Etkileşimleri belirlenmesi için İlişkili Kromozom Tuzak