Name: protocols for c-brick dna standard assembly using cpf1
Uploaded: 2017-06-15T14:00:00.000+00:00
Duration: 12 min 3 s
Description: Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Wir danken Shanghai Tolo Biotech für ihre technische Unterstützung bei der Entwicklung des C-Brick Standards. Diese Arbeit wurde durch Zuschüsse aus dem Strategischen Schwerpunktforschungsprogramm der Chinesischen Akademie der Wissenschaften (Grant Nr. XDB19040200) unterstützt.

1. Vorbereitung von crRNA <ol><li> Vorbereitung von crRNA-Vorlagen <ol><li> Die Oligonukleotide ( Tabelle 1 ) in RNase-freiem Wasser bis zu einer Konzentration von 10 μM erneut suspendieren. </li><li> Füge 22,5 μl Top-Strang-Oligonukleotid (T7-F in Tabelle 1 ), 22,5 μl Bottomstrang-Oligonukleotid ( Tabelle 1 ) und 5 μl 10x-Annealing-Puffer zu einem 0,2-ml-PCR-Röhrchen hinzu. Stellen Sie sicher, dass das Gesamtvolumen 50 μl beträgt. ANMERKUNG: Sechs verschiedene untere Strang-Oligonukleotide sind in Tabelle 1 gezeigt , von denen jede einzeln mit dem Top-Strang T7-F gepaart werden sollte. Die Kleinbuchstaben in Tabelle 1 stellen die zu transkribierende Sequenz in die Führungssequenz von crRNA dar. 10x Taq PCR Puffer kann anstelle des 10x Glühpuffers verwendet werden. </li><li> Legen Sie die PCR-Röhre in einen Thermocycler. </li><li> Führen Sie das Glühprogramm aus: anfängliche Denaturierung bei 95 ° C für5 min und dann eine Abklingzeit von 95-20 ° C, mit einer 1 ° C Abnahme pro Minute auf dem Thermocycler. HINWEIS: Sofort die Proben für Schritt 1.2.1 verwenden. </li></ol></li><li> Transkription und Reinigung von crRNA <ol><li> Zugabe von 38 μl RNase-freiem Wasser, 8 μl der Matrize aus Schritt 1.1.4, 20 μl 5x T7 Transkriptionspuffer, 20 μl NTP-Gemisch (10 μM), 4 μl rekombinantem RNase-Inhibitor (RRI) und 10 ΜL T7-RNA-Polymerase zu einem 1,5 ml-Mikrozentrifugenröhrchen. Stellen Sie sicher, dass das Gesamtvolumen 100 μl beträgt. </li><li> Das Mikrozentrifugenröhrchen über Nacht in ein 37 ° C Wasserbad geben (ca. 16 h). </li><li> Verwenden Sie einen RNA-Cleanup- und Konzentrations-Kit, um die transkribierte RNA zu reinigen. Folgen Sie dem Protokoll des Herstellers. </li><li> Quantifizieren Sie die RNAs mit UV-Vis-Spektrophotometern und verdünnen Sie die RNA auf eine Konzentration von 10 μM. Benutzen Sie die Proben sofort oder lagern Sie sie bei -80 ° C. HINWEIS: Die crRNA-SequenzS sind in Tabelle 2 aufgelistet . </li></ol></li></ol> 2. Konstruktion von C-Brick Parts ( dh das Einfügen von biologischen Teilen in einen C-Brick Standard Vector) HINWEIS: Dieser Schritt hat drei Teilschritte. Für kurze biologische Teile ( z. B. Promotoren und Terminatoren) ist es am besten, die direkte PCR-Methode zu verwenden, um die biologischen Teile in einen C-Brick-Standardvektor 4 einzusetzen. Die gesamte Vektorsequenz wird in den ergänzenden Daten gezeigt, und die Präfix- und Suffixsequenz ist in Fig. 1 gezeigt (Schritt 2.1, unten). Für biologische Teile, die leicht über PCR erhalten werden können ( z. B. mit Templaten von genomischen DNA, Plasmiden oder de novo synthetisierten DNA-Sequenzen), ist es am besten, das nahtlose Assemblierungsverfahren zu verwenden, um die biologischen Teile in einen C-Brick-Standardvektor einzusetzen (Schritt 2.2, unten). Für diejenigen Teile aus BioBrick und BglBrick Standards, BeschränkungEnzym-vermittelte Verdauung und T4-DNA-Ligase-vermittelte Ligation können verwendet werden, um die biologischen Teile in einen C-Brick-Standardvektor einzusetzen (Schritt 2.3 unten). <ol><li> Aufbau durch direkte PCR-Verstärkung <ol><li> Oligonukleotide für die PCR-Amplifikation aufbauen und bestellen. HINWEIS: Das 5&#39;-Ende des Oligonukleotids enthält die Sequenz des DNA-Teils und das 3&#39;-Ende des Oligonukleotids enthält die Vektorsequenz ( dh &quot;GGATCCACTAGTCTCTAGCTCG&quot; am 3&#39;-Ende des Vorwärtsstranges und &quot;GGATCCTTTCTCCTCTTTCTAG&quot; Im umgekehrten strang). Entweder kann kein Überhang oder ein ~ 20-bp-Überhang am 5&#39;-Ende des Oligonukleotids entworfen werden. Spezielle Beispiele finden sich in einer früheren Studie 4 . </li><li> Die Oligonukleotide in ultrareinem Wasser bis zu einer Konzentration von 10 μM erneut suspendieren. </li><li> PCR-Reaktionen auf Eis in einem 0,2-ml-PCR-Röhrchen aufbauen: 18 μl ultrareines Wasser geben, 25 μl 2x PCR-Puffer, 1 &amp; mgr; l DNTPs (10 &amp; mgr; M), jeweils 2,5 &amp; mgr; l der Vorwärts- und Rückwärtsprimer (10 &amp; mgr; M) aus Schritt 2.1.2, 0,5 &amp; mgr; l C-Brick-Standardvektor (50 ng) als Matrize und 0,5 &amp; mgr; l Von High-Fidelity-DNA-Polymerase. Stellen Sie sicher, dass das Gesamtvolumen 50 μl beträgt. </li><li> Legen Sie die Röhre direkt in einen Thermocycler und starten Sie das Thermocycler-Programm. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li><li> Thermocycler-Programm: ein Zyklus für 3 min bei 98 ° C; Dreißig Zyklen für 10 s bei 98 ° C, 20 s bei 55 ° C und 2 min bei 72 ° C; Und einen Zyklus für 10 min bei 72 ° C. Halten Sie die Probe bei 16 ° C. </li><li> Zugabe von 9 μl der Mischung aus Schritt 2.1.4 zu einem 1,5 mL Mikrozentrifugenröhrchen. </li><li> 1 μl DpnI zugeben und 1 h in einem Wasserbad von 37 ° C inkubieren. HINWEIS: Wenn die Primer keine überlappenden Sequenzen haben, fügen Sie 0,5 μl T4-Polynukleotidkinase (PNK) und 0,5 μl T4-DNA-Ligase hinzu und inkubieren inEin 22 ° C Wasserbad für 1 h. Andernfalls, wenn die Primer eine ~ 20 nt überlappende Sequenz enthalten, transformieren Sie die DpnI-behandelten Produkte direkt in E. coli (DH10B) -kompetente Zellen (Schritt 2.4). Das linearisierte PCR-Produkt wird durch das Rekombinationssystem im Wirt zirkuliert. </li><li> Benutzen Sie die Proben sofort oder lagern Sie sie bei -20 ° C. </li></ol></li><li> Aufbau durch nahtlose Montage <ol><li> Oligonukleotide für die PCR-Amplifikation aufbauen und bestellen. HINWEIS: Das 3&#39;-Ende des Oligonukleotids enthält die terminale Sequenz des DNA-Teils und das 5&#39;-Ende des Oligonukleotids enthält das Ende der linearisierten C-Brick-Standard-Vektorsequenz ( dh &quot;CTAGAAAGAGGAGAAAGGATCC&quot; für die 5&#39;- -end des vorderen Strangs und &quot;CGAGCTAGAGACTAGTGGATCC&quot; für das 5&#39;-Ende des umgekehrten Strangs). Spezielle Beispiele finden sich in einer früheren Studie 4 . </li><li> Das einzeln aussetzenUal-Oligonukleotiden in ultrareinem Wasser bis zu einer Konzentration von 10 μM </li><li> PCR-Reaktionen auf Eis in einem 0,2-ml-PCR-Röhrchen aufbauen: 18 μl ultrareines Wasser, 25 μl 2x PCR-Puffer, 1 μl dNTPs (10 μM), 2,5 μl jeweils die Vorwärts- und Rückwärtsprimer (10 μM ) Aus Schritt 2.2.2, 0,5 μl Schablone (20-500 ng) und 0,5 μl hochflexitiver DNA-Polymerase. Stellen Sie sicher, dass das Gesamtvolumen 50 μl beträgt. </li><li> Legen Sie den Schlauch direkt in den Thermocycler und führen Sie das Thermocycler-Programm. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. HINWEIS: Das Thermocycler-Programm auf: einen Zyklus für 3 min bei 98 ° C einstellen; 30 Zyklen für 10 s bei 98 ° C, 20 s bei 55 ° C (nach der Glühtemperatur des Primers) und 1 min (je nach Länge der biologischen Teile) bei 72 ° C; Und einen Zyklus für 10 min bei 72 ° C. Halten Sie die Probe bei 16 ° C. </li><li> Reinigen Sie das PCR-Produkt mit einem PCR Cleanup SysTem kit; Folgen Sie dem Protokoll des Herstellers. </li><li> Digitieren Sie den C-Brick-Standardvektor mit BamHI: Fügen Sie 34 μl ultrareines Wasser, 10 μl Plasmid (1 μg), 5 μl 10x Puffer und 1 μl BamHI zum Mikrozentrifugenröhrchen hinzu. Inkubieren für bis zu 2 h bei 37 ° C im Wasserbad. </li><li> Reinigen Sie das obige Produkt mit einem Gel Cleanup System Kit; Folgen Sie dem Protokoll des Herstellers. </li><li> Füge 2 μl linearisierter Vektor (50 ng) aus Schritt 2.2.7, 5 μl Fragment (200 ng) aus Schritt 2.2.4, 2 μl 5x nahtloser Montagepuffer und 1 μl nahtloses Montageenzym aus einem nahtlosen Montagekit hinzu Zu einem 1,5-ml-Mikrozentrifugenröhrchen. Stellen Sie sicher, dass das Gesamtvolumen 10 μl beträgt. </li><li> Legen Sie diese in ein 37 ° C Wasserbad für 30 min. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li></ol></li><li> Aufbau durch Restriktionsenzym-vermittelte Verdauung und T4-DNA-Ligase-vermittelte Ligation. HINWEIS: Für diejenigen Teile, die aus dem BioBrick (Schritt 2.3.4-2.3.7) und BglBrick (Schritt 2.3.1-2.3.3) Standards gewonnen wurden, können Restriktionsenzym-vermittelte Verdauung und T4-DNA-Ligase-vermittelte Ligation verwendet werden, um die Biologischen Teilen in einen C-Brick-Standard-Vektor. <ol><li> Die BglBrick-Standardteile mit BamHI und BglII verdauen: 34 μl ultrareines Wasser, 10 μl Plasmid (2 μg), 5 μl 10x Puffer 3, 0,5 μl BamHI und 0,5 μl BglII in das Mikrozentrifugenröhrchen geben. Inkubieren für 2 h in einem 37 ° C Wasserbad. </li><li> Führen Sie eine 1% Agarose-Gelelektrophorese und reinigen Sie das Fragment mit einem Gel Cleanup System Kit. </li><li> Ligat das Fragment und der C-Brick-Standardvektor: 2 μl linearisierter Vektor (50 ng) aus Schritt 2.1.12 und 6 μl Fragment (200 ng) aus Schritt 2.3.3 zu einem 1,5 mL Mikrozentrifugenröhrchen zugeben. Füge 1 μl 10 x T4 DNA Ligase Puffer und 1 μl T4 DNA Ligase hinzu. Inkubieren für 2 h bei 22 ° C. Benutzen Sie die Proben sofort oder freezE und lagern bei -20 ° C. </li><li> Diginieren Sie die BioBrick-Standardteile mit XbaI und SpeI: Fügen Sie 34 μl ultrareines Wasser, 10 μl Plasmid (2 μg), 5 μl 10x Puffer, 0,5 μl XbaI und 0,5 μl SpeI zum Mikrozentrifugenröhrchen hinzu. Inkubieren für 2 h in einem 37 ° C Wasserbad. </li><li> Digzen Sie den C-Brick-Standardvektor mit XbaI und SpeI: Fügen Sie 34 μl ultrareines Wasser, 10 μl Plasmid (1 μg), 5 μl 10x Puffer, 0,5 μl XbaI und 0,5 μl SpeI zum Mikrozentrifugenröhrchen hinzu . Inkubieren für 2 h in einem 37 ° C Wasserbad. </li><li> Führen Sie eine 1% Agarose-Gelelektrophorese aus und reinigen Sie das Fragment aus Schritt 2.3.4 und den linearisierten Vektor aus Schritt 2.3.5 mit einem Gel-Cleanup-System-Kit; Nach dem Protokoll des Herstellers. </li><li> Ligat das Fragment und der C-Brick-Vektor: 2 μl linearisierter Vektor (50 ng) aus Schritt 2.3.5 und 6 μl Fragment (200 ng) aus Schritt 2.3.4 zu einem 1,5 mL Mikrozentrifugenröhrchen zugeben. AnzeigeD 1 &amp; mgr; l 10 × T4-DNA-Ligasepuffer und 1 &amp; mgr; l T4-DNA-Ligase. Inkubieren für 2 h bei 22 ° C. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li></ol></li><li> Fügen Sie 10 μl der Produkte aus Schritt 2.1.8, 2.2.9, 2.3.3 oder 2.3.7 für die chemische Umwandlung in die kompetenten Zellen von E. coli (DH10B) hinzu. </li><li> Nehmen Sie mehrere Klone zu einem 5-ml flüssigen Luria-Bertani (LB) Röhrchen auf und inkubieren bei 37 ° C auf einem Shaker (220 U / min) über Nacht. </li><li> Extrahieren des Plasmids unter Verwendung eines Plasmidpräparationskits; Folgen Sie dem Protokoll des Herstellers. </li><li> Identifizierung der richtigen Klone durch Sanger-Sequenzierung 11 . </li></ol> 3. C-Brick Assembly ( Abbildung 2 ) <ol><li> Verdauung des C-Brick-Vektors mit Cpf1 <ol><li> Füge 22,5 μl RNase-freies Wasser, 4 μl 10x Cpf1-Puffer, 10 μl des Plasmids aus Schritt 2.6 (1 μg), 0,5 μl RRI und 1 &amp;# 181; L von Cpf1 (5 μM) zu einem 1,5-mL-Mikrozentrifugenröhrchen. HINWEIS: Cpf1 kann nach einer vorherigen Studie kommerziell gekauft oder gereinigt werden. </li><li> Um ein fremdes DNA-Fragment in die T1- und T2-Stellen einzufügen, wird 1 μl CrRNA-T2 (10 μM) zugegeben und in einem Wasserbad bei 37 ° C für 30 min inkubiert. Eine dd 1 &amp; mgr; l CrRNA-T1 (10 &amp; mgr; M) und Cpf1 (5 &amp; mgr; M) für weitere 30 min. HINWEIS: Um ein fremdes DNA-Fragment in die T3- und T4-Stellen einzufügen, fügen Sie 1 μl CrRNA-T3 (10 μM) hinzu und inkubieren in einem Wasserbad bei 37 ° C für 30 min. 1 &amp; mgr; l CrRNA-T4 (10 &amp; mgr; M) für weitere 30 min zugeben. </li><li> 1 &amp; mgr; l wärmeempfindliche alkalische Phosphatase zugeben und das Röhrchen in einem 37 ° C Wasserbad für weitere 1 h inkubieren. </li><li> Führen Sie eine Agarose-Gelelektrophorese durch und reinigen Sie den Vektor mit einem Gel-Cleanup-System-Kit. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li></ol></Li&gt; <li> Verdauung des DNA-Fragments mit Cpf1 <ol><li> Fügen Sie 21,5 μl RNase-freies Wasser, 4 μl 10x Cpf1-Puffer, 10 μl Plasmid aus Schritt 2.6 (2 μg), 0,5 μl RRI und 2 μL Cpf1 (5 μM) zu einem 1,5-mL-Mikrozentrifugenröhrchen hinzu. </li><li> Um ein fremdes DNA-Fragment in die T1- und T2-Stellen einzufügen, werden 1 μl CrRNA-T1 (10 μM) und 1 μl CrRNA-T3 (10 μM) zugegeben und in einem Wasserbad bei 37 ° C für 2 h inkubiert. HINWEIS: Alternativ dazu 1 μl CrRNA-T2 (10 μM) und 1 μl crRNA-T4 (10 μM) zugeben und in einem Wasserbad bei 37 ° C für 2 h inkubieren. </li><li> Führen Sie eine Agarose-Gelelektrophorese durch und reinigen Sie das Fragment mit einem Gel-Cleanup-System-Kit. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li></ol></li><li> C-Brick Montage und weitere Überprüfung <ol><li> Ligat das fremde DNA-Fragment und C-Brick-Vektor: 2 μl des linearisierten Vektors (50 ng) aus Schritt 3.1.4 und 6 μl des DNA-Fragments (200 ng) aus Schritt 3.2.3 zu einem 1,5 mL Mikrozentrifugenröhrchen. Füge 1 μl 10x T4 DNA Ligase Puffer und 1 μl T4 DNA Ligase hinzu. Inkubieren für 2 h bei 22 ° C. Benutzen Sie die Proben sofort oder gefrieren Sie sie und lagern Sie sie bei -20 ° C. </li><li> Fügen Sie 10 μl der Ligationsprodukte (Schritt 3.3.1) für die chemische Umwandlung in E. coli (DH10B) -kompetenten Zellen hinzu. </li><li> Fügen Sie mehrere Klone zu einem 5 ml flüssigen LB-Röhrchen hinzu und inkubieren Sie über Nacht auf einem Schüttler bei 220 U / min und 37 ° C. </li><li> Extrahieren des Plasmids unter Verwendung eines Plasmidpräparationskits; Folgen Sie dem Protokoll des Herstellers. </li><li> Identifizieren Sie korrekte Klone durch Sanger-Sequenzierung 11 . </li></ol></li><li> Führen Sie eine neue Runde von C-Brick Montage. Korrekte Klone aus Schritt 3.3.4 können als neuer C-Brick-Vektor oder DNA-Teil für weitere iterative C-Brick-Assembly nach dem gleichen Protokoll aus den Schritten 3.1-3.3 verwendet werden. HINWEIS: T2 &#39;und T3&#39; sItes sind als Backup von T2- und T3-Standorten konzipiert ( Abbildung 1a ). Für Plasmide, die aus Schritt 2.3.7 erhalten wurden, können nur T2 &#39;und T3&#39; für die C-Brick-Standardanordnung verwendet werden. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

Die Autoren haben nichts zu offenbaren.

Dieses Protokoll beschreibt ein Verfahren für den DNA-Assemblierungsstandard C-Brick. Der wichtigste Schritt in diesem Protokoll ist die Linearisierung des C-Brick-Standardvektors; Eine unvollständige Spaltung des Vektors könnte die Erfolgsquote ernsthaft beeinträchtigen. Zusätzlich, obwohl Cpf1 hauptsächlich Ziel-DNA-Sequenzen in dem &quot;18-23&quot; -Spaltmuster spaltet, wurde auch eine ungenaue Spaltung nahe den beiden Basen 4 nachgewiesen, was eine kleine Anzahl von Mutationen nach der...

Die Standardisierung von DNA-biologischen Teilen ist wichtig für die Entwicklung der synthetischen Biologie 1 . Die Entwicklung eines DNA-Assemblierungsverfahrens kann Ad-hoc- experimentelle Entwürfe ersetzen und viele der unerwarteten Ergebnisse entfernen, die bei der Montage von genetischen Komponenten in größere Systeme entstehen. Der BioBrick Standard (BBF RFC 10) war einer der frühesten vorgeschlagenen DNA Assembly Standards. Es verwendet die Präfixsequenz (die EcoRI- und XbaI-Schneidstellen enthält) und die Suffixsequenz (die SpeI- und PstI-Schneidstellen enthält) 2 , 3 . Da XbaI und SpeI komplementäre zusammenhängende Enden haben, können BioBrick DNA-Teile, die mit XbaI und SpeI geschnitten werden, miteinander verbunden werden und einen neuen BioBrick für eine weitere iterative Montage erzeugen. Bei der Verwendung des BioBrick-Standards 4 wurden einige Mängel festgestellt. Zum Beispiel produziert es eine 8-bp-NarbeZwischen den DNA-Teilen, die nicht die Konstruktion von In-Fusionsproteinen ermöglicht. Außerdem müssen die vier vorgenannten Typen von 6-bp-Restriktionsstellen aus den DNA-Teilen entfernt werden, was sehr unpraktisch ist. Der BglBrick-Standard wurde eingerichtet, um das erste Problem zu lösen 5 . Es schafft eine 6-bp &quot;GGATCT&quot; Narbe, die Herstellung von Gly-Ser und ermöglicht die Fusion von mehreren Proteinen oder Protein-Domains. IBrick wurde entwickelt, um mit dem zweiten Problem umzugehen 6 . Es verwendet Homing-Endonukleasen (HEs), die lange DNA-Sequenzen erkennen. Da die Erkennungsstandorte selten in natürlichen DNA-Sequenzen existieren, kann der iBrick-Standard für den direkten Aufbau von iBrick-Teilen ohne Modifikation ihrer DNA-Sequenzen verwendet werden. Allerdings verlässt der iBrick-Standard eine 21 bp-Narbe zwischen den DNA-Teilen, was der Grund für seine Unbeliebtheit sein könnte. In den letzten Jahren gingen die gruppierten regelmäßig kurzen palindromischen Wiederholungen (CRIS) zusammenPR) System hat sich schnell entwickelt 7 , 8 . Unter den CRISPR-assoziierten (Cas) Proteinen ist Cas9 Endonuklease aus Streptococcus pyogenes heute weit verbreitet . Es führt meist doppelsträngige DNA-Pausen (DSBs) mit stumpfen Enden 9 ein . Im Jahr 2015 charakterisierten Zhang und Mitarbeiter Cpf1 (CRISPR von Prevotella und Francisella 1) zum ersten Mal. Es gehört zum Klasse-2-Typ-V-CRISPR-Cas-System und ist eine CRISRP-RNA (crRNA) -geführte Endonuklease 10 . Im Gegensatz zu Cas9 führt Cpf1 einen DSB mit einem 4 oder 5 nt 5 &#39;Überhang 10 ein . Basierend auf dieser Eigenschaft wurde Cpf1 verwendet, um einen DNA-Assemblystandard C-Brick 4 zu entwickeln. Auf einem C-Brick-Standardvektor flankieren vier Cpf1-Zielstellen von vorangestellten T1 / T2 und suffixed T3 / T4 die biologischen Teile; Dies ähnelt dem BioBrick-Standard. Als Spaltung von T2- und T3-Stellen pFührt zu komplementären klebrigen Enden, es ist möglich, die iterative Anordnung von DNA-Teilen durchzuführen, während eine &quot;GGATCC&quot; Narbe zwischen den Teilen erzeugt wird. Bemerkenswerterweise hat der C-Brick-Standard zwei Hauptvorteile: Erkennung langer Zielsequenzen und kurzer Narben. Die von C-Brick erzeugte 6 bp &quot;GGATCC&quot; Narbe kodiert Gly-Ser, was den Aufbau von Fusionsproteinen ermöglicht. Darüber hinaus ist der C-Brick-Standard auch teilweise mit den BglBrick- und BioBrick-Standards kompatibel.

<table><tbody><tr><td>Comercial Oligonucleotide</td><td>Sangon Biotech</td><td></td><td></td></tr><tr><td>10x Taq PCR Buffer</td><td>Transgen</td><td>#J40928</td><td></td></tr><tr><td>Ultra Pure Distilled Water</td><td>Invitrogen</td><td>10977-015</td><td></td></tr><tr><td>5x RNA Transcription Buffer</td><td>Thermo Scientific</td><td>K0441</td><td></td></tr><tr><td>T7 RNA polymerase</td><td>Thermo Scientific</td><td>#EP0111</td><td></td></tr><tr><td>NTP mixture</td><td>Sangon</td><td>#ND0056</td><td></td></tr><tr><td>RRI (Recombinant RNase Inhibitor)</td><td>Takara</td><td>2313A</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td></td></tr><tr><td>UV-Vis Spectrometer</td><td>Thermo Scientific</td><td>Nano-Drop 2000c</td><td></td></tr><tr><td>2x Phanta Max Buffer</td><td>Vazyme</td><td>PB505</td><td>PCR buffer</td></tr><tr><td>dNTPs</td><td>Transgen</td><td>AD101</td><td></td></tr><tr><td>Phanta Max Super-Fidelity DNA Polymerase</td><td>Vazyme</td><td>P505-d1</td><td></td></tr><tr><td>Ezmax for One-step Cloning</td><td>Tolobio</td><td>24303-1</td><td>seamless assembly kit</td></tr><tr><td>5x Buffer for Ezmax One-step Cloning</td><td>Tolobio</td><td>32006</td><td></td></tr><tr><td>BamHI</td><td>NEB</td><td>#R0136L</td><td></td></tr><tr><td>BamHI-HF</td><td>NEB</td><td>#R3136L</td><td></td></tr><tr><td>BglII&amp;nbsp;</td><td>NEB</td><td>#R0144L</td><td></td></tr><tr><td>XbaI</td><td>NEB</td><td>#R0145L</td><td></td></tr><tr><td>SpeI</td><td>NEB</td><td>#R3133L</td><td></td></tr><tr><td>10x Buffer 3</td><td>NEB</td><td>#B7003S</td><td></td></tr><tr><td>10x CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>10x T4 DNA ligase Buffer</td><td>Tolobio</td><td>32002</td><td></td></tr><tr><td>T4 PNK</td><td>Tolobio</td><td>32206</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Tolobio</td><td>32210</td><td></td></tr><tr><td>DpnI</td><td>NEB</td><td>#R01762</td><td></td></tr><tr><td>SV Gel and PCR clean-up system</td><td>Promega</td><td>A9282</td><td></td></tr><tr><td>Plasmid Mini Kit I</td><td>Omega</td><td>D6943-02</td><td>plasmid preparation kit</td></tr><tr><td>thermosensitive alkaline phosphatase&amp;nbsp;</td><td>Thermo Scientific</td><td>#EF0651</td><td>FastAP</td></tr><tr><td>10x Cpf1 buffer</td><td>Tolobio</td><td>32008</td><td></td></tr><tr><td>Cpf1</td><td>Tolobio</td><td>32105</td><td>FnCpf1</td></tr><tr><td>thermocycler</td><td>Applied Biosystems</td><td>veriti 96 well</td><td></td></tr><tr><td>C-Brick standard vector</td><td>Tolobio</td><td>98101</td><td></td></tr><tr><td>E. coli [DH10B]</td><td>Invitrogen</td><td>18297010</td><td></td></tr><tr><td>Luria-Bertani media (tryptone)</td><td>Oxoid</td><td>LP0042</td><td></td></tr><tr><td>Luria-Bertani media (yeast extract)</td><td>Oxoid</td><td>LP0021</td><td></td></tr><tr><td>Luria-Bertani media (NaCl)</td><td>Sangon Biotech</td><td>B126BA0007</td><td></td></tr></tbody></table>

protocols for c-brick dna standard assembly using cpf1

CRISPR-assoziiertes Protein Cpf1 spaltet doppelsträngige DNA unter der Leitung von CRISPR RNA (crRNA) und erzeugt klebrige Enden. Aufgrund dieser Eigenschaft wurde Cpf1 für die Etablierung eines DNA-Assembler-Standards namens C-Brick verwendet, der den Vorteil von langen Erkennungsstellen und kurzen Narben hat. Auf einem Standard-C-Brick-Vektor gibt es vier Cpf1-Erkennungsstellen - das Präfix (T1- und T2-Standorte) und das Suffix (T3- und T4-Standorte) - flankierende biologische DNA-Teile. Die Spaltung von T2- und T3-Stellen erzeugt komplementäre klebrige Enden, die die Montage von DNA-Teilen mit T2- und T3-Stellen ermöglichen. Mittlerweile wird eine kurze &quot;GGATCC&quot; Narbe zwischen den Teilen nach der Montage erzeugt. Da das neu gebildete Plasmid noch einmal die vier Cpf1-Spaltstellen enthält, erlaubt die Methode die iterative Assemblierung von DNA-Teilen, die denjenigen von BioBrick- und BglBrick-Standards ähnlich ist. Ein Verfahren, das die Verwendung des C-Brick-Standards zur Zusammenstellung von DNA-Teilen skizziertWird hier beschrieben. Die C-Brick-Standard kann weit verbreitet von Wissenschaftlern, Absolventen und Studenten und sogar Amateure verwendet werden.

<html> Dieses Protokoll zeigte die Zusammenstellung von drei Chromoproteinkassetten (cjBlue (BBa_K592011), eforRed (BBa_K592012) und amilGFP (BBa_K592010)). Zuerst wurden die kodierenden Sequenzen der drei vorgenannten Gene und Terminatoren einzeln in einen C-Brick-Standardvektor kloniert. Kurze DNA-Teile, Promotor und Terminator wurden durch PCR-Amplifikation unter Verwendung von Primern, die die kurzen DNA-Teile am 5&#39;-Terminus enthalten, in den C-Brick-Vektor eingeführt. Darauf fol...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

Das CRISPR-assoziierte Protein Cpf1 kann durch eine speziell entwickelte CRISPR-RNA (crRNA) geführt werden, um doppelsträngige DNA an gewünschten Stellen zu spalten und klebrige Enden zu erzeugen. Basierend auf dieser Eigenschaft wurde ein DNA-Assembler-Standard (C-Brick) etabliert, und ein Protokoll, das seine Verwendung beschreibt, wird hier beschrieben.

Protokolle für C-Brick DNA Standard Assembly mit Cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Universidad San Sebastian

Research

JoVE Journal

Genetics

8.2K Aufrufe.  Chinese Academy of Sciences.  Das CRISPR-assoziierte Protein Cpf1 kann durch eine speziell entwickelte CRISPR-RNA (crRNA) geführt werden, um doppelsträngige DNA an gewünschten Stellen zu spalten und klebrige Enden zu erzeugen. Basierend auf dieser Eigenschaft wurde ein DNA-Assembler-Standard (C-Brick) etabliert, und ein Protokoll, das seine Verwendung beschreibt, wird hier beschrieben. 

Serie: Protocols for C-Brick DNA Standard Assembly Using Cpf1

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native &beta;-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFD&alpha; and &beta;, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFD&alpha; and &beta; improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via &beta;-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

Ein Toolkit zur Umwandlung von Kohlenwasserstoffen in wässrigen Umgebungen aktivieren

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

Forschung

Biotechnik

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

Eine anpassbare Protokoll für String Montage gRNA Klonen (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Genetik

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D DNA nanostructures. Over decades, the rapid development of DNA nanotechnology is attributed to the use of linear DNAs as the source materials. For example, the DAO (double crossover, antiparallel, odd half-turns) tile is well-known as a building block for construction of 2D DNA lattices; the core structure of DAO is made from two linear single-stranded (ss) oligonucleotides, like two ropes making a right hand granny&#160;knot. Herein, a new type of DNA tiles called cDAO (coupled DAO) are built using a small circular ss-DNA of c64nt or c84nt (circular 64 or 84 nucleotides) as the scaffold strand and several linear ss-DNAs as the staple strands. Perfect 1D and 2D nanostructures are assembled from cDAO tiles: infinite nanowires, nanospirals, nanotubes, nanoribbons; and finite nano-rectangles. Detailed protocols are described: 1) preparation by T4 ligase and purification by denaturing PAGE (polyacrylamide gel electrophoresis) of small circular oligonucleotides, 2) annealing of stable circular tiles, followed by native PAGE analysis, 3) assembling of infinite 1D nanowires, nanorings, nanospirals, infinite 2D lattices of nanotubes and nanoribbons, and finite 2D nano-rectangles, followed by AFM (Atomic Force Microscopy) imaging. The method is simple, robust, and affordable for most labs.

This article presents a detailed protocol for T4 ligation and denaturing PAGE purification of small circular DNA molecules, annealing and native PAGE analysis of circular tiles, assembling and AFM imaging of 1D and 2D DNA nanostructures, as well as agarose gel electrophoresis and centrifugation purification of finite DNA nanostructures.

Stabile DNA-Motive, 1D und 2D Nanostrukturen aus kleinen kreisförmigen DNA-Moleküle gebaut

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D ...

Chemie

Erfassung der Chromosomenkonformation (3C) für Forschung und Lehre im Grundstudium

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Autor im Rampenlicht: Mit den 3Cs eine Eins bekommen: Erfassung der Chromosomenkonformation für Studenten  

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

Eine Eins mit den 3Cs bekommen: Erfassung der Chromosomenkonformation für Studenten

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 &#176;C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.

Photoaktivierte Lokalisationsmikroskopie mit Bimolekulare Fluoreszenzkomplementation (BIFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and ...

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Automatisierte Roboter Liquid Handling Versammlung Modular DNA-Geräte

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, into close spatial proximity 2-6. Deciphering the relationship between chromosome organization and genome activity will aid in understanding genomic processes, like transcription and replication. However, little is known about how chromosomes fold. Microscopy is unable to distinguish large numbers of loci simultaneously or at high resolution. To date, the detection of chromosomal interactions using chromosome conformation capture (3C) and its subsequent adaptations required the choice of a set of target loci, making genome-wide studies impossible 7-10.
We developed Hi-C, an extension of 3C that is capable of identifying long range interactions in an unbiased, genome-wide fashion. In Hi-C, cells are fixed with formaldehyde, causing interacting loci to be bound to one another by means of covalent DNA-protein cross-links. When the DNA is subsequently fragmented with a restriction enzyme, these loci remain linked. A biotinylated residue is incorporated as the 5' overhangs are filled in. Next, blunt-end ligation is performed under dilute conditions that favor ligation events between cross-linked DNA fragments. This results in a genome-wide library of ligation products, corresponding to pairs of fragments that were originally in close proximity to each other in the nucleus. Each ligation product is marked with biotin at the site of the junction. The library is sheared, and the junctions are pulled-down with streptavidin beads. The purified junctions can subsequently be analyzed using a high-throughput sequencer, resulting in a catalog of interacting fragments.
Direct analysis of the resulting contact matrix reveals numerous features of genomic organization, such as the presence of chromosome territories and the preferential association of small gene-rich chromosomes. Correlation analysis can be applied to the contact matrix, demonstrating that the human genome is segregated into two compartments: a less densely packed compartment containing open, accessible, and active chromatin and a more dense compartment containing closed, inaccessible, and inactive chromatin regions. Finally, ensemble analysis of the contact matrix, coupled with theoretical derivations and computational simulations, revealed that at the megabase scale Hi-C reveals features consistent with a fractal globule conformation.

The Hi-C method allows unbiased, genome-wide identification of chromatin interactions (1). Hi-C couples proximity ligation and massively parallel sequencing. The resulting data can be used to study genomic architecture at multiple scales: initial results identified features such as chromosome territories, segregation of open and closed chromatin, and chromatin structure at the megabase scale.

Hallo-C: eine Methode, um die dreidimensionale Architektur des Genoms Study.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, ...

Biologie

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure. Each chromosome occupies a specific territory, that may change according to stage of development or cell cycle. Gene expression can occur in specialized transcriptional factories where chromatin segments may loop out from various chromosome territories, leading to co-localization of DNA segments which may exist on different chromosomes or far apart on the same chromosome. The Associated Chromosome Trap (ACT) assay provides an effective methodology to identify these long-range DNA associations in an unbiased fashion by extending and modifying the chromosome conformation capture technique. The ACT assay makes it possible for us to investigate mechanisms of transcriptional regulation in trans, and can help explain the relationship of nuclear architecture to gene expression in normal physiology and during disease states.

The associated chromosome trap (ACT) assay is a novel unbiased method for identifying long-range DNA interactions. The characterization of long range DNA interactions will allow us to determine the relationship of nuclear architecture to gene expression in both normal physiology and in diseased states.

Assoziierte Chromosome-Trap zur Identifizierung weiträumige DNA-Wechselwirkungen

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure.  Each chromosome occupies a specific territory, ...

Protokolle für C-Brick DNA Standard Assembly mit Cpf1

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Ein Toolkit zur Umwandlung von Kohlenwasserstoffen in wässrigen Umgebungen aktivieren

Eine anpassbare Protokoll für String Montage gRNA Klonen (STAgR)

Stabile DNA-Motive, 1D und 2D Nanostrukturen aus kleinen kreisförmigen DNA-Moleküle gebaut

Eine Eins mit den 3Cs bekommen: Erfassung der Chromosomenkonformation für Studenten

Eine Eins mit den 3Cs bekommen: Erfassung der Chromosomenkonformation für Studenten

Eine Eins mit den 3Cs bekommen: Erfassung der Chromosomenkonformation für Studenten

Photoaktivierte Lokalisationsmikroskopie mit Bimolekulare Fluoreszenzkomplementation (BIFC-PALM)

Automatisierte Roboter Liquid Handling Versammlung Modular DNA-Geräte

Hallo-C: eine Methode, um die dreidimensionale Architektur des Genoms Study.

Assoziierte Chromosome-Trap zur Identifizierung weiträumige DNA-Wechselwirkungen