Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

참고 :이 방법은 Medler, S 및 안사리, A. 2에보고 된 연구 문서에서 사용되었다. 1. 배양 및 수확 세포 <ol><li> 갓 줄무늬 사카로 마이 세스 세레 비지 판에서 YPD 배지 (10g / L의 효모 추출물, 20g / L 펩톤, 2 % 덱 스트로스)에있는 세포의 5 mL의 문화를 시작합니다. </li><li> 30 ° C, 250 rpm으로 궤도 통에 하룻밤 세포를 성장. </li><li> 250 ㎖의 배플 플라스크 내의 성장 밤새 배양을 YPD 배지 100 ㎖의 최종 부피는 100 배 희석. 참고 : 문화 100 ㎖의 총 TRO 반응에 따라 필요합니다; 여러 반응이 필요한 경우에, 배양의 더 큰 부피를 사용해야한다. </li><li> 0.8의 광학 밀도로 세포를 성장 - 1.0 600 nm에서 (A (600) ~ 0.8 - 1.0). </li><li> 멸균 50 ML 원뿔 튜브에 4 ° C에서 5 분 동안 820 XG에서 원심 분리하여 세포를 수확. </li><li> 차가운 얼음 TMN의 BU 10ml에 세포를 재현 탁ffer (10 mM 트리스 - 염산 pH를 7.5, 5 밀리미터의 MgCl 2, 100 mM의 염화나트륨)과 5 분 동안 얼음 위에서 배양한다. </li><li> 4 ° C에서 5 분 동안 820 XG에 원심 분리기 세포 펠렛합니다. 조심스럽게 흡인에 의해 뜨는을 제거합니다. </li></ol> 분석 실행 기능 2. Permeabilizing 및 준비 세포 <ol><li> 로 pipetting 아래로 부드럽게 절단 된 P 1000 팁을 사용하여 0.6 %의 sarkosyl 용액 1 ㎖의 세포를 재현 탁. 냉장 1.5 ML의 microcentrifuge 관에 세포 현탁액을 전송합니다. </li><li> 플랫폼 통에 25 분 동안 4 ° C에서 부드럽게 세포를 흔들어. 주 : 마이크로 원심 튜브는이 단계에서 발생하는 프로모터에서 새로운 개시 이벤트의 가능성을 피하기 위해, 차가운 온도를 유지하기 위해 얼음과 50 ㎖ 원뿔형 튜브에 충전한다. </li><li> 탁상 냉장 원심 분리기를 사용하여 4 ° C에서 6 분 동안 1,200 XG에서 세포를 원심 분리기. </li><li> 조심스럽게 당에서 초과 액체를 제거하기 위해 뜨는을 대기음meabilized 세포 펠렛. </li></ol> 3. 전사 런타임에 반응 <ol><li> 전사의 150 μL를 추가 실행에 버퍼 (50 mM 트리스 - 염산의 pH 7.5, 100 mM의 KCl을 10 mM의의 MgCl 2, 2 mM의 DTT (디티 오 트레이 톨), 0.75 mM의 ATP, CTP, GTP, 및 BrUTP, 200 U의 RNase 각 투과성이 세포 펠렛에 억제제). </li><li> 최대 피펫 팅에 의해 잘린 P 200 팁을 사용하여 아래로 부드럽게 섞는다. 참고 : 여러 샘플을 처리하는 경우, 모든 샘플이 준비가 될 때까지 얼음에 모든 것을 유지하고 다음 단계로 진행합니다. </li><li> 수욕에서 30 ℃에서 5 분 동안 인큐베이션. 참고 : 초기 RNA에 BrUTP의 최적의 통합을 보장하기 위해 1 ~ 5 분 사이의 배양 시간을 조정합니다. </li><li> 냉간 즉시 사용 RNA 분리 시약 500 μL를 첨가하여 반응을 정지. 실온에서 5 분 동안 인큐베이션. </li></ol> 4. RNA 추출 <ol><li> 셀 suspensi에 산 세척 유리 구슬 200 μL를 추가(34 단계)와, 볼텍스 믹서에 4 ° C에서 20 분 동안 격렬하게 진탕에. </li><li> 핫 22 G 바늘을 사용 microcentrifuge 관의 바닥에 구멍 및 15 mL의 멸균 원뿔 관의 상단에 배치. </li><li> 4 ° C에서 1 분 300 XG에 원심 분리기는 세포 용 해물을 수집합니다. 1.5 ML의 microcentrifuge 튜브에 세포 용 해물을 전송. </li><li> 차가운 RNA 분리 시약 500 μL와 세포 용 해물을 클로로포름 200 μL를 추가한다. 4 ° C에서 20 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 대한 내용을 섞는다. </li><li> 새로운 microcentrifuge 관에 위 수성 위상을 전송합니다. </li><li> pH를 4-5 이소 아밀 알코올 / (: 24 1 125) 차가운 페놀 / 클로로포름의 동일한 볼륨을 추가합니다. 4 ℃에서 15 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 적극적으로 흔들어. </li><li> 새로운 microcentrifuge 관에 위 수성 상을 포함하는 RNA를 전송합니다. 단계를 반복 4.6 두 번 더. </li><li> 최종 RNA 함유하는 수성 상에 5 M의 NaCl를 추가 STOCM. 0.3의 최종 농도는 RNA를 침전을 3 회 냉 에탄올의 양을 추가 얻을 케이. <ol><li> 1 시간 동안 또는 밤새 -20 ℃에서 인큐베이션. 참고 : - 안티 BrdU의 비드 (단계 5.3 참조) 차단 배양되는 동안 4.11 단계 4.9을 수행합니다. </li></ol></li><li> 4 ℃에서 20 분 동안 16,168 XG에 원심 분리기. 상층 액을 제거하고 DEPC (디 에틸 피로 카보) 물 100 μL의 RNA 펠렛을 재현 탁. </li><li> 통합되지 않은 BrUTP 뉴클레오티드에서 RNA를 분리하는 RNA 분리 미니 키트를 사용합니다. 의 RNase가없는 물 100 μL로 열로부터 RNA를 용출시킨다. </li><li> 5 분 동안 65 ° C의 물을 용기에 RNA를 부화 한 후, 적어도 2 분 동안 얼음으로 옮긴다. </li></ol> BrUTP 표지 RNA 5. 선호도 정화 <ol><li> 25 μL에 안티 BrdU의 추가, 구슬 해결 500 0.25 배씩 SSPE (나트륨 염 인산 EDTA) 결합 버퍼 (20 배 SSPE의 μL : 3 M의 NaCl, 0.2 M의 NaH 2 PO 4 </sub&gt; 0.02 M EDTA, pH 7.4의 1 mM의 EDTA, 0.05 % 트윈 (Tween), 37.5 mM의 염화나트륨). 4 ° C에서 30 초 동안 200 XG에 원심 분리기와 뜨는을 제거합니다. </li><li> 단계를 반복 5.1 세 번. </li><li> 구슬 (1 mg의 울트라 순수 소 혈청 알부민 (BSA) 버퍼, 0.1 %의 폴리 비닐 피 롤리 돈, 1 배 결합) 버퍼를 차단의 500 μL를 추가하고 부드럽게 1 흔들어 - 플랫폼 흔드는에 4 ° C에서 2 시간. </li><li> 단계 5.1에 기술 된 바와 같이, 결합 완충액 500 μL로 구슬을 두 번 더 씻는다. </li><li> 구슬에 버퍼를 바인딩의 400 μL를 추가합니다. </li><li> 구슬에 직접 (단계 4.11)에서 RNA의 100 μL를 전송합니다. 플랫폼 흔드는에 4 ° C에서 2 시간 - 부드러운가 1 진탕 품어. </li><li> 결합 완충액 500 μL, 낮은 소금 버퍼 500 μL (0.2 배씩 SSPE, 1 mM의 EDTA, 0.05 % 트윈), 높은 소금 버퍼 500 μL (0.25 배씩 SSPE, 1 mM의 EDTA, 0.05 % 트윈와 구슬 순차적으로 세척, 100 mM의 염화나트륨), 회 TET 완충액 500 μL (1X TE, 0.05 % 트윈)에서 회전하는각 세척 사이에 4 ° C에서 30 초 동안 200 XG. </li><li> 150 μL로 두 번 순차적으로 비드의 BrUTP 표지 된 RNA를 용출 번 용출 완충액 (20 mM의 DTT, 150 mM의 염화나트륨, 50mM 트리스 - 염산 pH를 7.5, 1 mM의 EDTA, 0.1 % SDS) 200 μL와 함께 배양하여 상층 액에서 구슬을 분리 짧은 스핀 다음 수욕에서 42 ° C에서 4 분. </li></ol> BrUTP 레이블 RNA의 6 강수량 <ol><li> 이소 아밀 알코올 / 차가운 페놀 / 클로로포름 500 μL를 추가 (: 24 : 125 1) pH가 4-5을 BrUTP 정제 선호도로는 RNA를 표시. 4 ° C에서 15 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 섞는다. </li><li> 새로운 microcentrifuge 관에 위 수성 위상을 전송합니다. </li><li> RNA의 침전을 냉 에탄올, 0.3 M의 3 배 부피의 최종 농도를 얻기 위해 5 M NaCl을 주식을 추가한다. </li><li> -20 ° C에서 밤새 품어. </li><li> 4 ° C에서 30 분 동안 16,168 XG에서 원심 분리하여 침전 된 RNA를 수집합니다. &lt;/ 리&gt; <li> 상층 액을 제거하고 10 분 동안 공기 건조에 펠렛을 할 수 있습니다. </li><li> DEPC 물 26 μL의 RNA 펠렛을 재현 탁. </li><li> 분광 광도계를 사용하여 260 nm에서 흡광도를 측정하여 최종 RNA 농도를 결정한다. 또한, 280 분의 260 비율을 결정합니다. 비율 ~ 2 순수 RNA 시료를 나타낸다. </li><li> cDNA 합성에 필요한 때까지 -80 ° C에서 분취 량의 RNA 샘플을 저장합니다. </li></ol> BrUTP 표지 RNA의 7 역전사 <ol><li> 100 NG에 RNA 농도를 조정 / μL은 DEPC 물을 사용. 각 cDNA 합성 반응에 RNA 0.5 μg의를 사용합니다. 참고 : RNA 템플릿의 농도는 최적의 cDNA 합성을 달성하기 위해 0.5 ~ 1.0 μg의 다를 수 있습니다. </li><li> 도 3a에 도시 된 바와 같이 하류 폴리 (A)에 위치 (종료 위치)의 여러 설계 역방향 프라이머를 이용하여 RNA를 역 전사. </li><li> 각각 역전사 반응, RNA의 templat 5 μL를 추가E (0.5 μg의), 1 μL의의 dNTP 믹스 (10 mM의 각), 역방향 프라이머 C, D, E, F 또는 G 2 μL (50 μM 각) 및 클레아 자유 수 (도 3a 참조). 각 튜브의 최종 반응 부피가 13 μL이다. 주 : 역전사 반응의 수는 cDNA 합성에 사용되는 역방향 프라이머의 수에 의존 할 것이다. 예를 들어, ASC1 다섯 역방향 프라이머를 사용 하였다 따라서 오 역전사 반응을 설정 하였다. cDNA 합성에 사용되는 역방향 프라이머를 기초 C, D, E, F 및 G로 튜브 라벨. </li><li> 어떤 차 구조 형태를 제거하는 5 분 동안 65 ° C에서 열 순환기에 RNA 템플릿의 dNTP 믹스와 프라이머를 포함하는 튜브를 품어, 적어도 2 분 동안 4 ° C에 다음 차가운. </li><li> 1 μL는 효소 (200 U / μL)를 역 추가, 4 μL는 버퍼와 RNA 템플릿과 프라이머를 포함하는 각각의 튜브에 0.1 M DTT의 2 μL (7.4 단계). 위아래로 부드럽게 피펫 팅에 의해 섞는다. </li><li> 60 분 동안 42 ℃에서 열 순환기에서 반응 혼합물을 배양하여 역전사 반응을 수행한다. </li><li> 20 분 동안 65 ℃에서 역전사 효소를 불 활성화. </li><li> -20 ° C에서의 cDNA를 저장하거나 다음 단계로 진행합니다. </li></ol> cDNA를 8. 증폭 <ol><li> 단계 7.8, 1.0 μL 포워드 프라이머 B (10 μM), 1.0 μL의 3.0 μL의 cDNA 주형을 다음과 같이 단계 7.8에서 (ASC1위한 C, D, E, F 및 G 표시) 각각의 cDNA 제제의 증폭을위한 PCR 반응을 수행 역방향 프라이머 C 또는 D 또는 E 또는 F 또는 G (10 μM), 2.5 μL 10 배 중합 효소 PCR 버퍼, 0.5 μL의의 dNTP 믹스 (10 mM의 각), 1.0 μL의 MgCl 2 (2.5 mM)을 15.5 μL PCR 등급 물, 0.5 μL 열 안정성 중합 효소. 참고 : 5 1 : 1까지의 cDNA 템플릿의 다른 희석 (100)는 PCR 제품 수율을 최적화하기 위해 테스트해야합니다. 단일 프로모터 근위 정방향 프라이머는 cDNA를 증폭하기 위해 사용될다른 역방향 프라이머를 이용하여 얻어진. 예를 들어, 프로모터 근처에 위치한 하나의 전방 프라이머 B는 G에 대한 ASC1 C에서 5 역방향 프라이머와 조합하여 사용 하였다. BC는, BD는,도 3a에 도시 된 바와 같이, BF와 BG는 각각 C, D, E, F 및 G로 표시 튜브에 사용하여, 될 수있다. </li><li> 다음 열 사이클링 매개 변수를 사용하여 PCR을 실행하여 1주기를 2 분 동안 95 ° C (중합 효소의 활성화를위한 핫 스타트), 30-40 사이클 30 초 (변성), 15 초 동안 54 ° C 95 ° C (어닐링) 1 분 (연장), 1 사이클 5 분 동안 68 ° C (최종 확장) 68 ° C. 주 : 소둔 온도는 사용되는 특정 프라이머에 따라 달라질 것이며, 연기 시간이 예상되는 제품의 크기에 따라 달라진다. </li><li> 0.8 %, 1.5 %, 또는 제품의 예상 크기에 따라 2 % 아가로 오스 겔 전기 영동에 의해 PCR 생성물을 분리한다. </li><li> 엘 Kaderi 동부 등의 설명에 따라 PCR 생성물을 정량화. (20)12 11. 참고 : 다른 방법으로, 초기 성적의 양을 정량 실시간 RT-qPCR에 전략을 사용합니다. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

여기서 사용 가닥 특이 TRO 프로토콜은 포유 동물 세포에서 12 GRO-SEQ (글로벌 도망 시퀀싱) 분석을 위해 사용 된 프로토콜에서 적응시켰다. 우리는 성공적으로 효모 신진에서 초기 전사를 연구하는 프로토콜을 수정했습니다. 특히 전사 종결 결함을 분석하기 위해, 우리는 RNA 가수 분해 공정 치우는하여 상기 프로토콜을 조정했다. 이것은 우리가 특히 프로모터 영역 근처의 전사 개...

진핵 전사 사이클은 세 가지 주요 단계로 구성; 개시, 신장 및 종료. RNA 중합 효소 II에 의한 전사의 종료는 두 가지, 상호 의존적 인 3 단계로 구성되어 있습니다. 첫 번째 단계는 템플릿에서 분열, 및 폴리아 데 닐화 mRNA를 분리를 포함하고, 바로 템플릿 폴리머의 결합 해제에 의해 표시된 두번째 단계로 이어진다. 적절한 종료와 RNA (4, 5)를 비 - 코딩 전반의 전사를 제한함으로써 점검 비정상적인 전사를 유지하는 하류 유전자의 전사와 간섭을 방지하기 위해, 전사 개시 / 재개시하는 동안 폴리머의 재활용을 위해 중요하다. 최근의 진보에도 불구하고, 종료는 RNA 중합 효소 II 전사주기까지 상기 단계에 의해 이해된다. 안정적인 종단 분석은 메커니즘 underlyin 연구를위한 필수적이다생체 내에서 RNA 중합 효소 II에 의한 전사의 g 종료. 실험적인 접근 방법은 생리 조건 하에서 활발히 유전자 전사 종결 결함을 검출하기 위해 사용된다. 이 북부 오 점, 종료 인자 칩 (염색질 면역 침전) 및 기존의 TRO 분석을 포함한다. 이들 기술은 각각 장단점을 갖는다. 사용되는 전통적인 TRO 분석은 생체 내 1에서 전사 종결 결함의 검출을위한 가장 신뢰할 수 있고 중요한 방법이 될 수 있습니다. 이 분석은 세포 내부 유전자의 상이한 영역의 전사적 활성 폴리머 분자 편재. 정상적인 조건에서 분석은 엄격히 유전자 (그림 1A)의 프로모터와 터미네이터 영역 사이에 분산 된 전사적으로 참여 중합 효소 분자를 보여줍니다. 결함 종료시 그러나, 폴리머는 종료 신호를 판독 할 수없는상기 유전자 (도 1b)의 3 &#39;말단의 하류 영역에서 검출된다. 전사 종결 결함이 프로모터 근위 영역으로부터 시작된 센스 속기 폴리머의 존재 하에서 적하하고, 종료 신호를 읽을 수 되,도에 도시 된 바와 같이, 유전자의 3 &#39;말단의 하류 영역을 전사 계속 2A. 진핵 게놈 및 유전자 6, 7, 8, 9, 약 10 압도적 보급 점에서 전사뿐만 아니라 안티센스 방향을 나타낸다 실현으로 곧 전통적인 TRO 분석 검출 할 수없는 것은 명백되었다 폴리머 IF 신호 유전자의 하류는 프로모터 시작 성적 증명서 (그림 2A) 또는 솜을 시작 탈선 RNA를 나타냅니다유전자 또는 종단 요소 (도 2b) 또는 유전자 (도 2c)의 3 &#39;말단에서 안티센스 방향의 폴리머 속기 하류의 중간 ewhere. 관찰 readthrough 중합 효소 신호가 프로모터 시작 확장 된 감각의 mRNA 또는 시험에서 유전자의 하류를 시작 안티 센스 성적표를 나타내는 경우 사용 BrUTP는 여기에 설명 된 가닥 특정 TRO 분석은 구별 할 수 있습니다. 우리는 성공적으로 효모 2 신진에서 전사 종료에 Kin28 키나제의 역할을 보여주기 위해이 방법을 사용하고 있습니다. 여기에 방법을 사용하는 우리는 같은 단백질이 효모 신진에서 ASC1의 전사의 종료를 위해 필요하다는 것을 보여준다.

<table><tbody><tr><td>Phenol-chloroform-isoamyl alcohol mixture</td><td>Sigma-Aldrich</td><td>77619</td><td>pH 4-5</td></tr><tr><td>TRIzol reagent</td><td>Life technologies</td><td>15596-026</td><td></td></tr><tr><td>RNase Inhibitor, human placenta</td><td>New England Biolabs</td><td>M0307S</td><td></td></tr><tr><td>Anti-BrdU beads</td><td>Santa Cruz Biotechnology</td><td>sc-32323AC</td><td></td></tr><tr><td>Protoscript II</td><td>New England Biolabs</td><td>M03368L</td><td>or an equivalent enzyme</td></tr><tr><td>Advantage 2 polymerase Mix</td><td>Clontech</td><td>639201</td><td>or an equivalent enzyme</td></tr><tr><td>5-Bromouridine 5&#039; triphosphate sodium salt</td><td>Santa Cruz Biotechnology</td><td>sc-214314A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>ATP</td><td>New England Biolabs</td><td>N0451AA</td><td></td></tr><tr><td>CTP</td><td></td><td>N0454AA</td><td></td></tr><tr><td>GTP</td><td></td><td>N0452AA</td><td></td></tr><tr><td>Ultra-pure bovine serum albumin (BSA)</td><td>MC Labs</td><td>UBSA-100</td><td></td></tr><tr><td>Asc1 B</td><td></td><td></td><td>AGATTCGTCGGTCACAAGTCC</td></tr><tr><td>Asc1 C</td><td></td><td></td><td>GAACTTTATACATATTCTTAGTT&lt;br/&gt; AGCAGTC</td></tr><tr><td>Asc1 D</td><td></td><td></td><td>TGTACATATGTATTTTCGCAGCA</td></tr><tr><td>Asc1 E</td><td></td><td></td><td>GCCAAGGAGACTGAATTTAATG</td></tr><tr><td>Asc1 F</td><td></td><td></td><td>CTATGGAATGGGGGTTTTAAG</td></tr><tr><td>Asc1 G</td><td></td><td></td><td>GGTTATGGCAGACATGCCAC</td></tr><tr><td>5s cDNA</td><td></td><td></td><td>AGATTGCAGCACCTGAGT</td></tr><tr><td>5&amp;rsquo; 5s reverse</td><td></td><td></td><td>GGTTGCGGCCATATCTAC</td></tr><tr><td>3&amp;rsquo; 5s reverse</td><td></td><td></td><td>TGAGTTTCGCGTATGGTC</td></tr></tbody></table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

이 원고는 생체 내에서 전사 종결 결함을 검출하는 프로토콜을 설명한다. 사용 BrUTP 여기서 설명한 가닥 특이 TRO 프로토콜은 생리 학적 조건 하에서 전사 종결 결함 분석을위한 강력한 실험 방법이다. 전통적인 TRO 분석 마찬가지로 전사 종결 결함 하나의 지표로서 유전자의 3 &#39;말단을 넘어 전사적 활성 폴리머의 존재에 의존한다. 그것은 기존의 TRO 분석으로 발생하는 두 가지 주요 문제를 극복한다. 첫째, 종료 신호를 통해 판독 효소가 프로모터 근위 부위에서 전사를 개시 한 경우, 검출 또는 수 단순히 어딘가에 본문에서 비특이적 개시된 pervasively 전사 효소 또는 3 &#39;을 나타내는 경우 유전자의 끝. 둘째, 구별 할 수 있습니다 경우 넘어 전사적으로 활성 효소 신호터미네이터 영역은 진정으로 readthrough 감지 mRNA의 전사 중합 효소 또는 터미네이터 시작 비 코딩 안티센스 RNA 신호이다. 간략하게, 프로토콜, 기하 급수적으로 성장하는 효모 세포 permeabilizing 친화 방식으로 BrUTP 표지 RNA 정제의 BrUTP 염기의 존재 하에서 신장 생체 내에서 개시 사체 허용 수반 정제 초기 RNA를 전사하고 cDNA를 증폭하여 역방향 프로모터와 유전자 (2)의 종결 영역을 플 랭킹 가닥 특이 적 프라이머.

전사 종결 결함을 검출에 BrUTP 가닥 특정 TRO 절차의 적용을 설명하기 위해, 우리는 같은 단백질의 종료 불량, 온도에 민감한 돌연변이가 rna14-1라고 사용. RNA 중합 효소 II에 의한 전사 종료에 같은 단백질의 역할은 선택된 유전자 1 터미네이터 - 인접 지역에서 RNA를 검출 기존의 TRO 분석을 이용하여 증명되었다. 비 - 허용 온도에서 rna14-1...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

BrUTP 가닥 특정 전사 런타임에 (TRO) 접근 방식을 사용하여 전사의 종료의 분석

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Universidad San Sebastian

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K 조회수.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

비디오: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

연구

생화학

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

유전학

Identification of RNA Fragments Resulting from Enzymatic Degradation using MALDI-TOF Mass Spectrometry

RNA is a biopolymer present in all domains of life, and its interactions with other molecules and/or reactive species, e.g., DNA, proteins, ions, drugs, and free radicals, are ubiquitous. As a result, RNA undergoes various reactions that include its cleavage, degradation, or modification, leading to biologically relevant species with distinct functions and implications. One example is the oxidation of guanine to 7,8-dihydro-8-oxoguanine (8-oxoG), which may occur in the presence of reactive oxygen species (ROS). Overall, procedures that characterize such products and transformations are largely valuable to the scientific community. To this end, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry is a widely used method. The present protocol describes how to characterize RNA fragments formed after enzymatic treatment. The chosen model uses a reaction between RNA and the exoribonuclease Xrn-1, where enzymatic digestion is halted at oxidized sites. Two 20-nucleotide long RNA sequences [5&#39;-CAU GAA ACA A(8-oxoG)G CUA AAA GU] and [5&#39;-CAU GAA ACA A(8-oxoG)(8-oxoG) CUA AAA GU] were obtained via solid-phase synthesis, quantified by UV-vis spectroscopy, and characterized via MALDI-TOF. The obtained strands were then (1) 5&#39;-phosphorylated and characterized via MALDI-TOF; (2) treated with Xrn-1; (3) filtered and desalted; (4) analyzed via MALDI-TOF. This experimental setup led to the unequivocal identification of the fragments associated with the stalling of Xrn-1: [5&#39;-H2PO4-(8-oxoG)G CUA AAA GU], [5&#39;-H2PO4-(8-oxoG)(8-oxoG) CUA AAA GU], and [5&#39;-H2PO4-(8-oxoG) CUA AAA GU]. The described experiments were carried out with 200 picomols of RNA (20 pmol used for MALDI analyses); however, lower amounts may result in detectable peaks with spectrometers using laser sources with more power than the one used in this work. Importantly, the described methodology can be generalized and potentially extended to product identification for other processes involving RNA and DNA, and may aid in the characterization/elucidation of other biochemical pathways.

MALDI-TOF was used to characterize fragments obtained from the reactivity between oxidized RNA and the exoribonuclease Xrn-1. The present protocol describes a methodology that can be applied to other processes involving RNA and/or DNA.

MALDI-TOF 질량 분광법을 이용한 효소적 분해로 인한 RNA 단편의 확인

RNA is a biopolymer present in all domains of life, and its interactions with other molecules and/or reactive species, e.g., DNA, proteins, ions, drugs, ...

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR - 클립 - RNA 단백질의 바인딩 Transcriptome 전체 바인딩 사이트를 식별하는 방법

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

생물학

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

CRISPR / 카스 시스템의 Endonucleases을위한 기판 생성

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

사전 mRNA의 기판의 3 &#39;끝 분열 : 휴대폰 무료 시스템을 사용하여 RNA 가공 반응 분석<em&gt; 시험관</em

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is achieved by reverse transcription of the RNA of interest using specific fluorescently labeled primers and subsequent analysis of the resulting cDNA fragments by denaturing polyacrylamide gel electrophoresis. Simultaneously, a traditional Sanger sequencing reaction is run on the gel to map the ends of the cDNA fragments to their exact corresponding bases. In contrast to 5&#39;-RACE (Rapid Amplification of cDNA Ends), where the product must be cloned and multiple candidates sequenced, the bulk of cDNA fragments generated by primer extension can be simultaneously detected in one gel run. In addition, the whole procedure (from reverse transcription to final analysis of the results) can be completed in one working day. By using fluorescently labeled primers, the use of hazardous radioactive isotope labeled reagents can be avoided and processing times are reduced as products can be detected during the electrophoresis procedure.
In the following protocol, we describe an in vivo fluorescent primer extension method to reliably and rapidly detect the 5&#39; ends of RNAs to deduce transcriptional starting points and RNA processing sites (e.g., by toxin-antitoxin system components) in S. aureus, E. coli and other bacteria.

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

We here describe a fluorescence based primer extension method to determine transcriptional starting points from bacterial transcripts and RNA processing in vivo using an automated gel sequencer.

형광 기반 프라이머 확장 기술은 전사 시작 포인트 및 RNases의 쪼개짐 사이트를 확인하는<em&gt; 생체</em

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is ...

Rapid Verification of Terminators Using the pGR-Blue Plasmid and Golden Gate Assembly

The goal of this protocol is to allow for the rapid verification of bioinformatically identified terminators. Further, the plasmid (pGR-Blue) is designed specifically for this protocol and allows for the quantification of terminator efficiency. As a proof of concept, six terminators were bioinformatically identified in the mycobacteriophage Bernal13. Once identified, terminators were then made as oligonucleotides with the appropriate sticky ends and annealed together. Using Golden Gate Assembly (GGA), terminators were then cloned into pGR-Blue. Under visible light, false positive colonies appear blue and positively transformed colonies are white/yellow. After induction of an arabinose inducible promoter (pBad) with arabinose, colony strength can be determined by measuring the ratio of green fluorescent protein (GFP) produced to red fluorescent protein (RFP) produced. With pGR-Blue, the protocol can be completed in as little as three days and is ideal in an educational setting. Additionally, results show that this protocol is useful as a means for understanding in silico predictions of terminator efficiency related to the regulation of transcription.

This protocol utilizes Golden Gate Assembly and the plasmid pGR-blue to rapidly quantify the strength of terminators found in silico.

PGR - 블루 플라스미드와 골든 게이트 어셈블리를 사용하여 터미네이터의 신속한 확인

The goal of this protocol is to allow for the rapid verification of bioinformatically identified terminators. Further, the plasmid (pGR-Blue) is designed ...

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single strands, each requiring distinct modes of replication: continuous (leading) and discontinuous (lagging). Understanding the interactions of chromatin-associated proteins with replicating DNA strands in vivo is crucial for elucidating the mechanisms of chromatin assembly and DNA repair coupled to DNA replication. This protocol presents the enrichment and sequencing of protein-associated nascent DNA (eSPAN) method, designed to quantify relative protein levels on nascent leading and lagging DNA strands at replication forks. The eSPAN procedure starts with chromatin immunoprecipitation (ChIP, in yeast) or cleavage under targets and tagmentation (CUT&amp;Tag; in mammalian cells) of a protein of interest, followed by enrichment of the protein-associated nascent DNA by bromodeoxyuridine (BrdU) immunoprecipitation. Strand-specific next-generation sequencing is applied to isolated ssDNA. This technique can be used to determine whether a protein is enriched at leading or lagging replication forks. The eSPAN provides genome-wide strand-preference of chromatin-associated proteins, including histones at replication forks.

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single ...

Transcription Attenuation in Prokaryotes

Transcriptional attenuation occurs when&#160;RNA transcription is prematurely terminated due to the formation of a terminator mRNA hairpin structure.&#160; Bacteria use these hairpins to regulate the transcription process and control the synthesis of several amino acids including histidine, lysine, threonine, and phenylalanine. Transcription attenuation takes place in the non-coding regions of mRNA.
There are several different mechanisms used to attenuate transcription. In ribosome mediated transcriptional attenuation, the movement of a ribosome on the transcript is stalled or proceeds forward depending upon the availability of the tRNAs charged with a specific amino acid. High amino acid concentrations allow the ribosome to move forward leading to the formation of the terminator structure; deficiency of the amino acid stalls the ribosome and causes formation of the anti-terminator structure. The trp operon in E. coli, discussed below, is a good example of this type of mechanism. tRNA mediated transcriptional attenuation, as observed in trp operon of Lactococcus lactis, depends on an RNA-RNA interaction. When uncharged tRNAs are present in sufficient numbers, they directly bind to the mRNA and stabilize the anti-terminator structure. Transcriptional attenuation is also known to be mediated by proteins as found in bgl (beta-glucoside) operon in E. coli.&#160; This involves an RNA&#8212;protein interaction where a protein binds to the transcript and regulates the formation of an anti-terminator structure. More recently, another transcriptional attenuation mechanism was discovered where small metabolites like thiamine were observed to regulate transcription by directly binding to the non-coding mRNA segments, also known as riboswitches. Riboswitches can form a terminator or an anti-terminator structure depending upon the concentration and nature of a metabolite.&#160;
Trp Operon
The trp operon in E. coli contains a 140 nucleotide leader sequence before its first structural gene. This leader sequence has four distinct segments &#8211; 1 through 4&#8211; and regulates the transcription of the downstream structural genes. Segment&#160; 1 can form a hairpin structure with segment&#160; 2. This 1-2 hairpin structure is known as a pause structure, as during transcription, it stalls RNA polymerase until the ribosome binds the newly transcribed RNA. This synchronizes transcription and translation in bacteria.&#160; When tryptophan concentrations are low, a hairpin structure forms between segments 2 and 3, known as the anti-terminator structure. This anti-terminator structure allows the continuous transcription of the downstream genes which produce enzymes for tryptophan synthesis. In contrast, when tryptophan concentrations are sufficient, a hairpin structure forms between segments 3 and 4, called the terminator structure. Along with a&#160; series of uracil bases that follow, the terminator structure causes RNA polymerase to dissociate from the RNA and template DNA strands, resulting in the termination of the transcription.

BrUTP 가닥 특정 전사 런타임에 (TRO) 접근 방식을 사용하여 전사의 종료의 분석

요약

더 많은 비디오 탐색

이 비디오의 챕터