Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

הערה: שיטה זו שימשה במאמר במחקר דיווחו Medler, S ו- אנסארי, א 2. 1. Culturing ו קציר תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התחל תרבות 5 מ&quot;ל של תאים במדיום YPD (תמצית שמרים 10 גר &#39;/ ל, 20 גר&#39; / ל peptone, 2 דקסטרוז%) מתוך צלחת cerevisiae Saccharomyces טרי מפוספס. </li><li style=";text-align:right;direction:rtl"> לגדל את התאים לילה ב שייקר מסלולית ב 30 ° C ו 250 סל&quot;ד. </li><li style=";text-align:right;direction:rtl"> לדלל את תרבות מבוגר לילה 100 פעמים לנפח סופי של 100 מ&quot;ל במדיום YPD בבקבוק 250 מ&quot;ל מבולבל. הערה: סך של 100 מ&quot;ל של התרבות נדרשת לכל תגובה TRO; אם תגובות מרובות נדרשות, נפח גדול יותר של התרבות חייב לשמש. </li><li style=";text-align:right;direction:rtl"> לגדל את תאי צפיפות אופטית של 0.8 - 1.0 ב 600 ננומטר (600 ~ 0.8 - 1.0). </li><li style=";text-align:right;direction:rtl"> קציר התאים על ידי צנטריפוגה ב 820 XG במשך 5 דקות ב 4 ° C בצינור 50 מ&quot;ל חרוטי סטרילית. </li><li style=";text-align:right;direction:rtl"> Resuspend התאים 10 מ&quot;ל של bu TMN קר קרחffer (10 mM Tris-HCl pH 7.5, 5 מ&quot;מ 2 MgCl, 100 מ&quot;מ NaCl) ו דגירה על קרח למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב 820 XG במשך 5 דקות ב 4 ° C עד גלולת התאים. בעדינות להסיר את supernatant על ידי שאיפה. </li></ol> 2. Permeabilizing תאי הכנות לקראת Run-על Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Resuspend התאים 1 מ&quot;ל של תמיסת 0.6% sarkosyl ידי pipetting למעלה ולמטה בעדינות בעזרת טיפ P 1000 קטום. מעבירים את ההשעיה לתא צינור 1.5 מ&quot;ל microcentrifuge צונן. </li><li style=";text-align:right;direction:rtl"> לנער את התאים בעדינות על 4 מעלות צלזיוס למשך 25 דקות על שייקר פלטפורמה. הערה: צינורות Microcentrifuge צריכים להיות ארוזים לתוך צינור חרוטים 50 מיליליטר עם קרח כדי לשמור על טמפרטורה קרה, הימנעות את האפשרות של כל אירועי ייזום חדשים המתרחשים האמרגן בשלב זה. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב 1200 XG במשך 6 דקות ב 4 ° C באמצעות צנטריפוגות בקירור שולחן. </li><li style=";text-align:right;direction:rtl"> בעדינות לשאוב supernatant להסיר את הנוזלים העודפים מן לכלתא גלול meabilized. </li></ol> תגובת 3. תמלול Run-על <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 150 μL של שעתוק ריצה על חיץ (50 mM Tris-HCl pH 7.5, 100 מ&quot;מ KCl, 10 מ&quot;מ MgCl 2, 2 מ&quot;מ DTT (dithiothreitol), 0.75 מ&quot;מ כל אחד ATP, CTP, GTP, ו BrUTP, 200 U RNase מעכב) אל תא גלולה permeabilized. </li><li style=";text-align:right;direction:rtl"> מערבבים בעדינות על ידי pipetting למעלה ולמטה באמצעות קצה P 200 קטום. הערה: אם עיבוד דגימות מרובות, לשמור הכל על קרח עד שכל הדגימות מוכנות ולאחר מכן להמשיך לשלב הבא. </li><li style=";text-align:right;direction:rtl"> דגירה במשך 5 דקות ב 30 מעלות צלזיוס באמבט מים. הערה: כוונן את זמן הדגירה בין 1 ל 5 דקות כדי להבטיח שילוב אופטימלי של BrUTP לתוך RNA המתהווה. </li><li style=";text-align:right;direction:rtl"> עצור את התגובה על ידי הוספת 500 μL של מגיב בידוד RNA קר מוכן לשימוש. דגירה במשך 5 דקות בטמפרטורת החדר. </li></ol> 4. RNA הפקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 200 μL של חרוזי זכוכית חומצה שטף לתא suspensiעל (שלב 3.4), ולנער במרץ למשך 20 דקות ב 4 ° C במיקסר מערבולת. </li><li style=";text-align:right;direction:rtl"> לנקב את החלק התחתון של הצינור microcentrifuge באמצעות מחט 22 G חם ומניחים אותו על גבי צינור חרוטי סטרילי 15 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה XG ב 300 דקות 1 ב 4 ° C כדי לאסוף את lysate התא. מעבירים את lysate לתא צינור 1.5 מ&quot;ל microcentrifuge. </li><li style=";text-align:right;direction:rtl"> הוספת 500 μL של מגיב בידוד RNA קר 200 μL של כלורופורם אל lysate התא. מערבבים את התוכן על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 20 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> מעבירים את השלב מימית העליון לצינור microcentrifuge חדש. </li><li style=";text-align:right;direction:rtl"> הוסף נפח שווה של פנול / כלורופורם קר / isoamyl אלכוהול (125: 24: 1) pH 4-5. לנער במרץ על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 15 דקות ב 4 ° C.. </li><li style=";text-align:right;direction:rtl"> מעביר את RNA המכיל בשלב מהימי העליון לצינור microcentrifuge חדש. חזור על שלב 4.6 פעמים נוספות. </li><li style=";text-align:right;direction:rtl"> אל השלב מהימי הסופי המכיל RNA, להוסיף 5 M NaCl stock כדי לקבל ריכוז סופי של 0.3 מ &#39;להוסיף 3 פעמים את הנפח של אתנול קר לזרז את הרנ&quot;א. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דגירה של 1 ש &#39;או לילה ב -20 ° C. הערה: בצע את שלבי 4.9 - 4.11 בעוד החרוזים אנטי BrdU שמתבצעים וטופחו לחסימה (ראה שלב 5.3). </li></ol></li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב 16,168 XG במשך 20 דקות ב 4 °. הסר את supernatant ו resuspend גלולה רנ&quot;א 100 μL של מים DEPC (diethylpyrocarbonate). </li><li style=";text-align:right;direction:rtl"> השתמש ערכת מיני בידוד RNA להפריד בין RNA מן נוקלאוטידים BrUTP מאוגדים. Elute רנ&quot;א מהעמודה עם 100 μL של מים RNase חינם. </li><li style=";text-align:right;direction:rtl"> דגירה RNA באמבט מים C ° 65 במשך 5 דקות ולאחר מכן להעביר קרח דק 2 לפחות. </li></ol> טיהור זיקה 5. RNA BrUTP שכותרתו <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי 25 μL של אנטי BrdU התיישבו חרוזים, להוסיף 500 μL של 0.25x SSPE (נתרן מלוחים פוספט EDTA) במאגר מחייב (20x SSPE: 3 M NaCl, 0.2 M לאא 2 PO 4 </sub&gt;, 0.02 M EDTA, pH 7.4, 1 mM EDTA, 0.05% Tween, 37.5 מ&quot;מ NaCl). צנטריפוגה ב XG 200 עבור 30 s ב 4 ° C ולהסיר את supernatant. </li><li style=";text-align:right;direction:rtl"> חזור על שלב 5.1 שלוש פעמים. </li><li style=";text-align:right;direction:rtl"> הוספת 500 μL של חיץ חסימת (1x חיץ מחייב, 0.1% polyvinylpyrrolidone, 1 מ&quot;ג אלבומין אולטרה-טהור שור (BSA)) על חרוזים ולנער בעדינות במשך 1 - 2 שעות ב 4 ° C על שייקר פלטפורמה. </li><li style=";text-align:right;direction:rtl"> שטפו את החרוזים פעמיים נוספות עם 500 μL של חיץ מחייב, כפי שמתואר בשלב 5.1. </li><li style=";text-align:right;direction:rtl"> להוסיף 400 μL של חיץ מחייב את החרוזים. </li><li style=";text-align:right;direction:rtl"> העברת 100 μL של RNA (משלב 4.11) ישירות חרוזים. דגירה עם רעד עדין במשך 1 - 2 שעות ב 4 ° C על שייקר פלטפורמה. </li><li style=";text-align:right;direction:rtl"> שטוף את ברצף החרוזים עם 500 μL של חיץ מחייב, 500 μL של חיץ מלח נמוך (SSPE 0.2X, 1 mM EDTA, 0.05% Tween), 500 μL של חיץ מלח גבוה (0.25x SSPE, 1 mM EDTA, 0.05% Tween, 100 מ&quot;מ NaCl), ופעמיים עם 500 μL של חיץ TET (1x TE, 0.05% Tween), מסתובב בביתXG 200 למשך 30 שניות ב 4 מעלות צלזיוס בין כל שטיפה. </li><li style=";text-align:right;direction:rtl"> Elute רנ&quot;א BrUTP שכותרתו אמנות עשויים חרוזים ברצף, פעמיים עם 150 μl ופעם עם 200 μl של חיץ elution (20 מ&quot;מ DTT, 150 מ&quot;מ NaCl, 50 mM Tris-HCl 7.5 pH, 1 mM EDTA, 0.1% SDS), על ידי דוגרים עבור 4 דקות ב 42 מעלות צלזיוס באמבט מים ואחריו סיבוב קצר להפריד חרוזים מן supernatant. </li></ol> רטיבות 6. RNA שכותרתו BrUTP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 500 μL של פנול / כלורופורם קר / isoamyl אלכוהול (125: 24: 1) pH 4 - 5 עד הזיקה המטוהרת BrUTP שכותרתו RNA. מערבבים על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 15 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> מעבירים את השלב מימית העליון לצינור microcentrifuge חדש. </li><li style=";text-align:right;direction:rtl"> הוסף 5 מניות M NaCl כדי לקבל ריכוז סופי של פעמים 0.3 M ו -3 היקף אתנול קר לזרז את הרנ&quot;א. </li><li style=";text-align:right;direction:rtl"> לדגור לילה -20 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> אסוף את הרנ&quot;א זירז ידי צנטריפוגה ב 16,168 XG במשך 30 דקות ב 4 ° C. &lt;/ Li&gt; <li style=";text-align:right;direction:rtl"> הסר את supernatant ולאפשר גלולה לייבוש באוויר במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend גלולה רנ&quot;א 26 μL של מים DEPC. </li><li style=";text-align:right;direction:rtl"> קבע את ריכוז RNA הסופי על ידי מדידת הספיגה ב 260 ננומטר באמצעות ספקטרופוטומטר. כמו כן, קבע את היחס 260/280. יחס ~ 2 מעיד על מדגם RNA טהור. </li><li style=";text-align:right;direction:rtl"> אחסן את דגימות רנ&quot;א aliquots ב -80 ° C עד הצורך לסינתזה cDNA. </li></ol> 7. שעתוק לאחור של רנ&quot;א שכותרתו BrUTP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התאם את הריכוז RNA ל 100 ng / μL באמצעות מים DEPC. השתמש 0.5 מיקרוגרם של רנ&quot;א עבור כל תגובה סינתזה cDNA. הערה: ריכוז תבנית RNA עשוי לנוע בין 0.5 ל 1.0 מיקרוגרם להשיג סינתזת cDNA אופטימלית. </li><li style=";text-align:right;direction:rtl"> הפוך לתמלל את RNA באמצעות פריימרים הפוכים מרובים שנועדו במורד זרם של (אתר הסיום) פולי (א) אתר כפי שמוצג באיור 3 א. </li><li style=";text-align:right;direction:rtl"> לתגובה כל שעתוק לאחור, להוסיף 5 μl RNA templatדואר (0.5 מיקרוגרם), 1 μL תמהיל dNTP (10 מ&quot;מ כל אחד), 2 μL של C פריימר הפוכה, D, E, F או G (50 מיקרומטר אחד) (ראה איור 3 א) ומים חינם nuclease. היקף התגובה האחרון בצינור אחד הוא 13 μL. הערה: מספר התגובות שעתוק לאחור יהיה תלוי במספר פריימרים הפוך המשמש לסינתזת cDNA. לדוגמא, עבור ASC1 חמישה פריימרים הפוכים שמשו ולכן חמש תגובות שעתוק לאחור הוקמו. לייבל הצינורות כמו C, D, E, F ו- G על בסיס של פריימר הפוכה המשמש לסינתזת cDNA. </li><li style=";text-align:right;direction:rtl"> דגירת הצינורות המכילים תבנית RNA, תמהיל dNTP ו פריימרים ב thermocycler על 65 מעלות צלזיוס למשך 5 דקות כדי להסיר כל קונפורמציה מבני משני, ולאחר מכן לצנן עד 4 מעלות צלזיוס למשך 2 דקות לפחות. </li><li style=";text-align:right;direction:rtl"> הוסף 1 μL הפוכה transcriptase (200 U / μL), 4 μL חיץ 2 μL של 0.1 M DTT צינור אחד המכיל את תבנית רנ&quot;א פריימר (שלב 7.4). מערבבים על ידי pipetting בעדינות מעלה ומטה. </li><li style=";text-align:right;direction:rtl"> בצע שעתוק לאחור על ידי דוגר את תערובת התגובה ב thermocycler על 42 מעלות צלזיוס למשך 60 דקות. </li><li style=";text-align:right;direction:rtl"> להשבית transcriptase הפוכה על 65 מעלות צלזיוס למשך 20 דקות. </li><li style=";text-align:right;direction:rtl"> אחסן את cDNA ב -20 ° C או להמשיך לשלב הבא. </li></ol> הגברת 8. של cDNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע את תגובת PCR עבור הגברה של כל הכנה cDNA (שכותרתו C, D, E, F ו- G עבור ASC1) משלב 7.8 כדלקמן: 3.0 תבנית cDNA μL משלב 7.8, 1.0 B פריימר קדימה μL (10 מיקרומטר), 1.0 מיקרוליטר C פריימר הפוכה או D או E או F או G (10 מיקרומטר), 2.5 μL 10x פולימראז חיץ PCR, 0.5 μL תמהיל dNTP (10 מ&quot;מ כל אחד), 1.0 מיקרוליטר MgCl 2 (2.5 מ&quot;מ), 15.5 מים כיתה μL PCR, ו -0.5 אנזים פולימראז thermostable μL. הערה: דילולים שונים של תבנית cDNA הנעה בין 1: 5 ל -1: 100 צריכים להיבדק כדי לייעל את תשואת מוצר PCR. פריימר קדימה יחיד האמרגן-הפרוקסימלי ישמש כדי להגביר cDNAשהושג באמצעות פריימרים הפוך שונה. לדוגמא, ב פריימר קדימה יחיד הממוקם ליד האמרגן שמש בשילוב עם חמישה פריימרים הפוכים מ C ל G טוב ASC1. BC, BD, BE, BF ו BG שימשו צינורות שכותרתו כמו C, D, E, F ו- G בהתאמה כמוצג באיור 3 א. </li><li style=";text-align:right;direction:rtl"> הפעל את ה- PCR באמצעות פרמטרי רכיבת התרמית הבאות: 1 מחזור 95 מעלות צלזיוס למשך 2 דקות (להתחיל חם עבור הפעלה של פולימראז), 30 - 40 מחזורים 95 מעלות צלזיוס למשך 30 שניות (denaturation), 54 מעלות צלזיוס למשך 15 שניות (חישול) , 68 מעלות צלזיוס במשך דקות 1 (הארכה), מחזור 1 68 מעלות צלזיוס למשך 5 דקות (הארכה הסופית). הערה: טמפרטורת החישול תשתנה בהתאם פריימרים הספציפיים בשימוש והזמן הרחב ישתנה בהתאם לגודל התוצר הצפוי. </li><li style=";text-align:right;direction:rtl"> הפרד את מוצר ה- PCR על ידי אלקטרופורזה על 0.8%, 1.5%, או 2 ג&#39;לים agarose% בהתאם לגודל הצפוי של המוצר. </li><li style=";text-align:right;direction:rtl"> לכמת את מוצר ה- PCR, כמתואר El Kaderi et al. , 2012 11. הערה: לחילופין, להשתמש בזמן אמת אסטרטגיה RT-qPCR כדי לכמת את כמות תמלילי המתהווה. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

פרוטוקול TRO ספציפי הגדיל משמש כאן הותאם מן הפרוטוקול המשמש GRO-Seq (Global לרוץ על-רצף) ניתוח בתאי יונקים 12. אנחנו בהצלחה שונה בפרוטוקול ללמוד שעתוק המתהווה ב ניצני שמרים. כדי לנתח את פגם סיום שעתוק במיוחד, מתאמנים את הפרוטוקול נוסף על ידי להיפטר צעד הידרוליזה RNA...

מחזור שעתוק איקריוטיים מורכב משלושה שלבים עיקריים; ייזום, התארכות והפסקה. סיומו של שעתוק על ידי RNA פולימראז II מורכב משני שלבים ברורים, תלויים זה בזה 3. השלב הראשון כולל מחשוף, polyadenylation ושחרור mRNA מהתבנית, והוא ומיד אחריו את השלב השני, בסימן ההתנתקות של פולימראז מהתבנית. סיום נכון הוא קריטי עבור המחזור של פולימראז במהלך חניכה / reinitiation של שעתוק, למניעת הפרעה עם השעתוק של גנים במורד זרם, ולשמירתו שעתוק סוטה לבדוק על ידי הגבלת השעתוק של מתפשט ללא קידוד RNA 4, 5. למרות ההתקדמות שחלה באחרונה, סיום הוא ללא ספק צעד הבין לפחות של מחזור שעתוק RNA פולימראז II. Assay סיום אמין חיוני ללימוד מנגנון underlyinסיום שעתוק g ידי RNA פולימראז II in vivo. מספר גישות ניסיוניות המשמשים לאיתור פגם הסיום ב גן transcribing פעיל בתנאים פיסיולוגיים. אלה כוללים כתם הצפון, שבב גורם סיום (הכרומטין immunoprecipitation) ואת assay TRO המסורתית. כל הטכניקות האלה יש כמה יתרונות וחסרונות. את assay TRO המסורתי היה אמור להיות הגישה האמינה והרגישה ביותר לגילוי פגם סיום שעתוק vivo 1. assay זה localizes מולקולות פולימראז הפעילות יעתיק על אזורים שונים של גן בתוך התא. בתנאים רגילים, assay תערוכות מולקולות פולימראז מעורב תעתיק מופץ אך ורק בין אזור האמרגן terminator של (איור 1 א) הגן. עם הסיום פגום, לעומת זאת, פולימראז הוא לא יודע לקרוא את אות הסיוםוהוא זוהה באזור במורד הזרם של 3 &#39;בסוף של הגן (איור 1B). פגם סיום שעתוק מתבטא בנוכחות פולימראז חוש-בהעתקה שיזמה מאזור האמרגן-הפרוקסימלי, ולהיות מסוגל לקרוא את אות הסיום, ממשיך transcribing באזור במורד הזרם של סוף &#39;3 של גן כפי שמוצג באיור 2A. עם ההכרה כי הגנום האיקריוטים מפגין שעתוק מתפשט המכריע במובן וכן כיוונים אנטי תחושה בתוך ומסביב גן 6, 7, 8, 9, 10, עד מהרה התברר כי assay TRO המסורתי אינו יכול לזהות אם האות פולימראז במורד הזרם של גן מייצג תעתיק ביוזמת האמרגן (איור 2 א) או RNA סוטה שיזמה סוםewhere באמצע הגן או במורד הזרם של אלמנט terminator (איור 2 ב), או בהעתקת פולימראז בכיוון אנטי תחושה מסוף &#39;3 של הגן (איור 2 ג). את assay TRO ספציפי גדיל באמצעות BrUTP המתואר כאן ניתן להבחין אם האות פולימראז readthrough ציין מייצג mRNA במשמעות הרחבה ביוזמת האמרגן או תמליל אנטי במובן זה יזם במורד הזרם של הגן תחת בחינה. השתמשנו בהצלחה את הגישה הזאת כדי להדגים את התפקיד של קינאז Kin28 לסיום שעתוק ניצני שמרים 2. תוך שימוש בגישה כאן אנו מראים כי Rna14 נדרשת להפסקת השעתוק של ASC1 ב ניצני שמרים.

<table><tbody><tr><td>Phenol-chloroform-isoamyl alcohol mixture</td><td>Sigma-Aldrich</td><td>77619</td><td>pH 4-5</td></tr><tr><td>TRIzol reagent</td><td>Life technologies</td><td>15596-026</td><td></td></tr><tr><td>RNase Inhibitor, human placenta</td><td>New England Biolabs</td><td>M0307S</td><td></td></tr><tr><td>Anti-BrdU beads</td><td>Santa Cruz Biotechnology</td><td>sc-32323AC</td><td></td></tr><tr><td>Protoscript II</td><td>New England Biolabs</td><td>M03368L</td><td>or an equivalent enzyme</td></tr><tr><td>Advantage 2 polymerase Mix</td><td>Clontech</td><td>639201</td><td>or an equivalent enzyme</td></tr><tr><td>5-Bromouridine 5&#039; triphosphate sodium salt</td><td>Santa Cruz Biotechnology</td><td>sc-214314A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>ATP</td><td>New England Biolabs</td><td>N0451AA</td><td></td></tr><tr><td>CTP</td><td></td><td>N0454AA</td><td></td></tr><tr><td>GTP</td><td></td><td>N0452AA</td><td></td></tr><tr><td>Ultra-pure bovine serum albumin (BSA)</td><td>MC Labs</td><td>UBSA-100</td><td></td></tr><tr><td>Asc1 B</td><td></td><td></td><td>AGATTCGTCGGTCACAAGTCC</td></tr><tr><td>Asc1 C</td><td></td><td></td><td>GAACTTTATACATATTCTTAGTT&lt;br/&gt; AGCAGTC</td></tr><tr><td>Asc1 D</td><td></td><td></td><td>TGTACATATGTATTTTCGCAGCA</td></tr><tr><td>Asc1 E</td><td></td><td></td><td>GCCAAGGAGACTGAATTTAATG</td></tr><tr><td>Asc1 F</td><td></td><td></td><td>CTATGGAATGGGGGTTTTAAG</td></tr><tr><td>Asc1 G</td><td></td><td></td><td>GGTTATGGCAGACATGCCAC</td></tr><tr><td>5s cDNA</td><td></td><td></td><td>AGATTGCAGCACCTGAGT</td></tr><tr><td>5&amp;rsquo; 5s reverse</td><td></td><td></td><td>GGTTGCGGCCATATCTAC</td></tr><tr><td>3&amp;rsquo; 5s reverse</td><td></td><td></td><td>TGAGTTTCGCGTATGGTC</td></tr></tbody></table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

כתב יד זה מתאר פרוטוקול לאיתור פגם סיום שעתוק in vivo. פרוטוקול TRO ספציפי הגדיל באמצעות BrUTP המתואר כאן הוא גישה ניסויית עצמה לניתוח פגם סיום שעתוק בתנאים פיסיולוגיים. כמו assay TRO המסורתי, היא מסתמכת על הנוכחות של פולימראז תעתיק פעיל מעבר סוף &#39;3 של גן כאינדיקטור פגם סיום שעתוק 1. זה מתגבר שתי בעיות עיקריות נתקלו עם assay TRO המסורתי. ראשית, הוא יכול לזהות אם פולימראז שקרא את אות הסיום הוא זה שיזם שעתוק מאזור האמרגן-הפרוקסימלי, או אם זה פשוט מייצג פולימראז transcribing pervasively שיזם הלא במיוחד מאיפשהו בגוף או &#39;3 סוף הגן. שנית, הוא יכול להבחין אם אות פולימראז הפעילה תעתיק מעברבאזור terminator הוא באמת mRNA תחושה readthrough transcribing פולימראז או אות רנ&quot;א אנטי במובן הלא קידוד terminator ביוזמת. בקצרה, פרוטוקול כרוך permeabilizing התאים שמרים גדל באופן אקספוננציאלי, מה שמאפשר את תמלילי כי יזם in vivo כדי להאריך בנוכחות של נוקלאוטיד BrUTP, טיהור RNA שכותרתו BrUTP לפי הגישה זיקה, הפוכה טרח להכין את RNA המתהווה מטוהרים הגברה cDNA באמצעות פריימרים גדיל ספציפי איגוף האמרגן ואת אזורי terminator של הגן 2.

כדי להדגים את תחולת הנוהל TRO BrUTP גדיל ספציפי באיתור מום סיום שעתוק, השתמשנו מוטציה סיום-פגום, רגיש בטמפרטורה של RNA14 שנקרא rna14-1. תפקידו של Rna14 לסיום שעתוק על ידי RNA פולימראז II הודגם באמצעות assay TRO המסורתי שמזוהה RNA באזור terminator-הפרוקסימלי של גנים ?...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

ניתוח של הפסקת תמלול שימוש BrUTP גדיל ספציפי התמלול Run-על (TRO) גישה

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Universidad San Sebastian

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K Views.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

ניתוח בזמן אמת של גורם שעתוק כריכה, תמלול, תרגום, מחזור ולהציג אירועים גלובליים במהלך ההפעלה הסלולרית

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

ניתוח Toeprinting של תרגום חניכה היווצרות מורכבות על יונקים mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

Biochemistry

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

RNA מלאכותי פולימראז השני מכלולי התארכות לניתוח אירועים בעיבוד RNA

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Mapping the Structure-Function Relationships of Disordered Oncogenic Transcription Factors Using Transcriptomic Analysis

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these proteins contain an intrinsically disordered domain (IDD) fused with the DNA-binding domain (DBD) of another protein and orchestrate widespread transcriptional changes to promote malignancy. These fusions are often the sole recurring genomic aberration in the cancers they cause, making them attractive therapeutic targets. However, targeting oncogenic transcription factors requires a better understanding of the mechanistic role that low-complexity, IDDs play in their function. The N-terminal domain of EWSR1 is an IDD involved in a variety of oncogenic fusion transcription factors, including EWS/FLI, EWS/ATF, and EWS/WT1. Here, we use RNA-sequencing to investigate the structural features of the EWS domain important for transcriptional function of EWS/FLI in Ewing sarcoma. First shRNA-mediated depletion of the endogenous fusion from Ewing sarcoma cells paired with ectopic expression of a variety of EWS-mutant constructs is performed. Then RNA-sequencing is used to analyze the transcriptomes of cells expressing these constructs to characterize the functional deficits associated with mutations in the EWS domain. By integrating the transcriptomic analyses with previously published information about EWS/FLI DNA binding motifs, and genomic localization, as well as functional assays for transforming ability, we were able to identify structural features of EWS/FLI important for oncogenesis and define a novel set of EWS/FLI target genes critical for Ewing sarcoma. This paper demonstrates the use of RNA-sequencing as a method to map the structure-function relationship of the intrinsically disordered domain of oncogenic transcription factors.

Intrinsically disordered domains are important for oncogenic fusion transcription factor function. To therapeutically target these proteins, a more detailed understanding of the regulatory mechanisms employed by these domains is required. Here, we use transcriptomics to map important structural features of the intrinsically disordered EWS domain in Ewing sarcoma.

מיפוי קשרי מבנה-פונקציה של גורמי שעתוק אונקוגניים מופרעים באמצעות ניתוח תמלול

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these ...

Cancer Research

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

שיטה מהירה תפוקה גבוהה עבור Ribonucleoproteins מיפוי (RNPs) על mRNA מראש אדם

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biology

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR-Clip - שיטה לזהות Transcriptome רחב אתרי קישור של חלבונים RNA הכבילה

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

ניתוח של תגובות RNA עיבוד באמצעות מערכות חינם ניידים: 3 &#39;סוף המחשוף של Pre-mRNA מצעים<em&gt; במבחנה</em

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is achieved by reverse transcription of the RNA of interest using specific fluorescently labeled primers and subsequent analysis of the resulting cDNA fragments by denaturing polyacrylamide gel electrophoresis. Simultaneously, a traditional Sanger sequencing reaction is run on the gel to map the ends of the cDNA fragments to their exact corresponding bases. In contrast to 5&#39;-RACE (Rapid Amplification of cDNA Ends), where the product must be cloned and multiple candidates sequenced, the bulk of cDNA fragments generated by primer extension can be simultaneously detected in one gel run. In addition, the whole procedure (from reverse transcription to final analysis of the results) can be completed in one working day. By using fluorescently labeled primers, the use of hazardous radioactive isotope labeled reagents can be avoided and processing times are reduced as products can be detected during the electrophoresis procedure.
In the following protocol, we describe an in vivo fluorescent primer extension method to reliably and rapidly detect the 5&#39; ends of RNAs to deduce transcriptional starting points and RNA processing sites (e.g., by toxin-antitoxin system components) in S. aureus, E. coli and other bacteria.

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

We here describe a fluorescence based primer extension method to determine transcriptional starting points from bacterial transcripts and RNA processing in vivo using an automated gel sequencer.

טכניקת הארכת פריימר בהתבסס הקרינה לקביעת נקודות התחלת תעתיק ומחשוף אתרים של RNases<em&gt; In vivo</em

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is ...

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single strands, each requiring distinct modes of replication: continuous (leading) and discontinuous (lagging). Understanding the interactions of chromatin-associated proteins with replicating DNA strands in vivo is crucial for elucidating the mechanisms of chromatin assembly and DNA repair coupled to DNA replication. This protocol presents the enrichment and sequencing of protein-associated nascent DNA (eSPAN) method, designed to quantify relative protein levels on nascent leading and lagging DNA strands at replication forks. The eSPAN procedure starts with chromatin immunoprecipitation (ChIP, in yeast) or cleavage under targets and tagmentation (CUT&amp;Tag; in mammalian cells) of a protein of interest, followed by enrichment of the protein-associated nascent DNA by bromodeoxyuridine (BrdU) immunoprecipitation. Strand-specific next-generation sequencing is applied to isolated ssDNA. This technique can be used to determine whether a protein is enriched at leading or lagging replication forks. The eSPAN provides genome-wide strand-preference of chromatin-associated proteins, including histones at replication forks.

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single ...

Transcription Attenuation in Prokaryotes

Transcriptional attenuation occurs when&#160;RNA transcription is prematurely terminated due to the formation of a terminator mRNA hairpin structure.&#160; Bacteria use these hairpins to regulate the transcription process and control the synthesis of several amino acids including histidine, lysine, threonine, and phenylalanine. Transcription attenuation takes place in the non-coding regions of mRNA.
There are several different mechanisms used to attenuate transcription. In ribosome mediated transcriptional attenuation, the movement of a ribosome on the transcript is stalled or proceeds forward depending upon the availability of the tRNAs charged with a specific amino acid. High amino acid concentrations allow the ribosome to move forward leading to the formation of the terminator structure; deficiency of the amino acid stalls the ribosome and causes formation of the anti-terminator structure. The trp operon in E. coli, discussed below, is a good example of this type of mechanism. tRNA mediated transcriptional attenuation, as observed in trp operon of Lactococcus lactis, depends on an RNA-RNA interaction. When uncharged tRNAs are present in sufficient numbers, they directly bind to the mRNA and stabilize the anti-terminator structure. Transcriptional attenuation is also known to be mediated by proteins as found in bgl (beta-glucoside) operon in E. coli.&#160; This involves an RNA&#8212;protein interaction where a protein binds to the transcript and regulates the formation of an anti-terminator structure. More recently, another transcriptional attenuation mechanism was discovered where small metabolites like thiamine were observed to regulate transcription by directly binding to the non-coding mRNA segments, also known as riboswitches. Riboswitches can form a terminator or an anti-terminator structure depending upon the concentration and nature of a metabolite.&#160;
Trp Operon
The trp operon in E. coli contains a 140 nucleotide leader sequence before its first structural gene. This leader sequence has four distinct segments &#8211; 1 through 4&#8211; and regulates the transcription of the downstream structural genes. Segment&#160; 1 can form a hairpin structure with segment&#160; 2. This 1-2 hairpin structure is known as a pause structure, as during transcription, it stalls RNA polymerase until the ribosome binds the newly transcribed RNA. This synchronizes transcription and translation in bacteria.&#160; When tryptophan concentrations are low, a hairpin structure forms between segments 2 and 3, known as the anti-terminator structure. This anti-terminator structure allows the continuous transcription of the downstream genes which produce enzymes for tryptophan synthesis. In contrast, when tryptophan concentrations are sufficient, a hairpin structure forms between segments 3 and 4, called the terminator structure. Along with a&#160; series of uracil bases that follow, the terminator structure causes RNA polymerase to dissociate from the RNA and template DNA strands, resulting in the termination of the transcription.

ניתוח של הפסקת תמלול שימוש BrUTP גדיל ספציפי התמלול Run-על (TRO) גישה

Summary

Explore More Videos

Chapters in this video