Name: toeprinting analysis of translation initiation complex formation on mammalian mrnas
Uploaded: 2018-05-10T13:00:00.000+00:00
Duration: 10 min 37 s
Description: Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

이 작품 혁신 존 R. 에반스 지도자 기금 (35017), 캠퍼스 앨버타 혁신 프로그램 및 앨버타 정부는 자연과학 및 공학 연구 위원회의 캐나다 발견 그랜트 (RGPIN-2017-05463), 캐나다 기초에 의해 투자 되었다 경제 개발 및 무역입니다.

참고: RNA는 ribonucleases (RNases)에 의해 저하에 매우 취약. RNA를 그대로 유지 하는 표준 예방 조치. 글러브를 자주 변경 합니다. 프로토콜의 모든 단계에서 필터링 된 피 펫 팁, nuclease 무료 plasticware 및 nuclease 없는 화학 물질을 사용 합니다. Nuclease 무료 사용 또는 diethyl pyrocarbonate (DEPC)-모든 솔루션에 대 한 물 처리.
1입니다. 솔루션의 준비
<ol><li>Toeprinting 버퍼 준비: 20 mM Tris HCl (pH 7.6), 100 mM KOAc, 2.5 m m Mg(OAc)2, 5% (w/v) 자당, 2 m m dithiothreitol (DTT), 그리고 0.5 m m spermidine.<ol>
<li>DTT와 spermidine 반복된 freeze-thaw 주기를 피하기 위해-20 ° C에서 단일 사용 aliquots에 저장. 참고: DTT와 spermidine는 사용 하기 바로 전에 toeprinting 버퍼에 추가 되어야 합니다. DTT와 spermidine 솔루션-20 ° c.에 저장 될 수 있다</li>
	</ol>
</li>
	<li>85 m m 5'-guanylyl imidodiphosphate (GMP PNP)와 91 m m 아데노신 3 인산 염 (ATP)의 aliquots를 준비 합니다. -20 ° c.에 aliquots 저장</li>
	<li>450 mL 6 %polyacrylamide-7 M 요소 젤 믹스의 준비: 40 %acrylamide:bis 67.5 mL-아크릴 (19:1), 요소, TBE (트리 스/borate/thylenediaminetetraacetic 산 (EDTA)), x 5의 112.5 mL 및 물 120 mL의 189 g. 37 ° C 물 목욕 또는 감동과 뜨거운 접시에 온난 하 여는 요소를 분해. 필터링 솔루션 (예., 0.2 μ m 니트로 진공 필터). 참고: 솔루션 저장할 수 있습니다 4 ° C에서 한 달 이상. 주의: 아크릴 단위체는 피부를 통해 흡수 될 수 있는 neurotoxin입니다. 피부 접촉을 피하기 위해 상당한 주의 (즉., 장갑, 실험실 외 투를 착용 하 고 눈 보호). 으로 중 합을 100% 완료 진행 하지 않을 수 있습니다 polyacrylamide 또한 주의 처리 되어야 합니다.</li>
	<li>Formamide 로드 염료 준비: 95 %formamide, 18 mM EDTA, 0.025% (w/v) 나트륨 라우릴 황산 염 (SDS), 0.025% (w/v) bromophenol 블루, 0.025% (w/v) 자일 렌 cyanol. -20 ° c.에 게</li>
	<li>10 pmol/μ의 작업 집중에 대 한 물 100 μ로 1 nmol 뇌관 (5' CTCGATATGTGCATCTGTA; 5' 끝-IRDye 800으로 표시)의 분해. 빛에서 보호 하에 단일 사용 aliquots (약 10 µ L),-20 ° C에서 저장 합니다.</li>
</ol>2입니다. mRNA의 준비
<ol><li>적절 한 서식 파일에서 중 합 효소 연쇄 반응 (PCR)에 의해 mRNA의 합성에 대 한 서식 파일 DNA 증폭 (즉., 게놈 DNA 또는 플라스 미드 DNA, 적절 한). 높은 충실도 제조업체의 지침에 따라 DNA 중 합 효소를 사용 하 여 다음 반응 조건 (35 주기): 녹기, 98 ° C, 10 s; anneal, 53 ° C, 20 s; 확장, 72 ° C, 30 s. 참고: 앞으로 뇌관 (5' AAGCTTAATACGACTCACTATAG) 통합 RNA 녹음 방송; 있도록 T7 발기인 순서 반전 뇌관 (5' T51GAATTCGGATCCGACCGTGG) 51 thymine 잔류물 베낀된 RNA에 대 한 폴 리 A 꼬리를 제공 하기 위해 포함 되어 있습니다. Note RNA에 생체 외에서 플라스 미드 DNA에서에서 복사할 수도 있습니다.</li>
	<li>체 외에 적절 한 전송 키트를 사용 하 여 IRES 포함 된 RNA 또는 DNA 템플렛에서 출장된 RNA를 고쳐 쓰다 제조업체의 지침을 따릅니다. 표준 20 μ 반응 볼륨에서 RNA 샘플을 준비 합니다. 37 ° c.에 30 분 동안 RNase 무료 DNase의 2 대와 새로 합성 RNA를 취급</li>
	<li>110 DNase 취급 RNA 희석 nuclease 무료 물 µ L 110 µ L 산 페 놀, 소용돌이 5 s와 3 분 동안 원심 분리기 실 온에서 20000 x g에 추가. 새로운 1.5 mL microfuge 관에 수성 단계의 100 µ L를 제거 3m 나트륨 아세테이트, 및 소용돌이 2 미 추가, 100% 에탄올, 소용돌이 5 s의 3 볼륨 10 µ L을 추가 하 고 하룻밤-20 ° C에서 RNA 침전.</li>
	<li>원심 > 삭제는 상쾌한 4 ° C에서 30 분 동안 20000 x g. 얼음 처럼 차가운 70% (v/v) 에탄올의 500 µ L와 펠 릿을 세척 하 고는 원심 분리를 반복. 많은 가능한 상쾌한으로 발음 하 고 5-10 분에는 펠 릿을 꺼내 려 하지 않도록 주의 대 한 펠 릿을 건조.</li>
	<li>Nuclease 무료 물 0.5 μ g/μ의 작업 농도를 적절 한 볼륨에는 RNA를 resuspend. 이-80 ° C에 저장 하거나 즉시 사용 될 수 있습니다.</li>
</ol>3. Toeprinting 반응
<ol><li>토끼 1 μ (40 대) RNase 억제제, 1 µ L 91 mM ATP의 (최종 1.82 m m) 및 1.5 mL microfuge 관 85 mM GMP PNP (최종 1.7 m m)의 1 μ의 Reticulocyte Lysate (RRL, nuclease 치료 하지 않을)의 혼합 15 μ. 5 분 30 ° C에서 품 어. 참고:는 RRL 반복적인 동결 해빙을 피하기 위해 단일 사용에 대 한 aliquoted 이어야 한다. 중요 한 제어 RRL, 반전 녹음 방송 RNA의 이차 구조 때문의 자연 일시 중지를 명료 하 게 하기 위해 부족 한 반응입니다. Toeprinting 버퍼 RRL이이 컨트롤에 대 한 대체를 추가 합니다.</li>
	<li>RNA의 0.5 µ g (1 µ L)를 추가 하 고 5 분 30 ° C에서 품 어.</li>
	<li>Toeprinting 버퍼의 22 µ L을 추가 하 고 3 분 동안 30 ° C에서 품 어.</li>
	<li>IRDye 표시 된 뇌관의 0.5 µ L (5 pmol)를 추가 하 고 10 분 동안 얼음에 품 어.</li>
	<li>2 µ L 25 mM dNTPs의 추가 (최종 농도: 1 m m), 2 µ L 100 mM Mg(OAc)2, 1 µ L의 조류 Myeloblastosis 바이러스 역전사 (AMV-RT)과 Toeprinting 버퍼의 3.5 µ L의. 마지막 볼륨은 50 μ.</li>
	<li>45 분 30 ° C에서 반응을 품 어.</li>
	<li>Nuclease 무료 물 200 µ L을 추가 하 고 즉시 25:24:1 페 놀: 클로 프롬: isoamyl 알콜 (pH 약 8.0)의 250 µ L를 추출. 소용돌이 5 s 하 고 실 온에서 3 분 20000 x g에서 원심 분리기. 새로운 1.5 mL microfuge 관에 수성 단계 제거 100% 에탄올, 소용돌이 5 s의 3 볼륨을 추가 하 고 하룻밤-20 ° C에서 침전.</li>
	<li>원심 > 삭제는 상쾌한 4 ° C에서 30 분 동안 20000 x g. 얼음 처럼 차가운 70% (v/v) 에탄올의 500 µ L로 DNA 펠 릿을 세척. 원심 > 20000 x g 4 ° c.에서 15 분 Aspirate 가능한 및 5-10 분에 대 한 펠 릿은 펠 릿을 꺼내 려 하지 않도록 주의 해야 건조 공기 만큼 표면에 뜨는.</li>
	<li>Nuclease 무료 물 6 μ에 펠 릿을 녹이 고 염료를 로드 하는 formamide의 3 μ를 추가.</li>
</ol>4. 연속 반응
<ol><li>2.1에서 DNA 템플렛 및 3.4 단계에서 IRDye 라는 뇌관을 사용 하 여 체인 출현으로 dideoxynucleotides (ddNTPs)를 사용 하 여 표준 연속 반응에 대 한. 적절 한 DNA 시퀀싱 장비를 사용 하 고 제조업체의 지침을 따르십시오.</li>
	<li>Formamide 로드 하는 염료의 3 μ와 각 연속 반응의 믹스 6 μ</li>
</ol>5입니다. 시퀀싱 하는 젤 전기 이동 법의 준비
참고:이 프로토콜 사용 하 여 형광 젤 기반 영상 고는 21 cm x 23cm x 0.2 m m 젤 하지만 필요한 경우 다른 시퀀서 또는 젤-크기, 적응 시킬 수 있다.
<ol><li>0.2 m m 간격으로 짧은 (23 × 25 cm) 및 긴 100% 에탄올 (30 × 25 cm) 유리 접시를 철저 하 게 청소. 건조 공기.</li>
	<li>6 %polyacrylamide-7 M 우 레 아 젤의 믹스 30 mL 200 μ 10% (w/v) 암모늄 persulfate (AP)의 혼합 및 tetramethylethylenediamine (TEMED)의 20 μ. 젤, 거품을 피하기 위해 돌을 부 어 하 고 ' 상어 이빨 ' 젤 빗을 삽입 합니다. 실 온에서 1 h에 대 한 유해를 젤을 수 있습니다.</li>
	<li>시퀀싱 기구를 조립 하 고 1 저수지를 채울 x TBE.</li>
	<li>사전 실행 15 분 1500 V에서 55 ° C의 최적의 온도 달성 될 때까지.</li>
	<li>샘플/로드 염료 혼합 (3.9 또는 4.2 단계)에서 85 ° C 5 분 부하 1 μ 시퀀싱 젤에 대 한 열.</li>
	<li>1500 V 8 h에 젤을 실행 합니다. 기계는 실시간으로 밴드를 읽을 것 이다.</li>
	<li>분해 장치, 그리고 아크릴 아 미드 젤 실행 버퍼를 처분.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

저자 관심을가지고 아무 충돌-의-공개.

Toeprinting 직접 고도로 제어 된 상황에서 번역 개시 복합물의 대형을 지원 하기 위해의 RNA의 능력을 측정 하는 강력한 기술입니다. Toeprinting에 대 한 단순화 된이 프로토콜 설명 포유류 RNAs. 토끼 reticulocyte lysate (RRL) 리보솜, eIFs, 초기자의 편리한 원본으로 사용 되, tRNA와 IRES 트랜스-행동 요인 (ITAFs). 실험 선택의 그들의 RNA를 제공 하 고 또한 그들의 선택의 특정 공동 인자와 toeprinting 반응을 보...

으로 번역 가장 세포 에너지 소비, 그것은 말 번역은 단단히 규제1. 반대로, 번역의 dysregulation-그리고 단백질 출력에 따른 변경-암1,2등, 스트레스 반응과 질병의 상태에서 자주 관찰 됩니다. 변환 제어의 주요 장점은 속도는 셀 다양 한 자극3에 대응 하기 위해 그들의 단백질 출력 변경할 수입니다. 번역 규정 따라서 세포 생존과 죽음1,2,3에 영향을 미칠 수 있는 중요 한 메커니즘을 나타냅니다. 번역의 단계의 개시는 대부분 높은 규제 하 고 복잡 한3입니다. 짧게, 가장 진 핵 mRNAs 포함 5' m7G 모자는 거의 항상 그들의 번역에 대 한 필수. 모자-종속 개시 진 핵 개시 요인 eIF4E, eIF4A, 및 eIF4G 필요 (모자 인식 복합)는 mRNA의 5' 끝에 상호 작용. 43S preinitiation 리보솜, eIF2 바인딩된 초기자를 포함 하는 mRNA를 통해 eIF3와 eIF4G의 상호 작용의 5' 끝에 tRNA와 eIF3, 모집. 복잡 한 괴롭힘 스캔 mRNA, eIF4A에 의해도 왔 생각 된다 (RNA helicase) 시작 codon (8 월)는 때까지. 복잡 한 48S 개시 이후에 형성 그리고 tRNA는 리보솜의 P 사이트에 전달 됩니다. 마지막으로, 60와 40 리보솜 소 단위 번역 신장1,,34다음 80 개시, 복잡 한 형태로 결합 된다. 반면, 내부 리보솜 입장 위치 (IRESes) 개시 코 돈3에 직접 40 ribosomal 소 단위를 모집 하 여 5' 모자에 대 한 요구 사항을 무시할. 생리 적 스트레스 상태 감소 글로벌 mRNA 번역 키 일반 진 핵 개시 요인 (eIFs)의 수정으로 인. 그러나, 종종 스트레스 대응 단백질을 인코딩하는 특정 mRNAs의 선택적 번역 비 정식 번역 개시 메커니즘을 사용 하 고 비 정식 번역 개시의 dysregulation 암 같은 질병 상태에 연루 1 , 2. 세포 IRESes 등 신중 RNA 규제 요소 같은 mRNAs2,3의 번역에 대 한 허용.
변환 제어의 1 개의 특히 재미 있는 양상은 특정된 mRNA의 비 정식 번역 대 정식의 메커니즘을 이해 하는 것입니다. Toeprinting 특정 RNAs 체 외의 번역 개시의 상세한 기계 연구를 허용 하는 기술입니다. Toeprinting의 전반적인 목표는 시퀀스, 구조 요소 또는 액세서리 결정 하기 위해 다양 한 조건에서 리보솜으로 복잡 한 번역 개시의 형성을 nucleate 관심의 RNA의 능력을 평가 하는 요소는 효율적인 번역 개시에 대 한 필요 합니다. 예를 들어, 리보솜 모집 5' 캡의 부재에 방해 수도 있습니다 하지만 한 IRES의 존재에 의해 자극.
체 외에서 하는 것입니다 기술의 원리 개시 단지 형태로, 그리고 반전 녹음 수 있도록 변환 컴포넌트 (또는 순화 된 구성 요소)을 포함 하는 세포 추출의 존재 그것을 품 어 관심, RNA 녹음 특정 뇌관는 RNA 안정적인 RNA 리보솜 단지 반전 녹음 방송에 리보솜의 소위 'toeprint'5,,67의 3' 가장자리에 발생 합니다.
이 프로토콜, ribosomal 소 단위, eIFs, tRNAs, 및 IRES 트랜스-행동 요인 (ITAFs)는 편리 하 게 토끼 reticulocyte lysate (RRL)에 의해 기여. 이 프로토콜의 또 다른 장점은 붙일 표시 된 뇌관 및 형광 젤 기반 영상, 보다는 오히려 방사선된 뇌관의 사용 이다. 이 등 radiolabeling 뇌관로 젤을 건조 강화 화면에 노출 하는 추가 단계를 제거 합니다. 형광 밴드는 큰 해상도 대 한 허용 젤 실행으로 실시간으로 기록 됩니다. 비록 출장된 mRNAs 또한이 기술을8에 의해 분석 될 수 있다 apoptosis 단백질 (XIAP) IRES RNA의 세척제 X 연결 억제제 여기, 예를 들어 사용 됩니다.
세포 lysates의 번역 과정의 최종 출력을 측정, 서쪽 분석, 달리 toeprinting은 번역 개시는 RNA에 복잡 한 대형을 측정 하기 위해 생체 외에서 접근 이다. 이 reductionist 접근 기판 또는 번역 개시 통제 요인의 매우 상세한 연구에 대 한 수 있습니다 (예., 출장 또는 취소 출장 mRNA, IRES 구조, 존재 또는 부재 특정 단백질 요인의, 폴 리 A 꼬리의 등)입니다. 따라서, toeprinting 번역8 다른 모드 또는 mRNA, 같은 구조 IRESes, 단백질 합성9,10의 효과 연구에 사용할 수 있습니다.

<table><tbody><tr><td>DEPC (Diethyl pyrocarbonate)</td><td>Sigma</td><td>D5758-100ML</td><td></td></tr><tr><td>TRIS base, Ultrapure</td><td>JT Baker</td><td>4109-01</td><td></td></tr><tr><td>KOAc (Potassium acetate)</td><td>Bio Basic</td><td>PB0438</td><td></td></tr><tr><td>Mg(OAc)&lt;sub&gt;2&lt;/sub&gt; (Magnesium acetate tetrahydrate)</td><td>Bio Basic</td><td>MB0326</td><td></td></tr><tr><td>Sucrose, molecular biology grade</td><td>Calbiochem</td><td>573113-1KG</td><td></td></tr><tr><td>Spermidine</td><td>Sigma</td><td>85558</td><td></td></tr><tr><td>GMP-PNP (Guanosine 5&amp;prime;-[&amp;beta;,&amp;gamma;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td><td>Sigma</td><td>G0635</td><td></td></tr><tr><td>ATP (Adenosine 5&amp;prime;-triphosphate) disodium salt, 100 mM solution</td><td>Sigma</td><td>A6559</td><td></td></tr><tr><td>19:1 Acrylamide:bis-acrylamide, 40%</td><td>Bio Basic</td><td>A0006</td><td></td></tr><tr><td>Urea</td><td>Bio Basic</td><td>UB0148</td><td></td></tr><tr><td>500mL bottle top filtration units, 0.2 &amp;micro;m</td><td>Sarstedt</td><td>83.1823.101</td><td></td></tr><tr><td>Formamide</td><td>Sigma</td><td>F9037-100ML</td><td></td></tr><tr><td>EDTA (disodium salt, dihydrate)</td><td>Bio Basic</td><td>EB0185</td><td></td></tr><tr><td>SDS</td><td>Bio Basic</td><td>SB0485</td><td></td></tr><tr><td>Bromophenol blue</td><td>Bio Basic</td><td>BDB0001</td><td></td></tr><tr><td>Xylene cyanol FF</td><td>Bio Basic</td><td>XB0005</td><td></td></tr><tr><td>MEGAshortscript T7 transcription kit</td><td>Ambion</td><td>AM1354</td><td></td></tr><tr><td>mMESSAGE mMACHINE T7 transcription kit</td><td>Ambion</td><td>AM1344</td><td></td></tr><tr><td>Acid Phenol:Chloroform (5:1)</td><td>Ambion</td><td>AM9722</td><td></td></tr><tr><td>25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td><td>Invitrogen</td><td>15593-049</td><td></td></tr><tr><td>Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td><td>Green Hectares, USA</td><td></td><td>Contact Green Hectares, ask for 1:1 RRL:water</td></tr><tr><td>RiboLock RNase Inhibitor (40 U/&amp;micro;L)</td><td>Thermo Fisher</td><td>E00382</td><td></td></tr><tr><td>100 mM dNTPs</td><td>Invitrogen</td><td>56172, 56173, 56174, 56175</td><td>Mix equal parts for a stock of 25 mM each.</td></tr><tr><td>AMV-RT, 10 U/&amp;micro;L</td><td>Promega</td><td>M5101</td><td></td></tr><tr><td>Sequenase Version 2.0 DNA Sequencing Kit</td><td>Thermo Fisher</td><td>707701KT</td><td></td></tr><tr><td>Model 4200 IR2 DNA analyzer</td><td>LI-COR</td><td></td><td>Product has been discontinued</td></tr><tr><td>APS (Ammonium Persulfate)</td><td>Bio Basic</td><td>AB0072</td><td></td></tr><tr><td>TEMED</td><td>Bio Basic</td><td>TB0508</td><td></td></tr><tr><td>Phusion High Fidelity Polymerase</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>Turbo Dnase</td><td>Thermo Fisher</td><td>AM2238</td><td></td></tr></tbody></table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

번역 개시 단백질 합성의 속도 제한 단계 이며, 세포 단백질 출력을 조절 하는 핵심을 나타냅니다. 단백질 합성의 세포질 긴장 응답, 열쇠 이며 dysregulation 암 등 많은 질병 상태에 중앙 이다. 예를 들어, 세포 스트레스 글로벌 번역의 억제를 약하게 모자 종속 개시 리드, 비록 특정 스트레스 응답 단백질에 모자 독립적인 방식으로 선택적으로 변환 됩니다. 신중한 RNA 규제 등의 요소, 세포 내부 리보솜 입장 위치 (IRESes),이 특정 한 mRNAs의 번역에 대 한 수 있습니다. 이러한 mRNAs의 식별 및 그들의 규제 메커니즘의 특성 분자 생물학에는 핵심 영역 되었습니다. Toeprinting 번역 개시에 관련 된 RNA 구조와 기능 연구에 대 한 방법입니다. Toeprinting의 목표는 생체 외에서 의 능력을 평가 하는 시퀀스, 구조 요소 또는 액세서리 요인 리보솜에 참여를 결정 하기 위해 다양 한 조건에서 리보솜과 안정 되어 있는 복합물을 형성 하는 RNA 베 껴 바인딩-효율적인 번역 개시에 대 한 사전 커서. 서쪽 분석 및 polysome 프로 파일링와 같은 다른 기술 함께 toeprinting 번역 개시의 규칙에 대 한 메커니즘의 강력한 특성에 대 한 수 있습니다.

우리는 이전 모자 독립적인 번역 개시 생체 외에서8,10을 지원 하기 위해 XIAP IRES의 능력을 설명 했습니다. Toeprinting 복잡 한 XIAP IRES 개시의 기계적 세부가 핵심 기술 했다. 인코딩 XIAP IRES (그림 1A)를 포함 하는 mRNA는 DNA 구조에 생체 외에서 복사할 및 toeprinting 분석을 받게 했다. 여?...

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

Toeprinting 목표 체 외에서 의 능력을 측정 하는 다양 한 조건에서 리보솜과 양식 번역 개시 복합물에 RNA를 복사할 수 있습니다. 이 프로토콜 toeprinting 포유류 RNA에 대 한 메서드를 설명 하 고 모자-종속 및 IRES 기반 번역 공부 하는 데 사용할 수 있습니다.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Universidad San Sebastian

Research

JoVE Journal

Biochemistry

12.4K 조회수.  University of Lethbridge. Toeprinting 목표 체 외에서 의 능력을 측정 하는 다양 한 조건에서 리보솜과 양식 번역 개시 복합물에 RNA를 복사할 수 있습니다. 이 프로토콜 toeprinting 포유류 RNA에 대 한 메서드를 설명 하 고 모자-종속 및 IRES 기반 번역 공부 하는 데 사용할 수 있습니다.

비디오: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

정량적 면역 형광 측정 글로벌 현지화 번역

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

연구

생화학

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

유전학

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

캡 의존형 번역 역학 분석을 위한 생체외 단일 분자 이미징 분석

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

번역 조절에서 RNA 단백질 상호 작용을 연구하는 광학 핀셋

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

발생학

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

기능 및 구조 분석을위한 Peptidyl - tRNAs를 포함 번역 리보솜의 분리

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

생물학

Analysis of Translation Initiation During Stress Conditions by Polysome Profiling

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. Alterations of this program can lead to the growth of damaged cells, a hallmark of cancer development, or to premature cell death such as seen in neurodegenerative diseases. Much of what is known concerning the molecular basis for translational control has been obtained from polysome analysis using a density gradient fractionation system. This technique relies on ultracentrifugation of cytoplasmic extracts on a linear sucrose gradient. Once the spin is completed, the system allows fractionation and quantification of centrifuged zones corresponding to different translating ribosomes populations, thus resulting in a polysome profile. Changes in the polysome profile are indicative of changes or defects in translation initiation that occur in response to various types of stress. This technique also allows to assess the role of specific proteins on translation initiation, and to measure translational activity of specific mRNAs. Here we describe our protocol to perform polysome profiles in order to assess translation initiation of eukaryotic cells and tissues under either normal or stress growth conditions.

Here, we describe a method to analyze changes in the initiation of mRNA translation of eukaryotic cells in response to stress conditions. This method is based on the velocity separation on sucrose gradients of translating ribosomes from non-translating ribosomes.

Polysom​​e 프로파일에 의한 스트레스 조건에서 번역 개시 분석

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. ...

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

게놈 전체 규모에 Polysom​​e 분별과 포유류 Translatomes 분석

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

신경과학

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of the cells. These adjustments are critical to eukaryotic cell survivability and &#39;damage control&#39; during fluctuating nutrient and salinity levels, temperature, and various chemical and radiation stresses. Due to the highly dynamic nature of the RNA-level responses, and the instability of many of the RNA:RNA and RNA:protein intermediates, obtaining a meaningful snapshot of the cytoplasmic RNA state is only possible with a limited number of methods. Transcriptome-wide, RNA-seq-based ribosome profiling-type experiments are among the most informative sources of data for the control of translation. However, absence of a uniform RNA and RNA:protein intermediate stabilization can lead to different biases, particularly in the fast-paced cellular response pathways. In this article, we provide a detailed protocol of rapid fixation applicable to eukaryotic cells of different permeability, to aid in RNA and RNA:protein intermediate stabilization. We further provide examples of isolation of the stabilized RNA:protein complexes based on their co-sedimentation with ribosomal and poly(ribo)somal fractions. The separated stabilized material can be subsequently used as part of ribosome profiling-type experiments, such as in Translation Complex Profile sequencing (TCP-seq) approach and its derivatives. Versatility of the TCP-seq-style methods has now been demonstrated by the applications in a variety of organisms and cell types. The stabilized complexes can also be additionally affinity-purified and imaged using electron microscopy, separated into different poly(ribo)somal fractions and subjected to RNA sequencing, owing to the ease of the crosslink reversal. Therefore, methods based on snap-chilling and formaldehyde fixation, followed by the sedimentation-based or other type of RNA:protein complex enrichment, can be of particular interest in investigating finer details of rapid RNA:protein complex dynamics in live cells.

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

We present a technique to rapidly stabilize translational (protein biosynthesis) complexes with formaldehyde crosslinking in live yeast and mammalian cells. The approach enables dissecting transient intermediates and dynamic RNA:protein interactions. The crosslinked complexes can be used in multiple downstream applications such as in deep sequencing-based profiling methods, microscopy, and mass-spectrometry.

진핵 세포에서 번역 단지의 신속한 생체 내 고정 및 격리

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of ...

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

요약

더 많은 비디오 탐색

이 비디오의 챕터

정량적 면역 형광 측정 글로벌 현지화 번역

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

캡 의존형 번역 역학 분석을 위한 생체외 단일 분자 이미징 분석

번역 조절에서 RNA 단백질 상호 작용을 연구하는 광학 핀셋

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

기능 및 구조 분석을위한 Peptidyl - tRNAs를 포함 번역 리보솜의 분리

Polysome 프로파일에 의한 스트레스 조건에서 번역 개시 분석

게놈 전체 규모에 Polysome 분별과 포유류 Translatomes 분석

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

진핵 세포에서 번역 단지의 신속한 생체 내 고정 및 격리

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

요약

더 많은 비디오 탐색

이 비디오의 챕터

정량적 면역 형광 측정 글로벌 현지화 번역

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

캡 의존형 번역 역학 분석을 위한 생체외 단일 분자 이미징 분석

번역 조절에서 RNA 단백질 상호 작용을 연구하는 광학 핀셋

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

기능 및 구조 분석을위한 Peptidyl - tRNAs를 포함 번역 리보솜의 분리

Polysom​​e 프로파일에 의한 스트레스 조건에서 번역 개시 분석

게놈 전체 규모에 Polysom​​e 분별과 포유류 Translatomes 분석

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

진핵 세포에서 번역 단지의 신속한 생체 내 고정 및 격리

Polysome 프로파일에 의한 스트레스 조건에서 번역 개시 분석

게놈 전체 규모에 Polysome 분별과 포유류 Translatomes 분석