Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

NOTE: This method was used in the research article reported in Medler, S and Ansari, A.2.
1. Culturing and Harvesting the Cells
<ol>
	<li>Start a 5 mL culture of cells in YPD medium (10 g/L yeast extract, 20 g/L peptone, 2% dextrose) from a freshly streaked Saccharomyces cerevisiae plate.</li>
	<li>Grow the cells overnight in an orbital shaker at 30 &#176;C and 250 rpm.</li>
	<li>Dilute the overnight grown culture 100 times to a final volume of 100 mL in YPD medium in a 250-mL baffled flask. 
	NOTE: A total of 100 mL of culture is needed per TRO reaction; if multiple reactions are needed, a larger volume of culture must be used.</li>
	<li>Grow the cells to an optical density of 0.8 - 1.0 at 600 nm (A600 ~ 0.8 - 1.0).</li>
	<li>Harvest the cells by centrifugation at 820 x g for 5 min at 4 &#176;C in a sterile 50 mL conical tube.</li>
	<li>Resuspend the cells in 10 mL of ice cold TMN buffer (10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl) and incubate on ice for 5 min.</li>
	<li>Centrifuge at 820 x g for 5 min at 4 &#176;C to pellet the cells. Gently remove the supernatant by aspiration.</li>
</ol>
2. Permeabilizing and Preparing Cells for Run-on Assay
<ol>
	<li>Resuspend the cells in 1 mL of 0.6% sarkosyl solution by pipetting up and down gently using a truncated P1000 tip. Transfer the cell suspension to a chilled 1.5 mL microcentrifuge tube.</li>
	<li>Shake the cells gently at 4 &#176;C for 25 min on a platform shaker. 
	NOTE: Microcentrifuge tubes should be packed into a 50 mL conical tube with ice to maintain a cold temperature, avoiding the possibility of any new initiation events occurring at the promoter at this stage.</li>
	<li>Centrifuge the cells at 1,200 x g for 6 min at 4 &#176;C using a tabletop refrigerated centrifuge.</li>
	<li>Gently aspirate the supernatant to remove any excess liquid from the permeabilized cell pellet.</li>
</ol>
3. Transcription Run-on Reaction
<ol>
	<li>Add 150 &#181;L of transcription run-on buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 10 mM MgCl2, 2 mM DTT (dithiothreitol), 0.75 mM each of ATP, CTP, GTP, and BrUTP, 200 U RNase inhibitor) to the permeabilized cell pellet.</li>
	<li>Mix gently by pipetting up and down using a truncated P200 tip. 
	NOTE: If processing multiple samples, keep everything on ice until all samples are ready and then proceed to the next step.</li>
	<li>Incubate for 5 min at 30 &#176;C in a water bath. 
	NOTE: Adjust the time of incubation between 1 to 5 min to ensure optimal incorporation of BrUTP into the nascent RNA.</li>
	<li>Stop the reaction by adding 500 &#181;L of cold ready-to-use RNA isolation reagent. Incubate for 5 min at room temperature.</li>
</ol>
4. RNA Extraction
<ol>
	<li>Add 200 &#181;L of acid-washed glass beads to the cell suspension (step 3.4), and shake vigorously for 20 min at 4 &#176;C in a vortex mixer.</li>
	<li>Puncture the bottom of the microcentrifuge tube using a hot 22 G needle and place it on the top of a 15-mL sterile conical tube.</li>
	<li>Centrifuge at 300 x g for 1 min at 4 &#176;C to collect the cell lysate. Transfer the cell lysate to a 1.5 mL microcentrifuge tube.</li>
	<li>Add 500 &#181;L of cold RNA isolation reagent and 200 &#181;L of chloroform to the cell lysate. Mix the contents on a vortex mixer and centrifuge at 16,168 x g for 20 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase to a new microcentrifuge tube.</li>
	<li>Add an equal volume of cold phenol/chloroform/isoamyl alcohol (125:24:1) pH 4-5. Shake vigorously on a vortex mixer and centrifuge at 16,168 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase containing RNA to a new microcentrifuge tube. Repeat step 4.6 two more times.</li>
	<li>To the final RNA-containing aqueous phase, add 5 M NaCl stock to get a final concentration of 0.3 M. Add 3 times the volume of cold ethanol to precipitate the RNA.
	<ol>
		<li>Incubate for 1 h or overnight at -20 &#176;C. 
		NOTE: Perform steps 4.9 - 4.11 while the anti-BrdU beads are being incubated for blocking (see step 5.3).</li>
	</ol>
	</li>
	<li>Centrifuge at 16,168 x g for 20 min at 4 &#176;C. Remove the supernatant and resuspend the RNA pellet in 100 &#181;L of DEPC (diethylpyrocarbonate) water.</li>
	<li>Use a RNA isolation mini kit to separate the RNA from the unincorporated BrUTP nucleotides. Elute the RNA from the column with 100 &#181;L of RNase-free water.</li>
	<li>Incubate the RNA in a 65 &#176;C water bath for 5 min and then transfer to ice for at least 2 min.</li>
</ol>
5. Affinity Purification of BrUTP-labeled RNA
<ol>
	<li>To 25 &#181;L of anti-BrdU settled beads, add 500 &#181;L of 0.25x SSPE (Sodium Saline Phosphate EDTA) binding buffer (20x SSPE: 3 M NaCl, 0.2 M NaH2PO4, 0.02 M EDTA, pH 7.4, 1 mM EDTA, 0.05% Tween, 37.5 mM NaCl). Centrifuge at 200 x g for 30 s at 4 &#176;C and remove the supernatant.</li>
	<li>Repeat step 5.1 three times.</li>
	<li>Add 500 &#181;L of blocking buffer (1x binding buffer, 0.1% polyvinylpyrrolidone, 1 mg ultra-pure bovine serum albumin (BSA)) to the beads and shake gently for 1 - 2 h at 4 &#176;C on a platform shaker.</li>
	<li>Wash the beads two more times with 500 &#181;L of binding buffer, as described in step 5.1.</li>
	<li>Add 400 &#181;L of binding buffer to the beads.</li>
	<li>Transfer 100 &#181;L of RNA (from step 4.11) directly to the beads. Incubate with gentle shaking for 1 - 2 h at 4 &#176;C on a platform shaker.</li>
	<li>Wash the beads sequentially with 500 &#181;L of binding buffer, 500 &#181;L of low salt buffer (0.2x SSPE, 1 mM EDTA, 0.05% Tween), 500 &#181;L of high salt buffer (0.25x SSPE, 1 mM EDTA, 0.05% Tween, 100 mM NaCl), and twice with 500 &#181;L of TET buffer (1x TE, 0.05% Tween), spinning at 200 x g for 30 s at 4 &#176;C in between each wash.</li>
	<li>Elute the BrUTP-labeled RNA from beads sequentially, twice with 150 &#181;l and once with 200 &#181;l of elution buffer (20 mM DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.1% SDS), by incubating for 4 min at 42 &#176;C in a water bath followed by a short spin to separate beads from the supernatant.</li>
</ol>
6. Precipitation of BrUTP Labeled RNA
<ol>
	<li>Add 500 &#181;L of cold phenol/chloroform/isoamyl alcohol (125:24:1) pH 4 - 5 to the affinity purified BrUTP labeled RNA. Mix on a vortex mixer and centrifuge at 16,168 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase to a new microcentrifuge tube.</li>
	<li>Add 5 M NaCl stock to get a final concentration of 0.3 M and 3 times the volume of cold ethanol to precipitate the RNA.</li>
	<li>Incubate at -20 &#176;C overnight.</li>
	<li>Collect the precipitated RNA by centrifugation at 16,168 x g for 30 min at 4 &#176;C.</li>
	<li>Remove the supernatant and allow the pellet to air dry for 10 min.</li>
	<li>Resuspend the RNA pellet in 26 &#181;L of DEPC water.</li>
	<li>Determine the final RNA concentration by measuring the absorbance at 260 nm using a spectrophotometer. Also, determine the 260/280 ratio. A ratio ~2 is indicative of a pure RNA sample.</li>
	<li>Store the RNA samples in aliquots at -80 &#176;C until needed for cDNA synthesis.</li>
</ol>
7. Reverse Transcription of BrUTP-labeled RNA
<ol>
	<li>Adjust the RNA concentration to 100 ng/&#181;L using DEPC water. Use 0.5 &#181;g of RNA for each cDNA synthesis reaction. 
	NOTE: The concentration of RNA template may vary from 0.5 to 1.0 &#181;g to achieve optimal cDNA synthesis.</li>
	<li>Reverse transcribe the RNA using multiple reverse primers designed downstream of the poly(A) site (termination site) as shown in Figure 3A.</li>
	<li>To each reverse transcription reaction, add 5 &#181;l RNA template (0.5 &#181;g), 1 &#181;L dNTP mix (10 mM each), 2 &#181;L of reverse primer C, D, E, F or G (50 &#181;M each) (see Figure 3A) and nuclease free water. The final reaction volume in each tube is 13 &#181;L. 
	NOTE: The number of reverse transcription reactions will depend on the number of reverse primers used for cDNA synthesis. For example, for ASC1 five reverse primers were used and therefore five reverse transcription reactions were set up. Label the tubes as C, D, E, F and G on the basis of the reverse primer used for cDNA synthesis.</li>
	<li>Incubate the tubes containing RNA template, dNTP mix and primers in a thermocycler at 65 &#176;C for 5 min to remove any secondary structural conformation, and then cool to 4 &#176;C for at least 2 min.</li>
	<li>Add 1 &#181;L reverse transcriptase (200 U/&#181;L), 4 &#181;L buffer and 2 &#181;L of 0.1 M DTT to each tube containing the RNA template and primer (step 7.4). Mix by pipetting gently up and down.</li>
	<li>Perform reverse transcription by incubating the reaction mix in a thermocycler at 42 &#176;C for 60 min.</li>
	<li>Inactivate the reverse transcriptase at 65 &#176;C for 20 min.</li>
	<li>Store the cDNA at -20 &#176;C or proceed to the next step.</li>
</ol>
8. Amplification of cDNA
<ol>
	<li>Perform the PCR reaction for amplification of each cDNA preparation (labeled C, D, E, F and G for ASC1) from step 7.8 as follows: 3.0 &#181;L cDNA template from step 7.8, 1.0 &#181;L forward primer B (10 &#181;M), 1.0 &#181;L reverse primer C or D or E or F or G (10 &#181;M), 2.5 &#181;L 10x polymerase PCR buffer, 0.5 &#181;L dNTP mix (10 mM each), 1.0 &#181;L MgCl2 (2.5 mM), 15.5 &#181;L PCR grade water, and 0.5 &#181;L thermostable polymerase enzyme. 
	NOTE: Different dilutions of cDNA template ranging from 1:5 to 1:100 should be tested to optimize the PCR product yield. A single promoter-proximal forward primer will be used to amplify cDNA obtained using different reverse primers. For example, a single forward primer B located near the promoter was used in combination with five reverse primers from C to G for ASC1. B-C, B-D, B-E, B-F and B-G were used in tubes labeled as C, D, E, F and G respectively as shown in Figure 3A.</li>
	<li>Run the PCR using the following thermal cycling parameters: 1 cycle 95 &#176;C for 2 min (hot start for activation of polymerase), 30 - 40 cycles 95 &#176;C for 30 s (denaturation), 54 &#176;C for 15 s (annealing), 68 &#176;C for 1 min (extension), and 1 cycle 68 &#176;C for 5 min (final extension). 
	NOTE: The annealing temperature will vary depending on the specific primers being used and the extension time will vary depending on the expected product size.</li>
	<li>Separate the PCR product by electrophoresis on 0.8%, 1.5%, or 2% agarose gels depending on the expected size of the product.</li>
	<li>Quantify the PCR product as described in El Kaderi et al., 201211. 
	NOTE: Alternatively, use real time RT-qPCR strategy to quantify the amount of nascent transcripts.</li>
</ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

The strand-specific TRO protocol used here was adapted from the protocol used for GRO-Seq (Global Run On-Sequencing) analysis in mammalian cells12. We successfully modified the protocol to study nascent transcription in budding yeast. To specifically analyze the transcription termination defect, we adjusted the protocol further by getting rid of the RNA hydrolysis step. This allowed us to specifically detect the full length nascent transcripts that initiated from the transcription start site near the promoter region.
There are several critical steps in the protocol that should be performed with utmost caution to get a meaningful result. First, the protocol must be performed with exponentially growing yeast cells. The cells in the log phase (A600 ~ 0.8 - 1.0) give the best results as the majority of cells at this stage are actively growing and exhibit robust transcription. Second, the RNA isolation step should be performed as quickly as possible at a temperature between 2 - 4 &#176;C. Third, before affinity purification of Br-UMP labelled RNA, unincorporated BrUTP should be removed from the RNA preparation. We used a RNA kit to get rid of BrUTP from the purified RNA preparation. Fourth, the use of a robust reverse transcriptase is critical for successful accomplishment of the protocol.
The strand-specific TRO protocol used here has advantages over the Northern blot technique in detecting the termination defect as it is more sensitive, faster and exhibits higher resolution. This protocol is also better than the traditional TRO protocol as it can distinguish the sense transcripts from the anti-sense transcripts and if the observed result is due to promoter-initiated transcription or aberrant transcription starting from a promoter downstream region. The strand-specific TRO protocol has some limitations. It is more laborious and time consuming than steady state mRNA detection techniques. It requires large number of cells. Therefore, the analysis of transcription of low transcribing genes might be a problem.
We have successfully used this technique to study the termination defect in the RNA polymerase II transcription cycle in budding yeast2. The approach can be extended to study termination of transcription by RNA polymerase I and RNA polymerase III in yeast as well. With appropriate modifications, the approach can also be applied to study the transcription termination defect in higher eukaryotes. Overall, the technique is relatively inexpensive, highly reproducible and requires standard equipment used in a molecular biology laboratory.

The eukaryotic transcription cycle consists of three major steps; initiation, elongation and termination. The termination of transcription by RNA polymerase II consists of two distinct, interdependent steps3. The first step involves cleavage, polyadenylation and release of mRNA from the template, and is immediately followed by the second step, marked by disengagement of polymerase from the template. Proper termination is crucial for the recycling of the polymerase during initiation/reinitiation of transcription, for preventing interference with the transcription of downstream genes, and for keeping aberrant transcription in check by limiting transcription of pervasive non-coding RNA4,5. Despite recent advances, termination is by far the least understood step of the RNA polymerase II transcription cycle. A reliable termination assay is essential for studying the mechanism underlying termination of transcription by RNA polymerase II in vivo.
A number of experimental approaches are used to detect the termination defect in an actively transcribing gene under physiological conditions. These include Northern blot, termination factor ChIP (Chromatin Immunoprecipitation) and the traditional TRO assay. Each of these techniques have some advantages and disadvantages. The traditional TRO assay used to be the most reliable and sensitive approach for detection of a transcription termination defect in vivo1. This assay localizes the transcriptionally active polymerase molecules on different regions of a gene inside the cell. Under normal conditions, the assay shows transcriptionally engaged polymerase molecules strictly distributed between the promoter and terminator region of the gene (Figure 1A). Upon defective termination, however, the polymerase is unable to read the termination signal and is detected in the region downstream of the 3&#8242; end of the gene (Figure 1B).
A transcription termination defect is manifested in the presence of a sense-transcribing polymerase that initiated from the promoter-proximal region, and being unable to read the termination signal, continues transcribing the region downstream of the 3&#8242; end of a gene as shown in Figure 2A. With the realization that the eukaryotic genome exhibits overwhelming pervasive transcription in sense as well as anti-sense directions in and around a gene 6,7,8,9,10, it soon became clear that the traditional TRO assay cannot detect if the polymerase signal downstream of a gene represents a promoter-initiated transcript (Figure 2A) or an aberrant RNA that initiated somewhere in the middle of the gene or downstream of the terminator element (Figure 2B), or the polymerase transcribing in the anti-sense direction from the 3&#8242; end of the gene (Figure 2C). The strand-specific TRO assay using BrUTP described here can distinguish if the observed readthrough polymerase signal represents promoter-initiated extended sense mRNA or an anti-sense transcript that initiated downstream of the gene under examination. We have successfully used this approach to demonstrate the role of Kin28 kinase in termination of transcription in budding yeast2. Employing the approach here we show that Rna14 is required for termination of transcription of ASC1 in budding yeast.

<table><tbody><tr><td>Phenol-chloroform-isoamyl alcohol mixture</td><td>Sigma-Aldrich</td><td>77619</td><td>pH 4-5</td></tr><tr><td>TRIzol reagent</td><td>Life technologies</td><td>15596-026</td><td></td></tr><tr><td>RNase Inhibitor, human placenta</td><td>New England Biolabs</td><td>M0307S</td><td></td></tr><tr><td>Anti-BrdU beads</td><td>Santa Cruz Biotechnology</td><td>sc-32323AC</td><td></td></tr><tr><td>Protoscript II</td><td>New England Biolabs</td><td>M03368L</td><td>or an equivalent enzyme</td></tr><tr><td>Advantage 2 polymerase Mix</td><td>Clontech</td><td>639201</td><td>or an equivalent enzyme</td></tr><tr><td>5-Bromouridine 5&#039; triphosphate sodium salt</td><td>Santa Cruz Biotechnology</td><td>sc-214314A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>ATP</td><td>New England Biolabs</td><td>N0451AA</td><td></td></tr><tr><td>CTP</td><td></td><td>N0454AA</td><td></td></tr><tr><td>GTP</td><td></td><td>N0452AA</td><td></td></tr><tr><td>Ultra-pure bovine serum albumin (BSA)</td><td>MC Labs</td><td>UBSA-100</td><td></td></tr><tr><td>Asc1 B</td><td></td><td></td><td>AGATTCGTCGGTCACAAGTCC</td></tr><tr><td>Asc1 C</td><td></td><td></td><td>GAACTTTATACATATTCTTAGTT&lt;br/&gt; AGCAGTC</td></tr><tr><td>Asc1 D</td><td></td><td></td><td>TGTACATATGTATTTTCGCAGCA</td></tr><tr><td>Asc1 E</td><td></td><td></td><td>GCCAAGGAGACTGAATTTAATG</td></tr><tr><td>Asc1 F</td><td></td><td></td><td>CTATGGAATGGGGGTTTTAAG</td></tr><tr><td>Asc1 G</td><td></td><td></td><td>GGTTATGGCAGACATGCCAC</td></tr><tr><td>5s cDNA</td><td></td><td></td><td>AGATTGCAGCACCTGAGT</td></tr><tr><td>5&amp;rsquo; 5s reverse</td><td></td><td></td><td>GGTTGCGGCCATATCTAC</td></tr><tr><td>3&amp;rsquo; 5s reverse</td><td></td><td></td><td>TGAGTTTCGCGTATGGTC</td></tr></tbody></table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here is a powerful experimental approach for analyzing the transcription termination defect under physiological conditions. Like the traditional TRO assay, it relies on the presence of a transcriptionally active polymerase beyond the 3&#8242; end of the gene as an indicator of a transcription termination defect1. It overcomes two major problems encountered with the traditional TRO assay. First, it can detect if the polymerase reading through the termination signal is the one that initiated transcription from the promoter-proximal region, or if it is simply representing a pervasively transcribing polymerase that initiated non-specifically from somewhere in the body or the 3&#8242; end of the gene. Secondly, it can distinguish if the transcriptionally active polymerase signal beyond the terminator region is truly the readthrough sense mRNA transcribing polymerase or a terminator-initiated non-coding anti-sense RNA signal. Briefly, the protocol involves permeabilizing the exponentially growing yeast cells, allowing the transcripts that initiated in vivo to elongate in the presence of the BrUTP nucleotide, purifying BrUTP-labelled RNA by the affinity approach, reverse transcribing the purified nascent RNA and amplifying the cDNA using strand-specific primers flanking the promoter and the terminator regions of the gene2.

To demonstrate the applicability of the BrUTP-strand-specific TRO procedure in detecting a transcription termination defect, we used a termination-defective, temperature-sensitive mutant of RNA14 called rna14-1. The role of Rna14 in termination of transcription by RNA polymerase II was demonstrated using the traditional TRO assay that detected RNA in the terminator-proximal region of selected genes1. The detection of RNA signal beyond the terminator region in the rna14-1 mutant at the non-permissive temperature was construed as the termination defect. The observed signal, however, could be ascribed to the pervasively transcribing polymerase that initiated transcription from somewhere near the 3&#8242; end of the gene as shown in Figure 2B. To conclusively demonstrate the role of Rna14 in termination, we performed BrUTP-strand-specific TRO in the rna14-1 mutant and the isogenic wild type strain at 37 &#176;C. We expected that in the wild type strain, the TRO signal will be constrained between the promoter and terminator regions as shown in Figure 1A. In the rna14-1 mutant, however, the polymerase will read through the termination signal and the TRO signal will be detected beyond the 3&#8242; end of the gene as shown in Figure 1B and 2A.
Briefly, we grew the rna14-1 mutant and its isogenic wild type cells at 25 &#176;C to mid-log phase and then shifted cells to 37 &#176;C for three hours. Transcription run-on assay was performed to incorporate BrUTP into nascent RNA synthesized by an actively transcribing RNA polymerase as described above. The BrUTP labeled RNA was purified and reverse transcribed using primers C, D, E, F, and G shown in Figure 3A. The corresponding cDNA was PCR amplified using primer pairs B-C, B-D, B-E, B-F, and B-G and fractionated on agarose gels (Figure 3B). Quantification of gels is shown in Figure 3C. The presence of PCR amplified products from the primer pairs B-E, B-F, and B-G in the rna14-1 mutant reflects a termination read through phenotype (Figure 3B, Lane 11 - 13; and Figure 3C, regions E, F and G). In the wild type cells, however, the TRO signal was limited till the terminator element (Figure 3B, Lanes 2 and 3; and Figure 3C, regions C and D). There was no detectable TRO signal beyond the terminator region (Figure 3B, Lane 4 - 6; and Figure 3C, regions E, F and G). Thus, we could detect the promoter-initiated nascent transcripts that read through the termination signal in the mutant but not in the wild type cells, thereby confirming that Rna14 is a termination factor.
<img alt="Figure 1" src="/files/ftp_upload/55446/55446fig1.jpg" /> 
Figure 1: Transcription Run-on (TRO) Assay Detects the Presence of Transcriptionally Active RNA Polymerase in Different Regions of a Gene. (A) When termination is normal, there is no polymerase signal beyond the terminator region. (B) Upon defective termination, the polymerase is unable to read the termination signal and can be detected beyond the 3&#8242; end of the gene. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55446/55446fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55446/55446fig2.jpg" /> 
Figure 2: Strand-specific TRO Assay. The strand-specific TRO assay can detect if the presence of a transcriptionally active polymerase beyond the 3&#8242; end of the gene is a true termination defect due to a promoter-initiated polymerase reading through the termination signal (A), or it is simply a pervasively transcribing polymerase transcribing in sense direction (B), or it is the anti-sense ncRNA transcribing polymerase initiating from the 3&#8242; end (C). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55446/55446fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55446/55446fig3.jpg" /> 
Figure 3: Rna14 is a Termination Factor as Polymerase Reads through the Termination Signal in the rna14-1 Mutant. (A) Schematic depiction of ASC1 gene showing the position of the forward primer B and five reverse primers, C, D, E, F, and G used for cDNA synthesis of purified BrUTP-labeled RNA. (B) cDNA made from reverse primers C, D, E, F and G was PCR amplified using the primers pairs B-C, B-D, B-E, B-F and B-G respectively. (C) The quantitative analysis of TRO data shown in (B) above in wild type and rna14-1 cells at 37 &#176;C. 5S RNA was used as the normalization control. The error bars represent one full unit of standard deviation based on a minimum of three trials. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55446/55446fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Nanyang Technological University

Research

JoVE Journal

Genetics

9.8K Views.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

Biochemistry

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Mapping the Structure-Function Relationships of Disordered Oncogenic Transcription Factors Using Transcriptomic Analysis

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these proteins contain an intrinsically disordered domain (IDD) fused with the DNA-binding domain (DBD) of another protein and orchestrate widespread transcriptional changes to promote malignancy. These fusions are often the sole recurring genomic aberration in the cancers they cause, making them attractive therapeutic targets. However, targeting oncogenic transcription factors requires a better understanding of the mechanistic role that low-complexity, IDDs play in their function. The N-terminal domain of EWSR1 is an IDD involved in a variety of oncogenic fusion transcription factors, including EWS/FLI, EWS/ATF, and EWS/WT1. Here, we use RNA-sequencing to investigate the structural features of the EWS domain important for transcriptional function of EWS/FLI in Ewing sarcoma. First shRNA-mediated depletion of the endogenous fusion from Ewing sarcoma cells paired with ectopic expression of a variety of EWS-mutant constructs is performed. Then RNA-sequencing is used to analyze the transcriptomes of cells expressing these constructs to characterize the functional deficits associated with mutations in the EWS domain. By integrating the transcriptomic analyses with previously published information about EWS/FLI DNA binding motifs, and genomic localization, as well as functional assays for transforming ability, we were able to identify structural features of EWS/FLI important for oncogenesis and define a novel set of EWS/FLI target genes critical for Ewing sarcoma. This paper demonstrates the use of RNA-sequencing as a method to map the structure-function relationship of the intrinsically disordered domain of oncogenic transcription factors.

Intrinsically disordered domains are important for oncogenic fusion transcription factor function. To therapeutically target these proteins, a more detailed understanding of the regulatory mechanisms employed by these domains is required. Here, we use transcriptomics to map important structural features of the intrinsically disordered EWS domain in Ewing sarcoma.

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these ...

Cancer Research

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biology

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is achieved by reverse transcription of the RNA of interest using specific fluorescently labeled primers and subsequent analysis of the resulting cDNA fragments by denaturing polyacrylamide gel electrophoresis. Simultaneously, a traditional Sanger sequencing reaction is run on the gel to map the ends of the cDNA fragments to their exact corresponding bases. In contrast to 5&#39;-RACE (Rapid Amplification of cDNA Ends), where the product must be cloned and multiple candidates sequenced, the bulk of cDNA fragments generated by primer extension can be simultaneously detected in one gel run. In addition, the whole procedure (from reverse transcription to final analysis of the results) can be completed in one working day. By using fluorescently labeled primers, the use of hazardous radioactive isotope labeled reagents can be avoided and processing times are reduced as products can be detected during the electrophoresis procedure.
In the following protocol, we describe an in vivo fluorescent primer extension method to reliably and rapidly detect the 5&#39; ends of RNAs to deduce transcriptional starting points and RNA processing sites (e.g., by toxin-antitoxin system components) in S. aureus, E. coli and other bacteria.

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

We here describe a fluorescence based primer extension method to determine transcriptional starting points from bacterial transcripts and RNA processing in vivo using an automated gel sequencer.

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is ...

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single strands, each requiring distinct modes of replication: continuous (leading) and discontinuous (lagging). Understanding the interactions of chromatin-associated proteins with replicating DNA strands in vivo is crucial for elucidating the mechanisms of chromatin assembly and DNA repair coupled to DNA replication. This protocol presents the enrichment and sequencing of protein-associated nascent DNA (eSPAN) method, designed to quantify relative protein levels on nascent leading and lagging DNA strands at replication forks. The eSPAN procedure starts with chromatin immunoprecipitation (ChIP, in yeast) or cleavage under targets and tagmentation (CUT&amp;Tag; in mammalian cells) of a protein of interest, followed by enrichment of the protein-associated nascent DNA by bromodeoxyuridine (BrdU) immunoprecipitation. Strand-specific next-generation sequencing is applied to isolated ssDNA. This technique can be used to determine whether a protein is enriched at leading or lagging replication forks. The eSPAN provides genome-wide strand-preference of chromatin-associated proteins, including histones at replication forks.

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single ...

Transcription Attenuation in Prokaryotes

Transcriptional attenuation occurs when&#160;RNA transcription is prematurely terminated due to the formation of a terminator mRNA hairpin structure.&#160; Bacteria use these hairpins to regulate the transcription process and control the synthesis of several amino acids including histidine, lysine, threonine, and phenylalanine. Transcription attenuation takes place in the non-coding regions of mRNA.
There are several different mechanisms used to attenuate transcription. In ribosome mediated transcriptional attenuation, the movement of a ribosome on the transcript is stalled or proceeds forward depending upon the availability of the tRNAs charged with a specific amino acid. High amino acid concentrations allow the ribosome to move forward leading to the formation of the terminator structure; deficiency of the amino acid stalls the ribosome and causes formation of the anti-terminator structure. The trp operon in E. coli, discussed below, is a good example of this type of mechanism. tRNA mediated transcriptional attenuation, as observed in trp operon of Lactococcus lactis, depends on an RNA-RNA interaction. When uncharged tRNAs are present in sufficient numbers, they directly bind to the mRNA and stabilize the anti-terminator structure. Transcriptional attenuation is also known to be mediated by proteins as found in bgl (beta-glucoside) operon in E. coli.&#160; This involves an RNA&#8212;protein interaction where a protein binds to the transcript and regulates the formation of an anti-terminator structure. More recently, another transcriptional attenuation mechanism was discovered where small metabolites like thiamine were observed to regulate transcription by directly binding to the non-coding mRNA segments, also known as riboswitches. Riboswitches can form a terminator or an anti-terminator structure depending upon the concentration and nature of a metabolite.&#160;
Trp Operon
The trp operon in E. coli contains a 140 nucleotide leader sequence before its first structural gene. This leader sequence has four distinct segments &#8211; 1 through 4&#8211; and regulates the transcription of the downstream structural genes. Segment&#160; 1 can form a hairpin structure with segment&#160; 2. This 1-2 hairpin structure is known as a pause structure, as during transcription, it stalls RNA polymerase until the ribosome binds the newly transcribed RNA. This synchronizes transcription and translation in bacteria.&#160; When tryptophan concentrations are low, a hairpin structure forms between segments 2 and 3, known as the anti-terminator structure. This anti-terminator structure allows the continuous transcription of the downstream genes which produce enzymes for tryptophan synthesis. In contrast, when tryptophan concentrations are sufficient, a hairpin structure forms between segments 3 and 4, called the terminator structure. Along with a&#160; series of uracil bases that follow, the terminator structure causes RNA polymerase to dissociate from the RNA and template DNA strands, resulting in the termination of the transcription.

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

Summary

Explore More Videos

Chapters in this video

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Mapping the Structure-Function Relationships of Disordered Oncogenic Transcription Factors Using Transcriptomic Analysis

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Transcription Attenuation in Prokaryotes