Name: visualization of il-22-expressing lymphocytes using reporter mice
Uploaded: 2017-01-25T12:30:00.000+00:00
Duration: 10 min 30 s
Description: Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

We thank Kelli Czarra and Megan Karwan for animal technical assistance, Kathleen Noer and Roberta Matthai for flow cytometry assistance, and Donna Butcher andMiriam R. Anver for pathology analysis. This project was supported by a grant from the Ely and Edythe Broad Foundation (to Scott Durum) and has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. HHSN261200800001E (MRA).

כל החיות קבלו טיפול נאה בהתאם הפרוצדורות המפורטות במדריך 2011 לטיפול ושימוש ועדה בחיות מעבדה של המעבדה הלאומית פרדריק לחקר הסרטן. הדור 1. של IL-22-tdTomato עכברים Reporter ידי BAC Recombineering הערה: העכברים צריכים להיות מודעים ואל תזוזו בתגובה לגירוי מזיק. לעקר את אזור הניתוח עם אתנול 70% לעקר את כל כלים כירורגיים באמצעות מעקר חרוז זכוכית. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לטהר BAC DNA (RP23-401E11, שיבוט באורך 228,391 bps) באמצעות שיטת החילוץ אלקליין 10, 11. לאפיין את שיבוט BAC ידי עיכול SpeI של 5 מיקרוגרם של RP23-401E11 כדי לאשר את הגודל הנכון של גן המטרה. הערה: BAC DNA היה מתעכל ל -14 קטעים. </li><li style=";text-align:right;direction:rtl"> הכנס את הגן המדווח tdTomato לתוך האתר לא אני / סאל א &#39;של וקטור הסעות PLD53SC-A-GFP-B11 ולהחליף את הגן GFP באותו אתר. לאחר מכן, באמצעות BAC RP23-401E11 כתבנית, להגביר את תיבות הומולוגיה (A ו- B) כדי אקסון תורגם לראשונה של Il-22 (אקסון 1) על ידי ה- PCR (95 מעלות צלזיוס 2 דקות; 30 מחזורים של 95 מעלות צלזיוס למשך 30 שניות, 55 ° C למשך 30 שניות, ו -72 מעלות צלזיוס במשך 30 שניות; ותוסף סופי על 72 מעלות צלזיוס למשך 10 דקות). במערכת התגובה 50 μl PCR, להוסיף 50 ng (1 μl) של ה- DNA BAC, 0.5 μl של פריימרים (10 מיקרומטר), 40 μl של איכות גבוהה PCR Supermix, ו -8 μl של H 2 O. הערה: פריימרים עבור תיבות A ו- B הן כדלקמן: תיבת קדימה: 5&#39;- T GGCGCGCC GGAGCTGTGAAGAAAG הפוך: 5&#39;- CAGAGATCGCACAAGTGTCAAC; B תיבת קדימה: 5&#39;- G TTAATTAA CTGCCCGTCAACA הפוך: 5&#39;- T GGCCGGCC TGAGCACCTGCTT catc 10. האתרים של אנזימי הגבלה (עולה לי ואני Pac) מודגשים. </li><li style=";text-align:right;direction:rtl"> ולקשור 500 ננוגרם של עולה I-מתעכל A ו- 500 ng של Pac I-מתעכל B fragmהמציג לתוך 50 ng של PLD53SC-ATB (tdTomato) וקטור ב 16 מעלות צלזיוס למשך 1 שעה. </li><li style=";text-align:right;direction:rtl"> Transform וקטור PLD53SC-ATB מטוהרים לתאי BAC-המוסמכות 11 והתרבות אותם על לוריא- Bertani (LB) צלחות אגר עם chloramphenicol (20 מיקרוגרם / מ&quot;ל) ו אמפיצילין (30 מיקרוגרם / מ&quot;ל) בשעה 37 ° C. בחרו שניים כדי שלוש מושבות של שיתוף לשלב מהצלחות מאסטר Ch / אמפר. </li><li style=";text-align:right;direction:rtl"> לחסן כל המושבה לתוך 1 מ&quot;ל של LB בתוספת chloramphenicol 20 מיקרוגרם / מ&quot;ל ​​ו דגירה אותם במשך שעה 1 ב 37 מעלות צלזיוס, 225 סל&quot;ד. מורחים 100 μl של כל התערובת על צלחת LB-אגר (10 גר &#39;Peptone 140, 5 גרם של תמצית שמרים, 12 גרם של אגר, ו 1 ליטר של מים; pH 7.5) בתוספת chloramphenicol ו 4-4.5% של סוכרוז. דגירה התרבות לילה בשעה 37 ° C. </li><li style=";text-align:right;direction:rtl"> פיק הוא מושבות גדולות וקטנות replate אותם על שתי צלחות LB-אגר עם chloramphenicol. לאחר מכן, לחשוף את הצלחות עם או בלי אור UV למשך 30 שניות לבחור את המושבות רגישות-UV לניתוח נוסף. </li><li style=";text-align:right;direction:rtl"> זהה את הדנ&quot;א BAC שונה על ידי PCR באמצעות tdTomato / IL-22 פריימר הטרוזיגוטיים (קדימה: 5 &#39;ACT TGT מהפקולטה לרוקחות אוכלים ATC TCT גת GGT; גב: 5&#39; TGT AAT CGG GGA TGT CGG C). תנאי thermocycler הם כדלקמן: 95 מעלות צלזיוס למשך 2 דקות; 30 מחזורים של 95 מעלות צלזיוס למשך 30 שניות, 56 ° C למשך 30 שניות, ו -72 מעלות צלזיוס במשך 30 שניות; ותוסף סופי על 72 מעלות צלזיוס למשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> אשר את הרצף של האזור השונה של BAC ידי רצף BAC הישיר של דנ&quot;א BAC-prep הגדול 12. </li><li style=";text-align:right;direction:rtl"> להרדים עכבר הנמען עם מנה של tribromoethanol 0.25% לתוך חלל הצפק כאשר להשתיל את zygotes microinjected לעכברים פסאודו בהריון C57BL / 6 ג. </li><li style=";text-align:right;direction:rtl"> Linearize את בחינות הבגרות IL-22-tdTomato לבנות (10 מיקרוגרם) על ידי עיכול עם 5 μl של הגבלה endonucleasePi-SCEI ב 100 μl של מערכת התגובה microinject הדנ&quot;א BAC לינארית לביצים מופרות של נקבות C57BL / 6 בשלב pronuclear 13. screen העכברים המהונדסים ידי ניתוח כתם דרום של DNA שבודד ביופסיות זנב באמצעות נהלים סטנדרטיים. </li></ol> 2. הכנת תא בודד מתוך טחול, קורנית, בלוטות הלימפה, או תיקון של Peyer הערה: IL-22-tdTomato עכברי כתב היו מתוחזקים במכון הלאומי לסרטן (NCI, פרדריק, MD). שיטת המתת החסד תואמת את הנחיות AVMA האחרונות המתת חסד. כל העכברים היו מורדמים באמצעות שאיפת CO 2 14. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להרדים עכבר IL-22-tdTomato בתא CO 2 והניח אותו על משטח נקי. לעקר את העור בבטן ידי ריסוס 70% אלכוהול ופצע אותו פתוח. הסר את הטחול ב בכנף שמאל ואת התימוס מאחורי עצם החזה. </li><li style=";text-align:right;direction:rtl"> כדי לקצור את בלוטות mesentericlymph (הממוקם בתוך רקמת mesenteric) והטלאים של Peyer (lymphoidnodules הקטן ברחבי אזור המעי של המעי הדק), לקחת את mesenteric הלבן פנינה הצמתים קרובה tהוא הקיר של המעי הדק באמצעות לנתח מלקחיים עם עצות משונן עדין הנקודה הראשונה ולאחר מכן להסיר את המעי הדק והמעי הגס כולו אל מחוץ לגוף. מצא את התיקונים סגלגלים המורחבים (הכתמים של Peyer) לאורך המעי לגזור אותם במספריים. טוחן רקמות הלימפה אלה (בלוטות הלימפה והטלאים של Peyer) בנפרד בין שתי שקופיות חלביות לתוך השעית תא בודד ב PBS / 1% בסרום שור עוברי (FBS) חיץ על קרח. </li><li style=";text-align:right;direction:rtl"> לרכך את הטחול או רקמות התימוס תוך שימוש באותה השיטה כמו בשלב 2.2. צנטריפוגה ההשעיה הטחול עבור 8 דקות ב XG 500 ו -4 מעלות צלזיוס. הוסף 1 מ&quot;ל של חיץ lysing ACK לכל הטחול את כדורי התא. </li><li style=";text-align:right;direction:rtl"> מערבבים היטב ולתת להם לעמוד במשך דקות 1. הוסף 9 מ&quot;ל של בופר פוספט סטרילית (PBS) חיץ מדגם זה. ספין למטה על ידי צנטריפוגה במשך 8 דקות ב XG 500 ו 4 ° C כדי להסיר את תאי הדם האדומים. הערה: אין להוסיף למאגר ACK lysing אל תאי התימוס. </li><li style=";text-align:right;direction:rtl"> Resuspend לויקוציטים וכתוצאה מכך 5 מ&quot;ל של PBS ו pass התאים דרך מסננת תא 100 מיקרומטר. אסוף את כדורי התא על ידי צנטריפוגה XG ב 500 במשך 8 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend התאים 5 מ&quot;ל של התקשורת RPMI או חיץ FACS לספור את התאים קיימא באמצעות הצבע הכחול 0.4% trypan / פתרון PBS. </li></ol> 3. בידוד של אינטרה-אפיתל לימפוציטים ו Lamina propria תאים מהמעיים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פתח את עור הבטן כמו בשלב 2.1, לחתוך את המעי הדק, מן התריסריון (ליד הקיבה) כדי מעי (קרוב בנספח), ואת המעי הגס כולו, ממש מעל פי הטבעת. הסר את השומן נוסף מלקחיים באמצעות רקמות mesenteric. שים את המעיים מיד קר כקרח PBS. </li><li style=";text-align:right;direction:rtl"> חפשו חלקות של Peyer (קטן, גושים גס) יחד באזור הדיסטלי של המעי הדק. הסר את ההמונים באמצעות מלקחיים andopen המעי לאורכו בעזרת מספריים. ביסודיות לשטוף את המעי עם 10 מ&quot;ל של קר כקרח PBS. </li><li style=";text-align:right;direction:rtl"> דגירה הרקמות ב 20 מ&quot;ל של חיץ מראש העיכול (EDTA מ&quot;מ 5ו 1 מ&quot;מ dithiothreitol תמיסת מלח מאוזן של האנק (HBSS)) במשך 30 דקות ב 37 מעלות צלזיוס עם סיבוב איטי (50 סל&quot;ד) שייקר. לאחר כל 2 incubations, להסיר את שכבת תאי אפיתל, המכיל לימפוציטים intraepithelial (IELs), על ידי vortexing האינטנסיבי (30 שניות ב 12,000 סל&quot;ד) ולהעביר את כל הרקמות דרך מסננת תא 100 מיקרומטר. </li><li style=";text-align:right;direction:rtl"> הוסף 20 מ&quot;ל של תמיסת EDTA חדש לרקמה לאינקובטורים השני למשך 30 דקות ב 37 מעלות צלזיוס. לעבור את שברי IEL דרך מסננת תא 100 מיקרומטר וברכה אותם עם השברים הקודמים. שמור את שברי המעי הנותרים על הקרח שיתייחסו בשלב 3.9. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה שברים IEL ונקווה ב 800 XG במשך 5 דקות ב 4 ° C.. לשטוף את השברים IEL ונקווה עם 10 מ&quot;ל של FBS HBSS / 5% ו ספין אותם במשך 5 דקות ב 800 XG ו -4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> Resuspend התאים 8 מ&quot;ל של מדיום סיליקה colloidal 44% 15 ולהצליב אותם עם 5 מ&quot;ל של מדיום סיליקה colloidal 67%. צנטריפוגה 44% / 67.5% תערובת תאים שיפוע במשך 20 דקות בטמפרטורת החדר ו -1,500 גרם x. </li><li style=";text-align:right;direction:rtl"> אוספים את התאים IEL מהלהקה על הממשק. ראשית, להסיר את השכבה העליונה של supernatant (כ -5 מ&quot;ל) באמצעות 1 פיפטה מ&quot;ל. לאחר מכן, הקציר IELs על שלבי הביניים של שיפוע בינוני סיליקה colloidal. </li><li style=";text-align:right;direction:rtl"> שטפו את IELs על ידי הוספת 10 מ&quot;ל של מדיום RPMI. ספין התאים למשך 5 דקות ב 800 XG ו -4 מעלות צלזיוס. Resuspend את IELs ב 5 מ&quot;ל של RPMI עבור צעד 3.15. </li><li style=";text-align:right;direction:rtl"> עבור בידוד של לימפוציטים שכבת הרירית המיוחדת (LPLs), לרכך את שברי רקמות המעי משלב 3.4 לחתיכות קטנות באמצעות מספריים (1 מ&quot;מ) ולעכל את החלקים עם 10 מ&quot;ל של חיץ העיכול (0.05 גרם של collagenase, 0.05 גרם של DNaseI, ו -0.3 גרם של dispase II ב RPMI / 5% FBS) במשך 15-20 דקות על 37 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> סנן את התערובת דרך מסננת תא 70 מיקרומטר. את supernatant הזרימה דרך מכיל את LPL שוחרר. </li><li style=";text-align:right;direction:rtl"> לגמרי לעכל את שברי המעי על ידי חזרה על שלבים 3.9-3.10 (בדרך כלל, הם חייבים להיותחזר 3 פעמים). בכל פעם, לרכז את supernatants המכיל את LPLs. </li><li style=";text-align:right;direction:rtl"> אוספים את התאים על ידי צנטריפוגה במשך 5 דקות ב 1500 XG טמפרטורה והחדר ו resuspend את הכדורים ב RPMI / 5% FBS. להעביר אותם דרך מסננת תא 40 מיקרומטר. </li><li style=";text-align:right;direction:rtl"> Resuspend את כדורי תא 10 מ&quot;ל של שבריר 40% שיפוע בינוני סיליקה 40:80 קולואידים ולהצליב אותם על 5 מ&quot;ל של שבריר 80% בתוך שפופרת 15 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> בצע את הפרדת שיפוע צפיפות על ידי צנטריפוגה במשך 20 דקות ב 1500 XG טמפרטורה וחדר 15. </li><li style=";text-align:right;direction:rtl"> אסוף את LPLs, כמתואר בשלב 3.7. לשטוף אותם פעם אחת עם 10 מ&quot;ל של PBS ו resuspend את כדורי ב 1 מ&quot;ל של% PBS / 1 FBS חיץ או בינוני RPMI. </li><li style=";text-align:right;direction:rtl"> ספירת תאי הקיימא (הן IELs ו LPLs) באמצעות צבע כחול 0.4% trypan / פתרון PBS. </li></ol> הביטוי 4. של IL-22-tdTomato ב קוליטיס <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כן השעיות תא טחול יחידות מעכברי IL-22-tdTomato בריכוז של 1 x 10 &lt;sup&gt; 7 תאים / מ&quot;ל ב PBS סטרילית, כמתואר בשלבים 2.1-2.4. </li><li style=";text-align:right;direction:rtl"> לטהר את תאי CD4 + T בשיטת הבידוד שלילי הסלולרית העכבר CD4 10. לייבל אותם עם אנטי CD4-APC (שיבוט RM4-5, 0.5 μl / 1 x 10 6 תאים PBS / 1% חיץ FBS) ואנטי-CD45RB-FITC (16A שיבוט, 0.5 μl / 1 x 10 6 תאים PBS / 1% חיץ FBS) על ידי דגירה על 4 מעלות צלזיוס למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> ספין התאים למשך 5 דקות ב 500 XG ו -4 מעלות צלזיוס. שוטפים את התאים עם 2 מ&quot;ל של חיץ PBS / 1% FBS resuspend אותם 1 מ&quot;ל של חיץ מכתים FBS PBS / 1%. </li><li style=";text-align:right;direction:rtl"> הפעל את תאי ה- T שכותרתו על זרימה cytometry מכונת 16. שער תאים על אוכלוסייה תא T מסוג CD4 + ו CD45RB גבוה תאי פעמים חיוביות (אורך הגל זוהה ב 488 ננומטר ו 633 nm לייזרים). </li><li style=";text-align:right;direction:rtl"> קציר התאים מסודרים על ידי צנטריפוגה במשך 5 דקות ב 500 XG ו -4 מעלות צלזיוס. Resuspend את כדורי תא חיץ סטרילי PBS ב 1 x 10 6 </sup&gt; תאים / מ&quot;ל. להזריק את התאים (0.5 x 10 6) לתוך הצפק שבין אלה לאלה Rag1 - / - עכבר הנמען. </li><li style=";text-align:right;direction:rtl"> להקריב את העכברים הנמען תחת CO 2 בנקודות זמן שונות. קציר את בלוטות לימפה mesenteric ואת המעיים קטנים וגדולים, כמתואר בשלבים 2.1 ו -2.2. שים כל צומת הלימפה mesenteric ופצע פתוח המעי (כריך נייר / המעי / נייר) paraformaldehyde 4% (PFA; להתמודד תחת במנדף) לילה לתקן רקמות. החזר את PFA עם 18% סוכרוז במשך 16-24 שעות ואז להקפיא את רקמות עבור חתך. </li><li style=";text-align:right;direction:rtl"> השתמש מכונת cryostat לחתוך את הרקמה 17, 18, 19. מומלץ לחמם את הסעיפים רקמות לטמפרטורת החדר במשך כ 60 דקות ומניחים אותם אצטון במשך 10 דקות בטמפרטורת החדר. לייבש אותם בטמפרטורת החדר למשך כ 5 דקות. </li><li style=";text-align:right;direction:rtl"> להוסיף העולה FBS, להסיר אותו על ידי פיפטה, ומוסיפים-RFP אנטי ביחס של 1: BSA 200 דילול ב -0.1% / 1x PBS. דגירת הנוגדנים ב 37 מעלות צלזיוס במשך 60 דקות. </li><li style=";text-align:right;direction:rtl"> יש לשטוף את הסעיפים 1x PBS במשך 10 דקות ולהחיל את נוגדנים משני המתאים (568 נגד ארנב עז) לרקמה, מדולל 1: 300 ב 1% BSA / 1x PBS, במשך 30 דקות בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> יש לשטוף שקופיות 1x PBS במשך 10 דקות, לנגב אותם יבש, ולהוסיף coverslips. </li><li style=";text-align:right;direction:rtl"> דמיינו כל הדגימות באמצעות מיקרוסקופ פלואורסצנטי תחת תאורה עקבית (RFP: עירור מסנן 540-580 ננומטר) באמצעות המטרה 40X. </li></ol>

<ol>
	<li>Awasthi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+IL-23+receptor+gfp+reporter+mice+reveal+distinct+populations+of+IL-17-producing+cells.">Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells.</a> J Immunol. 182, 5904-5908 (2009).</li><li>Price, A. E., Reinhardt, R. L., Liang, H. E., Locksley, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marking+and+quantifying+IL-17A-producing+cells+in+vivo.">Marking and quantifying IL-17A-producing cells in vivo.</a> PLoS One. 7, e39750 (2012).</li><li>Kamanaka, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+interleukin-10+in+intestinal+lymphocytes+detected+by+an+interleukin-10+reporter+knockin+tiger+mouse.">Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.</a> Immunity. 25, 941-952 (2006).</li><li>Sonnenberg, G. F., Fouser, L. A., Artis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Border+patrol:+regulation+of+immunity,+inflammation+and+tissue+homeostasis+at+barrier+surfaces+by+IL-22.">Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22.</a> Nat Immunol. 12, 383-390 (2011).</li><li>Dumoutier, L., Louahed, J., Renauld, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+characterization+of+IL-10-related+T+cell-derived+inducible+factor+(IL-TIF),+a+novel+cytokine+structurally+related+to+IL-10+and+inducible+by+IL-9.">Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.</a> J Immunol. 164, 1814-1819 (2000).</li><li>Cella, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+natural+killer+cell+subset+provides+an+innate+source+of+IL-22+for+mucosal+immunity.">A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity.</a> Nature. 457, 722-725 (2009).</li><li>Sanos, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RORgammat+and+commensal+microflora+are+required+for+the+differentiation+of+mucosal+interleukin+22-producing+NKp46++cells.">RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells.</a> Nat Immunol. 10, 83-91 (2009).</li><li>Spits, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+lymphoid+cells--a+proposal+for+uniform+nomenclature.">Innate lymphoid cells--a proposal for uniform nomenclature.</a> Nat Rev Immunol. 13, 145-149 (2013).</li><li>Mazzucchelli, R. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+identification+of+IL-7+producing+cells+in+reporter+mice.">Visualization and identification of IL-7 producing cells in reporter mice.</a> PLoS One. 4, e7637 (2009).</li><li>Shen, W., Hixon, J. A., McLean, M. H., Li, W. Q., Durum, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22-Expressing+Murine+Lymphocytes+Display+Plasticity+and+Pathogenicity+in+Reporter+Mice.">IL-22-Expressing Murine Lymphocytes Display Plasticity and Pathogenicity in Reporter Mice.</a> Front Immunol. 6, 662 (2015).</li><li>Gong, S., Yang, X. W., Li, C., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+modification+of+bacterial+artificial+chromosomes+(BACs)+using+novel+shuttle+vectors+containing+the+R6Kgamma+origin+of+replication.">Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication.</a> Genome Res. 12, 1992-1998 (2002).</li><li>Shen, W., Huang, Y., Tang, Y., Liu, D. P., Liang, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+to+modify+BACs+to+generate+large+recombinant+DNA+fragments.">A general method to modify BACs to generate large recombinant DNA fragments.</a> Mol Biotechnol. 31, 181-186 (2005).</li><li>Cho, A., Haruyama, N., Kulkarni, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+mice.">Generation of transgenic mice.</a> Curr Protoc Cell Biol. Chapter. Chapter 19, Unit 19 11 (2009).</li><li>Danneman, P. J., Stein, S., Walshaw, S. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humane+and+practical+implications+of+using+carbon+dioxide+mixed+with+oxygen+for+anesthesia+or+euthanasia+of+rats.">Humane and practical implications of using carbon dioxide mixed with oxygen for anesthesia or euthanasia of rats.</a> Lab Anim Sci. 47, 376-385 (1997).</li><li>Omata, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+coccidian+enteroepithelial+stages+of+Toxoplasma+gondii+from+the+intestinal+mucosa+of+cats+by+Percoll+density-gradient+centrifugation.">Isolation of coccidian enteroepithelial stages of Toxoplasma gondii from the intestinal mucosa of cats by Percoll density-gradient centrifugation.</a> Parasitol Res. 83, 574-577 (1997).</li><li>Kumar, N., Borth, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-cytometry+and+cell+sorting:+an+efficient+approach+to+investigate+productivity+and+cell+physiology+in+mammalian+cell+factories.">Flow-cytometry and cell sorting: an efficient approach to investigate productivity and cell physiology in mammalian cell factories.</a> Methods. 56, 366-374 (2012).</li><li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> CSH Protoc. 2008, pdb.prot4991 (2008).</li><li>Hilbe, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+automated+cellular+imaging+system+and+manual+microscopy+for+immunohistochemically+stained+cryostat+sections+of+lung+cancer+specimens+applying+p53,+ki-67+and+p120.">Comparison of automated cellular imaging system and manual microscopy for immunohistochemically stained cryostat sections of lung cancer specimens applying p53, ki-67 and p120.</a> Oncol Rep. 10, 15-20 (2003).</li><li>Suzuki, Y., Furukawa, M., Abe, J., Kashiwagi, M., Hirose, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localization+of+porcine+trappin-2+(SKALP/elafin)+in+trachea+and+large+intestine+by+in+situ+hybridization+and+immunohistochemistry.">Localization of porcine trappin-2 (SKALP/elafin) in trachea and large intestine by in situ hybridization and immunohistochemistry.</a> Histochem Cell Biol. 114, 15-20 (2000).</li><li>Wolk, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+increases+the+innate+immunity+of+tissues.">IL-22 increases the innate immunity of tissues.</a> Immunity. 21, 241-254 (2004).</li><li>Brand, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+is+increased+in+active+Crohn's+disease+and+promotes+proinflammatory+gene+expression+and+intestinal+epithelial+cell+migration.">IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration.</a> Am J Physiol Gastrointest Liver Physiol. 290, G827-G838 (2006).</li><li>Nagalakshmi, M. L., Rascle, A., Zurawski, S., Menon, S., Waal Malefyt, d. e., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22+activates+STAT3+and+induces+IL-10+by+colon+epithelial+cells.">Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.</a> Int Immunopharmacol. 4, 679-691 (2004).</li><li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Andoh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22,+a+member+of+the+IL-10+subfamily,+induces+inflammatory+responses+in+colonic+subepithelial+myofibroblasts.">Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts.</a> Gastroenterology. 129, 969-984 (2005).</li><li>Bhan, A. K., Mizoguchi, E., Smith, R. N., Mizoguchi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colitis+in+transgenic+and+knockout+animals+as+models+of+human+inflammatory+bowel+disease.">Colitis in transgenic and knockout animals as models of human inflammatory bowel disease.</a> Immunol Rev. 169, 195-207 (1999).</li><li>Mombaerts, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+development+of+inflammatory+bowel+disease+in+T+cell+receptor+mutant+mice.">Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice.</a> Cell. 75, 274-282 (1993).</li><li>Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+regulation+in+the+intestine:+a+balancing+act+between+effector+and+regulatory+T+cell+responses.">Immune regulation in the intestine: a balancing act between effector and regulatory T cell responses.</a> Ann N Y Acad Sci. 1029, 132-141 (2004).</li><li>Ahlfors, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+fate+reporter+reveals+origin+and+control+of+IL-22+production+in+homeostasis+and+infection.">IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection.</a> J Immunol. 193, 4602-4613 (2014).</li></ol>

The authors have nothing to disclose.

IL-22 ממלאים תפקיד חיוני שיפוץ רקמות הגנת מארחת מולד. תאי IL-מייצר 22 זוהו לשעבר vivo על ידי מכתים תאי. עם זאת, זה עדיין נשאר קשה לעקוב IL-22 ביטוי באתרם, או במצב הרגיל או מצבים דלקתיים. פרוטוקול זה מתאר שיטה חדשה לפתח מודל עכבר כתב IL-22, אשר מאפשר לנו למקם את התאים לבטא כתב in vivo. TdTomato גן מקודד הכתב היה מוכנס לתוך מוקד IL-22 באתר המשבש את רצף האות. תוצאות אסטרטגיה זו ב כתב להיות לכודה בתוך התא לייצר, בניגוד IL-22 אשר מופרש במהירות, המאפשרות הדמיה של תא הייצור. כתב IL-22-המהונדס ניתן בתוך BAC גדול, במטרה לשמר את הגורמים רגולטוריים, ובכך מקנות נאמנות ביטוי של העיתונאי תואם לזה של IL-22. רקמות המעיים של מ &#39;המהונדסקרח מוצג ביטוי הכתב ההומיאוסטטית ב CD4 T תאים לימפוציטים מולדים שכבת הרירית המיוחדת של המעי הדק. קוליטיס המושרה, תאי CD4 T הביע הכתב במעי הגס. תפקידיו של IL-22 במחלת מעי דלקתית אינם ברורים. על ידי השתתפות התחדשות הביטחון הרקמה הרירית של המעי, IL-22 הוא מסוגל לעורר את הייצור של שני 20 מגן, 21, 22 ומגשרים מעודדי דלקת (למשל, IL-8) 23, 24. שני מודלים של קוליטיס תא מונחה T הראו עליות IL-22 במעי הגס, כולל α TCR - / - עכברים 25, 26 ו המודל להעברה CD45RB 27. השוואת מודלים מחלות מעי דלקתיות, ביטוי-22 IL במעי היה גבוה יותר משמעו Crmodelthan מחלת האון במודל של קוליטיס כיבתה 21, 24 .הנה, אנו להעביר תאי CD4CD45RBhi T מן העכברים כתב לתוך Rag1 - / - מקבלים לחקות את התהליך פתוגניים של מחלת קרוהן. מצאנו כי, שקודם קוליטיס, IL-22 כתבים היו דמיינו בבלוטות הלימפה ניקוז מעיים (MLN). האותות מכן פחתה MLN ועבר את המעיים, במיוחד במעי הדק הדיסטלי ו נקודתיים, עם התפתחות קוליטיס. רוב עיתונאי tdTomato היו נקודות בתוך רירית שכבת רירית המיוחדת של המעי. סוג אחר של כתב IL-22 תוארה בעבר, שבו תאים מסומנים לצמיתות כזה שהם ובנותיהם ממשיכים להביע הכתב, אם לא תעתיק של IL-22 המשיך 28. כמו לימפוציטים המולד המחקר, הבטן שלנו סומנו בתנאים ההומיאוסטטית, ובשנת קוליטיס, tהכתב הוא היה מקומי בתאי T מן בלוטות הלימפה mesenteric אל רקמת המעי. הנהלים המתוארים בפרוטוקול זה יהיו ישימים להקמת עכברי כתב transgene אחרים, כגון IL-17, IL-25, וכן הלאה. עם זאת, חשוב לבחור שיבוטי BAC מתאימים נושאת גורמי רגולטוריים דיסטלי להבטיח את הנאמנות של ביטוי גני כתב, מאז transgenes משולב באופן אקראי לתוך גנום העכבר. העכבר הכתב מאפשרת זיהוי של תאים המבטאים in vivo, כמו גם עבור טיהור ואפיון של תאים חיים. השתמשנו tdTomato, חלבון פלואורסצנטי אדום בהיר במיוחד, כמו גן כתב ניאון כדי להפוך את הכתב מתאים בדיקות הדמיה חיות.

סוג ספציפי ביטוי נייד של גני כתב שימושי כדי לזהות תאים פעילים המבטאים את היעד ברקמות תחת מדינות ההומיאוסטטית ומודאגות. זה גם מאפשר הטיהור של תאים אלה, אשר נשארים קיימא, ללמוד נכסים הנוספים שלהם. עכברי כתב כבר נוצלו הבהרת מנגנון הפעולה עבור ציטוקינים ספציפיים, גורמי שעתוק, ואלמנטים רגולטוריים. אסטרטגיות קודמות 1, 2, 3 הסתמכו בעיקר על דפיקות הכתב לתוך מוקד יעד כרומוזום העכבר, הליך זמן רב ויקר. לפיכך, שיטה פשוטה עבור הדור של עכברי כתב רצויה. ציטוקינים הם מעמד רחב של חלבונים קטנים, מופרש / פפטידים המווסתים את התגובה החיסונית באמצעות איתות אינטר. Interleukin 22 (IL-22) הוא ציטוקין עם רבים דיווחו פעילויות, כולל מחסום פוnction, תיקון רקמות, ודלקת 4. למרות IL-22 התגלה בתחילה כמוצר T-cell 5, דוחות שלאחר מכן הפגינו ביטויו הרג טבעיים (NK) תאים בבני אדם 6 ועכברים 7 ו בסוגים אחרים של לימפוציטים מולד 8. למרות תצפית נרחבת של תאי-22-ייצור IL, ויזואליזציה של IL-22 בעבר נדרש vivo לשעבר גירוי permeabilization בפני כתמים עם נוגדנים. לכן, רומן IL-22 עכברים הכתב יהיה כלי מאוד שימושי כדי לחקור את הפונקציה של IL-22 בתהליכים ההומיאוסטטית ו פתוגניים. הנה, פתחנו מודל עכבר כתב מהונדס פשוט לשמור על IL-22-ייצור תאי in vivo ו במבחנה. באמצעות שיטה BAC recombineering 9, הכנסנו את רצף cDNA tdTomato עם פולי שברי אות לתוך loc IL-22לנו והחלפתי אקסון 1. האזורים המתורגמים האחרים, אקסונים, והאלמנטים רגולטוריים לא היו מוטרדים, מאז שהיינו רוצים לחקות את הוויסות הטבעית של IL-22 ככל האפשר. האתר של החדרת הכתב משבש את רצף האות, וכתוצאה מכך הצטברות של הכתב בתוך התאים המייצרים, בניגוד IL-22 עצמו, אשר מופרש במהירות. שיטה חדשה זו יכולה לחול גם על הדור של עכברי כתב חלבונים מופרשים אחרים.

<table><tbody><tr><td>RP23-401E11 BAC</td><td>Thermo Fisher Scientific</td><td>RPCI23.C</td><td>Need gene ID: 50929</td></tr><tr><td>NucleoBond BAC 100</td><td>Takara Clontech</td><td>740579</td><td></td></tr><tr><td>PCR SuperMix High Fidelity</td><td>Thermo Fisher Scientific</td><td>10790020</td><td></td></tr><tr><td>PI-SceI</td><td>New England Biolabs</td><td>R0696S</td><td></td></tr><tr><td>SpeI</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>LB Broth</td><td>Thermo Fisher Scientific</td><td>10855-001</td><td>1 L: 10 g SELECT Peptone 140, 5 g SELECT Yeast Extract, 5 g sodium chloride&amp;nbsp;</td></tr><tr><td>Anti-mouse CD3</td><td>eBioscience</td><td>11-0031</td><td></td></tr><tr><td>Anti-mouse CD4</td><td>eBioscience</td><td>17-0041</td><td></td></tr><tr><td>Anti-mouse CD45</td><td>Thermo Fisher Scientific</td><td>MCD4530</td><td></td></tr><tr><td>Anti-mouse CD45RB</td><td>eBioscience</td><td>11-0455</td><td></td></tr><tr><td>Anti-mouse RFP</td><td>Abcam</td><td>Ab62341</td><td></td></tr><tr><td>HBSS, no calcium, no magnesium, no phenol red</td><td>Thermo Fisher Scientific</td><td>14175145</td><td>KCl, KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;, Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;, NaHCO&lt;sub&gt;3&lt;/sub&gt;, NaCl, D-Glucose</td></tr><tr><td>Dnase I</td><td>Roche</td><td>10104159001</td><td></td></tr><tr><td>ACK lysing buffer</td><td>Thermo Fisher Scientific</td><td>A1049201</td><td></td></tr><tr><td>Percoll</td><td>GE healthcare life sciences</td><td>17-0891-01</td><td></td></tr><tr><td>Collagenase D</td><td>Roche</td><td>11088858001</td><td></td></tr><tr><td>Dispase II (neutral protease, grade II)</td><td>Roche</td><td>4942078001</td><td></td></tr><tr><td>IX70 inverted fluorescence microscope</td><td>Olympus</td><td></td><td>Ask for quote</td></tr><tr><td>Nikon Eclipse 80i microscope</td><td>Nikon</td><td></td><td>Ask for quote</td></tr><tr><td>Dynal shaker</td><td>Electron Microscopy Science</td><td>61050-10</td><td></td></tr><tr><td>FACSAria</td><td>BD Bioscience</td><td></td><td>Ask for quote</td></tr><tr><td>LSRII SORP/flow cytometry</td><td>Becton, Dickinson and Company&amp;nbsp;</td><td></td><td>Ask for quote</td></tr></tbody></table>

visualization of il-22-expressing lymphocytes using reporter mice

עכברי Reporter היו בשימוש נרחב כדי לבחון את הלוקליזציה של ביטוי של גנים ממוקדים. פרוטוקול זה מתמקד אסטרטגיה לבסס מודל עכבר כתב המהונדס חדש. בחרנו לדמיין interleukin (IL) ביטוי גנים 22 כי ציטוקינים זה יש פעילויות חשובות במעי, שם הוא תורם לתקן רקמות שנפגעו על ידי דלקת. מערכות Reporter להציע יתרונות משמעותיים על פני שיטות אחרות של זיהוי מוצרי in vivo. במקרה של IL-22, מחקרים אחרים בודדים לראשונה תאים מרקמות ולאחר מכן מחדש עוררו את התאים במבחנה. IL-22, אשר מופרש בדרך כלל, היה לכוד בתוך התאים באמצעות תרופה, והכתים תאיים שימש לדמיין את הדברים. שיטה זו מזהה תאים מסוגלים לייצר IL-22, אבל זה לא לקבוע אם הם עושים כל כך in vivo. עיצוב הכתב כולל החדרת גן חלבון פלואורסצנטי (tdTomato) לתוך גן IL-22 בתוך wa כזהy כי חלבון פלואורסצנטי לא יכול להיות מופרשים ולכן נשארה לכודה בתוך התאים המייצרים in vivo. המפיקים פלורסנט ניתן דמיינו מכן בסעיפים רקמות או על ידי ניתוח vivo לשעבר באמצעות cytometry הזרימה. תהליך הבנייה בפועל עבור הכתב כלולים recombineering כרומוזום בקטריאלי מלאכותי שהכיל את הגן IL-22. כרומוזום מהונדס זה אז הוכנס גנום העכבר. ביטוי כתב ההומיאוסטטית IL-22 נצפה ברקמות עכבר שונות, כולל הטחול, התימוס, בלוטות הלימפה, התיקון של Peyer ומעי, על ידי ניתוח תזרים cytometry. קוליטיס הושר על ידי תאי T (CD4 + CD45RBhigh) העברה, וביטוי כתב היה דמיין. T תאים חיוביים נוכחים ראשונים הבלוטות לימפה mesenteric, ולאחר מכן הם שהצטברו בתוך שכבת הרירית המיוחדת של רקמות מעי גסות הדיסטלי הקטנות. האסטרטגיה באמצעות BACS נתנה ביטוי כתב-נאמנות טובה לעומת IL-22 הבעהשיאון, וזה פשוט יותר מאשר נהלים עקומים.

Transgene כתב murine IL-22 נוצר באמצעות recombineering לשנות כרומוזום בקטריאלי מלאכותי נושא את לוקוס IL-22. איור 1 מציג דיאגרמה של וקטור pBACe3.6 המכיל את הגן sacBII, סמן חיובי-הבחירה, גן עמידות לאנטיביוטיקה chloramphenicol 11. אחרי שהצגתי את tdTomato לתוך אקסון 1, רצף הפפטיד האות שובש, כפי שמוצג באיור 2. לפיכך, כתב tdTomato היה לכוד בתוך התאים IL-22-להביע, מה שמאפשר זיהוי והבידוד שלהם על ידי cytometry זרימה. העכברים הומוזיגוטים גדלו מקווי מייסד הוקרנו על ידי PCR, והם לא דורשים backcrossing על מנת להשיג צאצאים עם זהות גנטית, כפי שנדרש באסטרטגית הרגילה העקומה. כדי לבדוק את הנאמנות של הכתבים IL-22, במבחנה splenocytes -generated היו בתרבית תחת Th22 או תנאי נייטרלי. <strong<html> &gt; איור 3 מראה כי IL-22-tdTomato היטיב להביע בתאים Th22 במבחנה, זוהה באמצעות זרימת cytometry או על ידי מיקרוסקופ פלואורסצנטי. בשנת vivo, כפי שמוצג באיור 4, כתב IL-22 התגלה ברקמות עכבר שונות בתנאים ההומיאוסטטית. רוב אות tdTomato נמצאה שכבת רירית מיוחדת תאים (LP) מהבטן, אך לא את הלימפה בבית השחי (ALN), הטחול, או התימוס. כדי להמחיש את כתב tdTomato ב רקמה דלקתית, השתמשנו במודל קוליטיס עכבר מושרה על ידי העברת כתב CD4 + CD45Rb היי תאי T לתוך Rag1 - / - עכברים. איור 5 מדגים כי הכתבים שנוכחים ראשונים בלוטות הלימפה mesenteric ואז שהצטברו בתוך שכבת הרירית המיוחדת של רקמות מעי דק ומעי גסים הדיסטלי. יחדיו, שיטה חדשה זו עבור הדור של עכברי כתב IL-22 היא יעילה חוסך זמן. בתוך-page = &quot;1&quot;&gt; <img alt="איור 1" src="/files/ftp_upload/54710/54710fig1.jpg" /> איור 1: מפת האתר של וקטור pBACe3.6. pBACe3.6 מאופיין המכיל התנגדות chloramphenicol אנטיביוטיקה גן sacBII כסמן חיובי-הבחירה. במהלך רקומבינציה, השיבוטים הרצויים הם סוכרוז עמידים דרך שלהם לבטא את גן sacBII והם מותר לגדל על תקשורת סוכרוז המכיל, ואילו מושבות BAC השליליות הן סוכרוז רגיש. <img alt="איור 2" src="/files/ftp_upload/54710/54710fig2.jpg" /> איור 2: מבט סכמטי של שיבוט RP23-401E11 BAC השונה. גן כתב tdTomato הוכנס מוקד Il-22, אשר כולל IL-22 ואלמנטים תקנוניים (RP23-401E11 BAC) בעכברים בקטריאלי מלאכותי כרומוזום, באמצעות טכנולוגיית recombineering. על ידי רקומבינציה הומולוגי, הרצף של הפפטיד האות של Il-22 ב<html> BAC הופרע אקסון 1 של Il-22 הוחלף גן כתב tdTomato. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/54710/54710fig3.jpg" /> איור 3: זיהוי של IL-22 לכתבים splenocytes מתורבת במבחנה. תאי CD4 T היו מטוהרים מן הטחול ואז מגורה עם-CD28 אנטי; אנטי CD3 (מצב נייטרלי); או אנטי CD3, אנטי CD28, אנטי IFNƳ, אנטי IL4, IL-6, TGF-β, ו -6 Formylindolo (3,2-ב) carbazole (FICZ) במשך 5 ימים. IL-22-tdTomato נותח על ידי cytometry זרימה (שני למעלה) מיקרוסקופ פלואורסצנטי (למטה שני, סרגל קנה מידה: 100 מיקרומטר). מספרי הרביעים לציין את אחוז תאי CD45 +.<html> Target = &quot;_ blank&quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 4" src="/files/ftp_upload/54710/54710fig4.jpg" /> איור 4: ויזואליזציה של IL-22-בייצור תאים ברקמות עכבר שונים. תא בודד השעיות הוכנו מן הטחול, התימוס, בלוטות הלימפה, מעיים (IEL ו LP), ואת התיקון של Peyer. הם היו אז משטח מוכתם FITC-אנטי CD3 ובחן לביטוי tdTomato. MLN: בלוטה לימפה mesenteric, ALN: הקשרים לימפה בבית השחי, PP: התיקון של Peyer, IEL: תאי intraepithelial המבודדים מן המעי הדק, LP: תאי שכבת רירית מיוחדים מטוהר מן המעי הדק. מספרי הרביעים לציין את אחוז תאי CD45 +. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> ין-page = &quot;1&quot;&gt; <img alt="איור 5" src="/files/ftp_upload/54710/54710fig5.jpg" /> איור 5: לוקליזציה של IL-22 לכתבים במהלך הפיתוח של קוליטיס העברת תאי T. CD4CD45RBHigh T תאים מעכברי כתב IL-22 הועברו לתוך Rag1 - / - עכברים, ואת אותות tdTomato הוערכו על ידי אימונוהיסטוכימיה ברקמות השונות בנקודות זמן שונות במהלך הפיתוח של קוליטיס. החצים מצביעים על אותות IL-22-tdTomato. ברי סולם = 25 מיקרומטר. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

ויזואליזציה של לימפוציטים-22-להביע IL באמצעות עכברים Reporter

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

visualization-of-il-22-expressing-lymphocytes-using-reporter-mice

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

8.7K Views.  National Cancer Institute, National Institutes of Health. We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse. 

Video: Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Detection and Isolation of Viable Mouse IL-17-Secreting T Cells

The MACS Cytokine Secretion Assay technology allows detection of secreted cytokines on the single cell level and sensitive isolation of viable cytokine-secreting cells. In order to label IL-17-secreting cells, a single cell suspension of mouse splenocytes is prepared and stimulated at 37&deg;C with PMA/ionomycin to induce cytokine secretion. To stop secretion cells are then placed on ice and are exposed to the IL-17 Catch Reagent   a bi-specific antibody that binds to CD45 on the cell surface of leukocytes and to IL-17 as it is secreted and caught near the cell surface. Secretion is then re-started by increasing the temperature to 37&deg;C and IL-17 is trapped by the Catch Reagent. Secretion is then stopped again, by placing cells on ice. To detect the trapped IL-17, cells are incubated with a second IL-17-specific antibody conjugated to biotin and an Anti-Biotin-PE antibody. Cells can now be directly analyzed by flow cytometry or prepared for isolation and enrichment by subsequent labeling with Anti-PE conjugated MicroBeads.

This procedure describes the detection and isolation of mouse TH17 leukocytes that actively secrete IL-17 upon stimulation.

זיהוי ובידוד של Viable IL-17-מפריש תאים עכבר T

The MACS Cytokine Secretion Assay technology allows detection of secreted cytokines on the single cell level and sensitive isolation of viable ...

Biology

Long Term Intravital Multiphoton Microscopy Imaging of Immune Cells in Healthy and Diseased Liver Using CXCR6.Gfp Reporter Mice

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, neutrophils, T cell subsets, B cells, natural killer (NK) and NKT cells. Intravital microscopy of the liver for monitoring immune cell migration is particularly challenging due to the high requirements regarding sample preparation and fixation, optical resolution and long-term animal survival. Yet, the dynamics of inflammatory processes as well as cellular interaction studies could provide critical information to better understand the initiation, progression and regression of inflammatory liver disease. Therefore, a highly sensitive and reliable method was established to study migration and cell-cell-interactions of different immune cells in mouse liver over long periods (about 6 hr) by intravital two-photon laser scanning microscopy (TPLSM) in combination with intensive care monitoring.
The method provided includes a gentle preparation and stable fixation of the liver with minimal perturbation of the organ; long term intravital imaging using multicolor multiphoton microscopy with virtually no photobleaching or phototoxic effects over a time period of up to 6 hr, allowing tracking of specific leukocyte subsets; and stable imaging conditions due to extensive monitoring of mouse vital parameters and stabilization of circulation, temperature and gas exchange.
To investigate lymphocyte migration upon liver inflammation CXCR6.gfp knock-in mice were subjected to intravital liver imaging under baseline conditions and after acute and chronic liver damage induced by intraperitoneal injection(s) of carbon tetrachloride (CCl4).
CXCR6 is a chemokine receptor expressed on lymphocytes, mainly on Natural Killer T (NKT)-, Natural Killer (NK)- and subsets of T lymphocytes such as CD4 T cells but also mucosal associated invariant (MAIT) T cells1. Following the migratory pattern and positioning of CXCR6.gfp+ immune cells allowed a detailed insight into their altered behavior upon liver injury and therefore their potential involvement in disease progression.

Stable intravital high-resolution imaging of immune cells in the liver is challenging. Here we provide a highly sensitive and reliable method to study migration and cell-cell-interactions of immune cells in mouse liver over long periods (about 6 hours) by intravital multiphoton laser scanning microscopy in combination with intensive care monitoring.

לטווח ארוך Intravital multiphoton מיקרוסקופית הדמיה של תאים חיסוני בבריאים וחולה כבד באמצעות עכברים CXCR6.Gfp Reporter

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, ...

Intravital Imaging of Neutrophil Priming Using IL-1&#946; Promoter-driven DsRed Reporter Mice

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that enhances the phagocytic functionality of neutrophils. Although extensive studies have unveiled the existence and importance of neutrophil priming during infection and injury, means of visualizing this process in vivo have been unavailable. The protocol provided enables monitoring of the dynamic process of neutrophil priming in living animals by combining three methodologies: 1) DsRed reporter signal &#8212; used as a measure of priming 2) in vivo neutrophil labeling &#8212; achieved by injection of fluorescence-conjugated anti-lymphocyte antigen 6G (Ly6G) monoclonal antibody (mAb) and 3) intravital confocal imaging. Several critical steps are involved in this protocol: oxazolone-induced mouse ear skin inflammation, appropriate sedation of animals, repeated injections of anti-Ly6G mAb, and prevention of focus drift during imaging. Although a few limitations have been observed, such as the limit of continuous imaging time (~ 8 hr) in one mouse and the leakage of fluorescein isothiocyanate-dextran from blood vessels in the inflammatory state, this protocol provides a fundamental framework for intravital imaging of primed neutrophil behavior and function, which can easily be expanded to examination of other immune cells in mouse inflammation models.

This current protocol employs fluorescent reporters, in vivo labeling, and intravital imaging techniques to enable monitoring of the dynamic process of neutrophil priming in living animals.

הדמיה Intravital של Priming נויטרופילים שימוש IL-1β מונחה יזם עכברים Reporter DsRed

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that ...

Phenotypic and Functional Analysis of Activated Regulatory T Cells Isolated from Chronic Lymphocytic Choriomeningitis Virus-infected Mice

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance and homeostasis maintenance by regulating the immune response. The primary role of Treg cells is to suppress the proliferation of effector T (Teff) cells and the production of cytokines such as IFN-&#947;, TNF-&#945;, and IL-2. It has been demonstrated that Treg cells&#39; ability to inhibit the function of Teff cells is enhanced during persistent pathogen infection and cancer development. To clarify the function of Treg cells under resting or inflamed conditions, a variety of in vitro suppression assays using mouse or human Treg cells have been devised. The main aim of this study is to develop a method to compare the differences in phenotype and suppressive function between resting and activated Treg cells. To isolate activated Treg cells, mice were infected with lymphocytic choriomeningitis virus (LCMV) clone 13 (CL13), a chronic strain of LCMV. Treg cells isolated from the spleen of LCMV CL13-infected mice exhibited both the activated phenotype and enhanced suppressive activity compared with resting Treg cells isolated from na&#239;ve mice. Here, we describe the basic protocol for ex vivo phenotype analysis to distinguish activated Treg cells from resting Treg cells. Furthermore, we describe a protocol for the measurement of the suppressive activity of fully activated Treg cells.

Here, we describe a protocol to analyze the phenotype of regulatory T (Treg) cells isolated from na&#239;ve and chronic lymphocytic choriomeningitis virus-infected mice. In addition, we provide a process to evaluate the suppressive activity of the Treg cells.

פנוטיפי אנליזה פונקציונלית של תאים תקינה T הופעל מבודדת מן עכברים הנגועים בנגיף לימפוציטית כרונית Choriomeningitis

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance ...

Isolation and Activation of Murine Lymphocytes

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading pathogen1,2. Understandably, such intricate abilities are controlled by a large number of molecules involved in various cellular processes to ensure timely and spatially regulated immune responses3. Here, we describe experimental procedures that allow rapid isolation of highly purified murine lymphocytes using magnetic cell sorting technology. The resulting purified lymphocytes can then be subjected to various in vitro or in vivo functional assays, such as the determination of lymphocyte signaling capacity upon stimulation by immunoblotting4 and the investigation of proliferative abilities by 3H-thymidine incorporation or carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling5-7. In addition to comparing the functional capacities of control and genetically modified lymphocytes, we can also determine the T cell stimulatory capacity of antigen-presenting cells (APCs) in vivo, as shown in our representative results using transplanted CFSE-labeled OT-I T cells.

Lymphocytes are the major players in adaptive immune responses. Here, we present a lymphocyte purification protocol to determine the physiological functions of the desired molecules in lymphocyte activation in vitro and in vivo. The described experimental procedures are suitable for comparing functional capacities between control and genetically modified lymphocytes.

בידוד ההפעלה של Murine לימפוציטים

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading ...

An IL-8 Transiently Transgenized Mouse Model for the In Vivo Long-term Monitoring of Inflammatory Responses

Airway inflammation is often associated with bacterial infections and represents a major determinant of lung disease. The in vivo determination of the pro-inflammatory capabilities of various factors is challenging and requires terminal procedures, such as bronchoalveolar lavage and the removal of lungs for in situ analysis, precluding longitudinal visualization in the same mouse. Here, lung inflammation is induced through the intratracheal instillation of Pseudomonas aeruginosa culture supernatant (SN) in transiently transgenized mice expressing the luciferase reporter gene under the control of a heterologous IL-8 bovine promoter. Luciferase expression in the lung is monitored by in vivo bioluminescent image (BLI) analysis over a 2.5- to 48-h timeframe following the instillation. The procedure can be repeated multiple times within 2 - 3 months, thus permitting the evaluation of the inflammatory response in the same mice without the need to terminate the animals. This approach permits the monitoring of pro- and anti-inflammatory factors acting in the lung in real time and appears suitable for functional and pharmacological studies.

An IL-8 Transiently Transgenized Mouse Model for the In Vivo Long-term Monitoring of Inflammatory Responses

The method described here allows for the visualization of IL-8 promoter-dependent inflammation activation in the lungs of mice through non-invasive bioluminescence imaging (BLI). The same animal can be subjected to BLI multiple times for up to two months from the time of delivery of the luciferase reporter construct.

דגם IL-8 עכבר transgenized חולף עבור<em&gt; בויבו</emמעקב ארוך טווח אחר תגובות דלקתיות

Airway inflammation is often associated with bacterial infections and represents a major determinant of lung disease. The in vivo determination of the ...

Imaging of In Situ Interferon Gamma Production in the Mouse Spleen following Listeria monocytogenes Infection

Cytokines are small proteins secreted by cells, mediating cell-cell communications that are crucial for effective immune responses. One characteristic of cytokines is their pleiotropism, as they are produced by and can affect a multitude of cell types. As such, it is important to understand not only which cells are producing cytokines, but also in which environment they do so, in order to define more specific therapeutics. Here, we describe a method to visualize cytokine production in situ following bacterial infection. This technique relies on imaging cytokine-producing cells in their native environment by confocal microscopy. To do so, tissue sections are stained for markers of multiple cell types together with a cytokine stain. Key to this method, cytokine secretion is blocked directly in vivo before harvesting the tissue of interest, allowing for detection of the cytokine that accumulated inside the producing cells. The advantages of this method are multiple. First, the microenvironment in which cytokines are produced is preserved, which could ultimately inform on the signals required for cytokine production and the cells affected by those cytokines. In addition, this method gives an indication of the location of the cytokine production in vivo, as it does not rely on artificial in vitro re-stimulation of the producing cells. However, it is not possible to simultaneously analyze cytokine downstream signaling in cells that receive the cytokine. Similarly, the cytokine signals observed correspond&#160;only to the time-window during which cytokine secretion was blocked. While we describe the visualization of the cytokine Interferon (IFN) gamma in the spleen following mouse infection by the intracellular bacteria Listeria monocytogenes, this method could potentially be adapted to the visualization of any cytokine in most organs.

Imaging of In Situ Interferon Gamma Production in the Mouse Spleen following Listeria monocytogenes Infection

Here, we describe a simple confocal imaging method to visualize the in situ localization of cells secreting the cytokine Interferon gamma in murine secondary lymphoid organs. This protocol can be extended for the visualization of other cytokines in diverse tissues.

הדמיה של אינטרפרון באתרו הפקת גמא בטחול העכבר בעקבות זיהום יסטריה חיידקי

Cytokines are small proteins secreted by cells, mediating cell-cell communications that are crucial for effective immune responses. One characteristic of ...

Intravital Imaging of Intraepithelial Lymphocytes in Murine Small Intestine

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal epithelium. Due in part to the lack of a definitive ligand for the &#947;&#948; T cell receptor, our understanding of the regulation of &#947;&#948; IEL activation and their function in vivo remains limited. This necessitates the development of alternative strategies to interrogate signaling pathways involved in regulating &#947;&#948; IEL function and the responsiveness of these cells to the local microenvironment. Although &#947;&#948; IELs are widely understood to limit pathogen translocation, the use of intravital imaging has been critical to understanding the spatiotemporal dynamics of IEL/epithelial interactions at steady-state and in response to invasive pathogens. Herein, we present a protocol for visualizing IEL migratory behavior in the small intestinal mucosa of a GFP &#947;&#948; T cell reporter mouse using inverted spinning disk confocal laser microscopy. Although the maximum imaging depth of this approach is limited relative to the use of two-photon laser-scanning microscopy, spinning disk confocal laser microscopy provides the advantage of high speed image acquisition with reduced photobleaching and photodamage. Using 4D image analysis software, T cell surveillance behavior and their interactions with neighboring cells can be analyzed following experimental manipulation to provide additional insight into IEL activation and function within the intestinal mucosa.

We describe a method to visualize GFP-labeled &#947;&#948; IELs using intravital imaging of murine small intestine by inverted spinning disk confocal microscopy. This technique enables the tracking of live cells within the mucosa for up to 4 h and can be used to investigate a variety of intestinal immune-epithelial interactions. &#160;

אינטרטל הדמיה של לימפוציטים תוך-אפיתל במעי קטן מוריין

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal ...

Isolation of Group 2 Innate Lymphoid Cells from Mouse Nasal Mucosa to Detect the Expression of CD226

With abundant research on group 2 innate lymphoid cells (ILC2s) published over the years, ILC2s are widely known to be implicated in regulating various pathological processes, including anti-helminth immunity, tissue repair, thermogenesis, and autoimmune diseases such as asthma and allergic rhinitis (AR). ILC2s permanently reside in peripheral tissues such as the skin, gut, lungs, and nasal cavity; however, there is limited information about their exact functions in nasal mucosal immunity. CD226 is an activating costimulatory molecule, mainly expressed on natural killer (NK) cells, T cells, and inflammatory monocytes. However, whether ILC2s express CD226 or play a role in the pathogenesis of ILC2s-related diseases remains unknown. Here, we established a method to isolate and identify ILC2s from the nasal mucosa and detected CD226 expression on ILC2s obtained from healthy and AR mice. Herein, we describe this protocol for the isolation and identification of ILC2s from mouse nasal mucosa, which will help explore the internal pathological mechanism of immunological disorders in nasal mucosal diseases.

Group 2 innate lymphoid cells (ILC2s), implicated in type 2 inflammation, mainly participate in response to helminth infection, allergic diseases, metabolic homeostasis, and tissue repair. In this study, a procedure to isolate ILC2s from murine nasal mucosa and detect the expression of CD226 is demonstrated.

בידוד תאי לימפה מולדים מקבוצה 2 מרירית האף של העכבר כדי לזהות את הביטוי של CD226

With abundant research on group 2 innate lymphoid cells (ILC2s) published over the years, ILC2s are widely known to be implicated in regulating various ...

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response against helminth infections, where it plays an important role in the expulsion of the parasite. In a murine model of Nippostrongylus brasiliensis infection, IL-9 is produced mainly by CD4+ T lymphocytes and innate lymphoid cells found in the lung, small intestine, and draining lymph nodes. Given the technical difficulties involved in the intracellular staining of IL-9, as well as the complexity of isolating hematopoietic cells from the small intestine upon infection, there is a pressing need for a comprehensive but straightforward protocol to analyze the expression of IL-9 in different lymphoid and non-lymphoid tissues in this model. The protocol described here outlines the kinetics of IL-9 produced by CD4+ T cells and innate lymphoid cells in the lung and small intestine, the main organs targeted by N. brasiliensis, as well as in the mediastinal and mesenteric lymph nodes, throughout the infection. In addition, it details the number of larvae needed for infection, depending on the cell type and organ of interest. This protocol aims to assist in the standardization of assays to save time and resources by offering the opportunity to focus on the specific cells, organs, and disease stages of interest in the N. brasiliensis infection model.

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9-expressing T and ILC2 cells are induced during N. brasiliensis infection, yet their characterization has been largely overlooked in the infected intestine due to their low frequency and differential kinetics. This protocol describes the isolation of these cells from different target organs and confirmation of their identity via flow cytometry at different infection stages.

אסטרטגיה לחקר תאי לימפה מייצרי IL-9 במודל זיהום Nippostrongylus brasiliensis

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response ...