Name: visualization of il-22-expressing lymphocytes using reporter mice
Uploaded: 2017-01-25T12:30:00.000+00:00
Duration: 10 min 30 s
Description: Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

We thank Kelli Czarra and Megan Karwan for animal technical assistance, Kathleen Noer and Roberta Matthai for flow cytometry assistance, and Donna Butcher andMiriam R. Anver for pathology analysis. This project was supported by a grant from the Ely and Edythe Broad Foundation (to Scott Durum) and has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. HHSN261200800001E (MRA).

Bütün hayvanlar Bakım ve Kanser Araştırma Frederick Ulusal Laboratuvarı Laboratuvar Hayvanları Komitesi Kullanım 2011 Kılavuzu&#39;nda belirtilen deneysel prosedürlere uygun olarak uygun bakım aldı. BAC Recombineering ile IL-22-tdTomato Raportör 1. Farelerin Üretimi NOT: fareler bilinçsiz olmalı ve bir uyarana karşı tepki olarak hareket etmezler. % 70 etanol ile cerrahi alan sterilize ve bir cam boncuk sterilizatör kullanan tüm cerrahi aletler sterilize edin. <ol><li> Bir alkalin ekstraksiyon yöntemi 10, 11 kullanılarak BAC DNA (RP23-401E11, klon uzunluğu 228.391 bps) arındırın. hedef genin doğru boyutu onaylamak için RP23-401E11 5 ug Spel sindirimi ile BAC klonu karakterize eder. NOT: BAC DNA 14 parça halinde sindirildi. </li><li> PLD53SC-A-GFP-B mekik vektörüne Not I / Sal I mevkisine tdTomato raportör gen eklemek11 ve aynı siteye GFP geninin değiştirin. Daha sonra, bir şablon olarak BAC RP23-401E11 kullanılarak, ilk çevrilen ekson homoloji kutularının (A ve B) amplifiye IL-22 (ekson 1) PCR (95 ° C&#39;de 2 dakika ile; 30 dakika süre ile 95 ° C&#39;de 30 döngü sn, 30 saniye için 55 ° C ve 30 saniye için 72 ° C, ve 10 dakika süreyle 72 ° C&#39;de son uzatma). 50 ul PCR reaksiyon sisteminde, ilave 50 ng (1 uL) BAC DNA, primerler, 0.5 ul (10 uM), PCR Supermix yüksek aslına uygunluk 40 ul ve H2O 8 ul 5&#39;T GGCGCGCC GGAGCTGTGAAGAAAG ve Ters: İleri Bir kutu NOT: aşağıdaki gibi A ve B kutuları için primerler olan 5&#39;CAGAGATCGCACAAGTGTCAAC; İleri B kutusu: 5&#39;G TTAATTAA CTGCCCGTCAACA ve Ters: 5&#39;T GGCCGGCC TGAGCACCTGCTT CATC 10. sınırlama enzimleri (Asc I ve Pac I) siteleri altı çizilmiştir. </li><li> Artan I-sindirilmiş A 500 ng ve Pac I-sindirilmiş B fragmanının 500 ng Arterhastalar, 1 saat boyunca 16 ° C&#39;de PLD53SC-ATB (tdTomato) vektörü, 50 ng halinde. </li><li> 37 ° C &#39;de, kloramfenikol (20 ug / ml) ve ampisilin (30 ug / ml) ile agar plakaları Luria-Bertani (LB) BAC-kompetan hücreler 11 ve kültür bunların saflaştırılmış PLD53SC-ATB vektör dönüşümü. İki ya da üç koloniler seçin Ch / Amp master plakalardan eş-entegre. </li><li> 20 ug / ml kloramfenikol ile takviye edilmiş LB 1 ml her bir koloni inoküle ve 37 ° C&#39;de 1 saat ve 225 rpm&#39;de için inkübe. LB-agar plakası üzerine her karışımın 100 ul yayılması (Peptone 140 10 g, maya özütü, ağar, 12 g ve 1 L su içinde 5 g; pH 7.5) kloramfenikol ve sükrozun 4-4.5% ile takviye edilmiştir. 37 ° C&#39;de gece boyunca kültür inkübe edin. </li><li> hem büyük ve küçük koloniler seçin ve kloramfenikol ile iki LB-agar plakaları bunları replate. Daha sonra da 30 saniye süre ile, UV ışık olmadan da plakalar ortaya çıkarmak ve daha fazla analiz için UV duyarlı koloniler. </li><li> tdTomato / IL-22 heterozigot primer kullanılarak PCR ile modifiye BAC DNA tespit (İleri: 5 &#39;ACT TGT gCg ATC TCT gat GGT; Ters: 5&#39; TGT AAT CGG ggA TGT CGG C). Termosikler koşulları aşağıdaki gibi olan: 2 dakika boyunca 95 ° C; 30 saniye, 30 saniye için 56 ° C, ve 30 saniye süreyle 72 ° C&#39;de, 95 ° C&#39;de 30 döngü; ve 10 dakika süreyle 72 ° C&#39;de son uzatma. </li><li> Büyük hazırlık BAC DNA 12 direkt BAC dizileme ile BAC modifiye alanının dizisi onaylayın. </li><li> yalancı gebelik olan C57BL / 6C farelere mikro-enjekte zigotların implantasyonu sırasında periton boşluğuna% 0.25 tribromoethanol bir dozu ile bir alıcı fare anestezisi. </li><li> IL-22-tdTomato BAC reaksiyon sisteminin 100 ul kısıtlama endonucleasePi-SceI 5 ul ile sindirme ile (10 ug) oluşturmak ve pronükleer aşama 13 de, C57BL / 6 kadın döllenmiş yumurta içine doğrusallaştırılmış BAC DNA Microinject linearize. ScreStandart prosedürler kullanılarak, kuyruk biyopsilerinden izole edilmiş DNA&#39;nın Southern blot analizi ile transgenik fareler en. </li></ol> Dalaklar, Timus, lenf nodu ve Peyer Patch 2. Tek hücreli Hazırlık Not: IL-22-tdTomato raportör farenin Ulusal Kanser Enstitüsü (NCI, Frederick, MD) tutuldu. Ötenazi yöntemi Ötenazi En son AVMA talimatlara uygundur. Tüm fareler CO2 inhalasyon 14 kullanılarak ötenazi uygulandı. <ol><li> CO 2 odasında bir IL-22-tdTomato fare Euthanize ve temiz bir ped üzerine koydu. % 70 alkol püskürtülerek karın cildi sterilize ve açık kesti. soldan, dalak ve sternum arkasında timus çıkarın. </li><li> mesentericlymph düğümleri (mezenterik dokusunda bulunur) ve (ince bağırsak ileum bölgede küçük lymphoidnodules) Peyer yamaları hasat, inci beyazı mezenterik t yakın düğümleri almakvücut dışına bütün ince bağırsağı ve kolon kaldırmak sonra ilk ince nokta tırtıklı ipuçları forseps incelemek ve kullanma ince bağırsağın o duvarı. gut boyunca uzatılmış oval lekeler (Peyer yamaları) Bul ve makasla kesti. PBS /% 1 fetal inek serumu (FBS), buz üzerinde tampon içinde tek bir hücre süspansiyonu içine tek tek, iki buzlu slaytlar arasında bu lenfoid dokulardan (lenf düğümleri ve Peyer yamaları) öğütün. </li><li> Adım 2.2 ile aynı yöntemi kullanarak dalak veya timus dokuları kıyma. 500 x g&#39;de 8 dakika 4 ° C dalak süspansiyon santrifüjleyin. Hücre peletlere dalak başına ACK yokedici tampon 1 ml. </li><li> İyice karıştırın ve onları 1 dakika boyunca bekletin. Her bir örnek için steril fosfat-tamponlu tuzlu su (PBS), tampon 9 ml ekleyin. Kırmızı kan hücreleri çıkarmak için 500 x g ve 4 ° C&#39;de 8 dakika için santrifüjleme ile dönerler. NOT: timus hücreleri ACK parçalama tampon katmayın. </li><li> PBS ve p 5 ml elde lökositlerin yeniden süspanse100 mikron hücre süzgecinden hücreleri ass. 8 dakika boyunca 500 x g&#39;de santrifüj ile hücre pelletleri toplayın. </li><li> RPMI ortam veya FACS tampon, 5 ml hücrelerin tekrar ve% 0.4 tripan mavi boya / PBS çözeltisi kullanılarak canlı hücreler sayılır. </li></ol> Barsaklardan İntraepitelyal lenfositler ve Lamina Propria Hücreleri 3. İzolasyon <ol><li> Sağ anüs üzerinde, (yakın ekine) ileum ve tüm kolon duodenum dan (bir sonraki mide), adım 2.1 gibi karın cildi açın ince bağırsak kesti. Ekstra adipoz ve mezenterik doku kullanarak forseps çıkarın. buz soğukluğunda PBS hemen bağırsak koyun. </li><li> ince bağırsağın distal bölge boyunca Peyer yamaları (küçük, sert nodüller) arayın. forseps andopen makas kullanılarak uzunlamasına bağırsak kullanarak kitleleri çıkarın. İyice buz soğukluğunda 10 ml PBS ile bağırsak yıkayın. </li><li> Ön sindirim tamponu (5 mM EDTA, 20 ml doku inkübeve bir çalkalayıcı yavaş dönme (50 rpm) 37 ° C&#39;de 30 dakika boyunca Hank Dengeli Tuz Çözeltisi (HBSS)) içinde 1 mM ditiotreitol. 2 inkubasyon her birinden sonra, yoğun vorteks (12,000 rpm&#39;de 30 sn) tarafından, intraepitelyal lenfositler (IELS) içeren epitel hücre tabakasını kaldırmak ve 100 mikron hücre süzgecinden tüm dokuları geçmektedir. </li><li> 37 ° C&#39;de 30 dakika süre ile ikinci bir inkübasyon için dokuya yeni bir EDTA çözeltisi 20 ml ekleyin. 100 mikron hücre süzgecinden IEL kesirler geçirin ve önceki fraksiyonları ile havuz. buz üzerinde kalan bağırsak parçaları tutmak adım 3.9 tedavi edilmesi. </li><li> 4 ° C&#39;de 5 dakika boyunca 800 x g&#39;de toplanmış IEL fraksiyonlar santrifüjleyin. HBSS /% 5 FBS, 10 ml ile bir yerde toplanır IEL su fraksiyonları ile 800 x g&#39;de 5 dakika 4 ° C aşağı döndürün. </li><li> % 44 koloidal silis ortamı 15 8 mL hücrelerin tekrar ve 5 ml 67% koloidal silis ortamı ile kapla. % 44/67 santrifüjOda sıcaklığında 20 dakika 1500 x g .5% hücre karışımı gradyanı. </li><li> arayüzünde gruptan IEL hücreleri toplamak. İlk olarak, 1 mL pipet kullanılarak süpernatan (yaklaşık 5 mi) üst tabakayı kaldırmak. Sonra, kolloidal silika orta degrade interfaz hasat IELS. </li><li> RPMI ortamında 10 ml ekleyerek IELS yıkayın. 800 x g&#39;de 5 dakika ve 4 ° C hücreleri aşağı doğru döndürün. Adım 3.15 RPMI 5 ml IELS süspanse edin. </li><li> Lamina propriya lenfositlerinin izolasyonu (LPLs) için (1 mm) bir makas kullanılarak küçük parçalar halinde adım 3.4 bağırsak doku parçaları kıyma ve (kollajenaz 0.05 g, DNasel 0.05 g sindirim tamponu 10 ml parçalar sindirmek, ve 37 ° C&#39;de 15-20 dakika boyunca RPMI /% 5 FBS içinde dispase II) 0,3 gr. </li><li> 70 mikron hücre süzgecinden karışımı Filtre. akış süpernatant serbest LPL içerir. </li><li> Tamamen normal (adımları 3.9-3.10 tekrarlayarak bağırsak parçaları sindirmek, onlar olmalı) 3 kez tekrar edilmiştir. Her zaman, LPLs içeren süpernatantlar havuz. </li><li> 1,500 xg ve oda sıcaklığında 5 dakika boyunca santrifüj ile hücreler toplamak ve RPMI /% 5 FBS içinde tekrar süspansiyon pelet. 40 mikron hücre süzgecinden onları geçmek. </li><li> Bir 40:80 koloidal silis, orta gradyanı% 40 fraksiyonunun 10 ml hücre pelletleri yeniden süspanse edin ve 15 ml&#39;lik bir tüp içinde 80% fraksiyon 5 ml ile kapla. </li><li> 1,500 xg ve oda sıcaklığında 15 20 dakika boyunca santrifüj ile yoğunluk gradyan ayırma gerçekleştirir. </li><li> Adım 3.7&#39;de tarif edildiği gibi, LPLs toplayın. 10 ml PBS ile bir kez yıkayın ve PBS /% 1 FBS tampon ya da RPMI ortamı, 1 ml pelet tekrar süspansiyon. </li><li> % 0.4 tripan mavi boya / PBS çözeltisi kullanılarak canlı hücreleri (IELS ve LPLs ikisi) sayın. </li></ol> Kolit, IL-22-tdTomato 4. ekspresyonu <ol><li> 1 x 10 bir konsantrasyonda IL-22-tdTomato farelerden tek dalak hücre süspansiyonları hazırlamak &lt;destek&gt; 7 hücreleri adımda 2.1-2.4 tarif edildiği gibi steril PBS / ml. </li><li> Fare CD4 hücre Negatif İzolasyon yöntemi 10 kullanılarak CD4 + T hücreleri arındırmak. Ve anti-CD45RB-FITC (klon 16A (PBS /% 1 FBS tamponu içinde, klon RM4-5 0.5 ul / 1 x 10 6 hücre), anti-CD4-APC ile PBS içinde 0.5 ml / 1 x 10 6 hücre etiketlemek 30 dakika boyunca 4 ° C&#39;de inkübasyon ile /% 1 FBS tamponu). </li><li> 500 xg&#39;de 5 dakika ve 4 ° C hücreleri aşağı doğru döndürün. PBS /% 1 FBS tamponu, 2 ml hücreleri yıkayın ve PBS /% 1 FBS lekeleme tampon maddesi 1 ml bunları tekrar süspansiyon. </li><li> Makinenin 16 sitometri bir akış etiketli T hücrelerini çalıştırın. Kapısı T-hücre popülasyonu üzerindeki hücreler ve sıralama CD4 + CD45RB yüksek çift pozitif hücreler (488 nm ve 633 nm lazerler tespit dalga boyu). </li><li> 500 x g&#39;de 5 dakika 4 ° C&#39;de santrifüj ile kriteri hücreler hasat edilir. 1 x 10 6, steril PBS tamponunda yeniden süspanse hücre pelletleri </sup&gt; hücre / ml. / - - Alıcı fare Rag1 ¬ lerde periton içine hücreleri (0.5 x 10 6) enjekte edilir. </li><li> Çeşitli zaman noktalarında CO 2 altında alıcı fareler Kurban. adımlarda 2.1 ve 2.2 açıklandığı gibi, mezenterik lenf nodları ve küçük ve büyük bağırsakları hasat. dokuları düzeltmek için bir gecede, her mezenterik lenf düğümü koyun ve kesme açık bağırsağa (kağıt / bağırsak / kağıt sandviç)% 4 paraformaldehid (davlumbaz altında ele PFA). 16-24 saat süreyle% 18 sakaroz ile PFA değiştirin ve sonra kesit için dokular dondurma. </li><li> Doku 17, 18, 19 kesmek için kriyostat makinesi kullanın. yaklaşık 60 dakika boyunca oda sıcaklığına kadar doku bölümleri ısıtın ve oda sıcaklığında 10 dakika boyunca aseton içinde yerleştirin. yaklaşık olarak 5 dakika boyunca oda sıcaklığında kurumaya. </li><li> , Aşan FBS ekle pipet çıkarın ve 1 anti-RFP ekleyin: 200 seyreltme 0.1% BSA / 1x PBS. 60 dakika boyunca 37 ° C &#39;de antikor inkübe edin. </li><li> 10 dakika süre ile 1 x PBS bölümleri durulayın ve doku tekabül eden ikincil antikor (keçi anti-tavşan 568) uygulanır, suyla 1: 300,% 1 BSA / 1X PBS, oda sıcaklığında 30 dakika karıştırıldı. </li><li> 10 dakika 1x PBS slaytlar durulayın onları kuru silin ve lamelleri ekleyin. </li><li> 40X objektif kullanılarak: (uyarma filtresi 540-580 nm RFP) tutarlı aydınlatma altında bir floresan mikroskop ile tüm örnekleri gözünüzde canlandırın. </li></ol>

<ol>
	<li>Awasthi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+IL-23+receptor+gfp+reporter+mice+reveal+distinct+populations+of+IL-17-producing+cells.">Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells.</a> J Immunol. 182, 5904-5908 (2009).</li><li>Price, A. E., Reinhardt, R. L., Liang, H. E., Locksley, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marking+and+quantifying+IL-17A-producing+cells+in+vivo.">Marking and quantifying IL-17A-producing cells in vivo.</a> PLoS One. 7, e39750 (2012).</li><li>Kamanaka, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+interleukin-10+in+intestinal+lymphocytes+detected+by+an+interleukin-10+reporter+knockin+tiger+mouse.">Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.</a> Immunity. 25, 941-952 (2006).</li><li>Sonnenberg, G. F., Fouser, L. A., Artis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Border+patrol:+regulation+of+immunity,+inflammation+and+tissue+homeostasis+at+barrier+surfaces+by+IL-22.">Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22.</a> Nat Immunol. 12, 383-390 (2011).</li><li>Dumoutier, L., Louahed, J., Renauld, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+characterization+of+IL-10-related+T+cell-derived+inducible+factor+(IL-TIF),+a+novel+cytokine+structurally+related+to+IL-10+and+inducible+by+IL-9.">Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.</a> J Immunol. 164, 1814-1819 (2000).</li><li>Cella, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+natural+killer+cell+subset+provides+an+innate+source+of+IL-22+for+mucosal+immunity.">A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity.</a> Nature. 457, 722-725 (2009).</li><li>Sanos, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RORgammat+and+commensal+microflora+are+required+for+the+differentiation+of+mucosal+interleukin+22-producing+NKp46++cells.">RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells.</a> Nat Immunol. 10, 83-91 (2009).</li><li>Spits, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+lymphoid+cells--a+proposal+for+uniform+nomenclature.">Innate lymphoid cells--a proposal for uniform nomenclature.</a> Nat Rev Immunol. 13, 145-149 (2013).</li><li>Mazzucchelli, R. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+identification+of+IL-7+producing+cells+in+reporter+mice.">Visualization and identification of IL-7 producing cells in reporter mice.</a> PLoS One. 4, e7637 (2009).</li><li>Shen, W., Hixon, J. A., McLean, M. H., Li, W. Q., Durum, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22-Expressing+Murine+Lymphocytes+Display+Plasticity+and+Pathogenicity+in+Reporter+Mice.">IL-22-Expressing Murine Lymphocytes Display Plasticity and Pathogenicity in Reporter Mice.</a> Front Immunol. 6, 662 (2015).</li><li>Gong, S., Yang, X. W., Li, C., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+modification+of+bacterial+artificial+chromosomes+(BACs)+using+novel+shuttle+vectors+containing+the+R6Kgamma+origin+of+replication.">Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication.</a> Genome Res. 12, 1992-1998 (2002).</li><li>Shen, W., Huang, Y., Tang, Y., Liu, D. P., Liang, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+to+modify+BACs+to+generate+large+recombinant+DNA+fragments.">A general method to modify BACs to generate large recombinant DNA fragments.</a> Mol Biotechnol. 31, 181-186 (2005).</li><li>Cho, A., Haruyama, N., Kulkarni, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+mice.">Generation of transgenic mice.</a> Curr Protoc Cell Biol. Chapter. Chapter 19, Unit 19 11 (2009).</li><li>Danneman, P. J., Stein, S., Walshaw, S. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humane+and+practical+implications+of+using+carbon+dioxide+mixed+with+oxygen+for+anesthesia+or+euthanasia+of+rats.">Humane and practical implications of using carbon dioxide mixed with oxygen for anesthesia or euthanasia of rats.</a> Lab Anim Sci. 47, 376-385 (1997).</li><li>Omata, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+coccidian+enteroepithelial+stages+of+Toxoplasma+gondii+from+the+intestinal+mucosa+of+cats+by+Percoll+density-gradient+centrifugation.">Isolation of coccidian enteroepithelial stages of Toxoplasma gondii from the intestinal mucosa of cats by Percoll density-gradient centrifugation.</a> Parasitol Res. 83, 574-577 (1997).</li><li>Kumar, N., Borth, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-cytometry+and+cell+sorting:+an+efficient+approach+to+investigate+productivity+and+cell+physiology+in+mammalian+cell+factories.">Flow-cytometry and cell sorting: an efficient approach to investigate productivity and cell physiology in mammalian cell factories.</a> Methods. 56, 366-374 (2012).</li><li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> CSH Protoc. 2008, pdb.prot4991 (2008).</li><li>Hilbe, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+automated+cellular+imaging+system+and+manual+microscopy+for+immunohistochemically+stained+cryostat+sections+of+lung+cancer+specimens+applying+p53,+ki-67+and+p120.">Comparison of automated cellular imaging system and manual microscopy for immunohistochemically stained cryostat sections of lung cancer specimens applying p53, ki-67 and p120.</a> Oncol Rep. 10, 15-20 (2003).</li><li>Suzuki, Y., Furukawa, M., Abe, J., Kashiwagi, M., Hirose, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localization+of+porcine+trappin-2+(SKALP/elafin)+in+trachea+and+large+intestine+by+in+situ+hybridization+and+immunohistochemistry.">Localization of porcine trappin-2 (SKALP/elafin) in trachea and large intestine by in situ hybridization and immunohistochemistry.</a> Histochem Cell Biol. 114, 15-20 (2000).</li><li>Wolk, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+increases+the+innate+immunity+of+tissues.">IL-22 increases the innate immunity of tissues.</a> Immunity. 21, 241-254 (2004).</li><li>Brand, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+is+increased+in+active+Crohn's+disease+and+promotes+proinflammatory+gene+expression+and+intestinal+epithelial+cell+migration.">IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration.</a> Am J Physiol Gastrointest Liver Physiol. 290, G827-G838 (2006).</li><li>Nagalakshmi, M. L., Rascle, A., Zurawski, S., Menon, S., Waal Malefyt, d. e., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22+activates+STAT3+and+induces+IL-10+by+colon+epithelial+cells.">Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.</a> Int Immunopharmacol. 4, 679-691 (2004).</li><li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Andoh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22,+a+member+of+the+IL-10+subfamily,+induces+inflammatory+responses+in+colonic+subepithelial+myofibroblasts.">Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts.</a> Gastroenterology. 129, 969-984 (2005).</li><li>Bhan, A. K., Mizoguchi, E., Smith, R. N., Mizoguchi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colitis+in+transgenic+and+knockout+animals+as+models+of+human+inflammatory+bowel+disease.">Colitis in transgenic and knockout animals as models of human inflammatory bowel disease.</a> Immunol Rev. 169, 195-207 (1999).</li><li>Mombaerts, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+development+of+inflammatory+bowel+disease+in+T+cell+receptor+mutant+mice.">Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice.</a> Cell. 75, 274-282 (1993).</li><li>Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+regulation+in+the+intestine:+a+balancing+act+between+effector+and+regulatory+T+cell+responses.">Immune regulation in the intestine: a balancing act between effector and regulatory T cell responses.</a> Ann N Y Acad Sci. 1029, 132-141 (2004).</li><li>Ahlfors, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+fate+reporter+reveals+origin+and+control+of+IL-22+production+in+homeostasis+and+infection.">IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection.</a> J Immunol. 193, 4602-4613 (2014).</li></ol>

The authors have nothing to disclose.

IL-22 doğal konukçu savunma ve dokuların yeniden yapılandırılmasında önemli bir rol oynar. IL-22 üreten hücreler hücre içi boyama ile ex vivo olarak tespit edilmiştir. Ancak, hala normal durumda ya da iltihabi durumların ya, in situ, IL-22 ifadesini izlemek için zordur. Bu protokol, in vivo olarak raportör-ifade eden hücreleri lokalize sağlıyor bir IL-22 raportör fare modeli geliştirmek için yeni bir metot açıklanır. haberci gen kodlayan tdTomato sinyal dizisini bozan bir bölgede IL-22 lokusuna sokulmuştur. muhabir Bu strateji sonuçları üreten hücre görselleştirme sağlayan IL-22 hızlı salgılanır aksine, üreten hücreye hapsolmak. işlenmiş IL-22-haberci Bu itibarla düzenleyici elemanlar koruyucu IL-22&#39;nin karşılık gelen raportör ekspresyonu doğruluğunu kazandırma amacı ile büyük bir BAC depolandığı. Transgenik m intestinal dokularBuz ince bağırsağın lamina propria CD4 T hücreleri ve doğal lenfositlerde homeostatik muhabir ifadesini sergiledi. uyarılan kolit olarak, CD4 T hücreleri kolonda muhabir ifade etti. enflamatuar bağırsak hastalığı, IL-22 rolü açık olmuştur. Bağırsak mukoza savunma ve doku rejenerasyonu katılarak, IL-22, 22 her ikisi de, koruyucu 20 üretimini 21 ortaya çıkarma yeteneğine sahiptir ve proinflamatuar medyatörler (örneğin, IL-8) 23, 24. - / - Farelerde 25, 26 ve CD45RB aktarım modeli 27, T hücresi kaynaklı kolit iki model TCR a dahil olmak üzere, kolon, IL-22 artış göstermiştir. enflamatuar barsak hastalığı modelini karşılaştırarak, bağırsak, IL-22 ekspresyonu, bir Cr yüksekti- / - ülseratif kolit 21, 24 .Here modelinde Ohn hastalığı modelthan biz Rag1 içine bildirici farelerden CD4CD45RBhi T hücreleri transferi alıcıları ve Crohn hastalığı patojenik işlemini taklit eder. Bu kolit öncesinde, IL-22 muhabir bağırsak lenf düğümlerinden (MLN) &#39;de görselleştirilmiştir tespit etmiştir. sinyaller daha sonra MLN azaldı ve kolit gelişimi ile, bağırsaklar, özellikle distal ince bağırsaklar ve iki nokta üst üste taşındı. Çoğu tdTomato gazetecilere bağırsak lamina propria mukozasına içinde lokalize edildi. IL-22 için muhabir farklı bir türü, daha önce burada hücrelerin kalıcı olarak ve kız 28 devam eden IL-22 transkripsiyonu olsun ya da olmasın, muhabir ifade etmeye devam şekilde işaretlenmiştir, tarif edilmiştir. Çalışmamızda, gut doğuştan lenfositler gibi kolitte, t homeostatik koşullarda işaretlenen veO Reporter bağırsak dokusuna mezenterik lenf düğümleri T hücrelerinde tespit edildi. Bu protokol açıklanan prosedürler vb gibi IL-17, IL-25 gibi diğer transgen muhabiri farelerin, kurulması için geçerli olacak ve. transgenlerin rasgele fare genomuna entegre edilmektedir Bununla birlikte, haberci gen ekspresyonunun kalitesini sağlamak için uzak düzenleyici elementler taşıyan uygun bir BAC klonları seçmek çok önemlidir. Bildirici fare in vivo, hem de canlı hücreler saflaştırılması ve karakterizasyonu için ifade eden hücrelerin tanımlanmasına izin verir. Biz, canlı hayvan görüntüleme çalışmaları için muhabir uygun hale getirmek için bir floresan raportör gen olarak, tdTomato, son derece parlak kırmızı floresan proteini kullanılmıştır.

haberci genlerin hücre tipi spesifik ifade aktif homeostatik ve tedirgin halleri altında dokularda hedef ifade eden hücreleri belirlemek için yararlıdır. Bu ayrıca diğer özelliklerini incelemek için, canlı kalır, bu hücrelerin, saflaştırılması için izin verir. Raportör farenin özgü sitokinlerin transkripsiyon faktörleri ve düzenleyici elemanlar için eylem mekanizmasını açıklamaya kullanılabilecektir. Önceki stratejiler 1, 2, 3, büyük ölçüde fare kromozomu, zaman alıcı ve masraflı prosedürde hedef yörüngesi içine muhabiri vurma yararlanmıştır. Bu nedenle, raportör farelerin üretimi için daha basit bir yönteme ihtiyaç vardır. Sitokinler hücrelerarası sinyalizasyon ile immün yanıtları düzenleyen küçük, salgılanan proteinler / peptidlerin geniş bir sınıfıdır. İnterlökin 22 (IL-22), birçok ile sitokin bariyer fu dahil aktiviteler bildirilmiştirnction, doku tamiri ve inflamasyon 4. IL-22 ilk olarak bir T-hücre ürün 5 ile tespit edilmiştir, ancak, daha sonra rapor insanlarda 6 ve fareler 7 ve doğuştan gelen lenfositlerin 8 diğer sınıfları doğal öldürücü (NK) hücreleri içinde ekspresyonu gösterdi. Antikorlarla lekelere IL-22, daha önce gerekli olan ex vivo stimülasyonu ve geçirgenliği ve geniş bir IL-22 üreten hücrelerin gözlem, görselleştirme rağmen. Bu nedenle, yeni IL-22 raportör fareler homeostatik ve patojenik süreçlerde IL-22 fonksiyonunu araştırmak için çok yararlı bir araç olacaktır. Burada, in vivo ve in vitro olarak IL-22 üreten hücreleri gözlemlemek için basitleştirilmiş bir transgenik raportör fare modeli geliştirilmiştir. BAC Recombineering yöntemi 9 kullanarak, IL-22 loc olarak Poli A sinyal parçalarını tdTomato cDNA dizisini takılıUS ve mümkün olduğu kadar IL-22 doğal düzenleme taklit mi zira diğer dönüştürülmemiş bölgeleri, eksonlan ve düzenleyici elemanları, tedirgin değil ekson 1 yerini aldı. bildirici ekleme yeri IL-22 kendisi hızlı bir şekilde salgılanır aksine üreten hücrelerin içindeki muhabir birikmesine yol açar, sinyal dizisini bozar. Bu yeni yöntem, diğer salgılanan proteinler için haberci farelerin üretimi için uygulanabilir.

<table><tbody><tr><td>RP23-401E11 BAC</td><td>Thermo Fisher Scientific</td><td>RPCI23.C</td><td>Need gene ID: 50929</td></tr><tr><td>NucleoBond BAC 100</td><td>Takara Clontech</td><td>740579</td><td></td></tr><tr><td>PCR SuperMix High Fidelity</td><td>Thermo Fisher Scientific</td><td>10790020</td><td></td></tr><tr><td>PI-SceI</td><td>New England Biolabs</td><td>R0696S</td><td></td></tr><tr><td>SpeI</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>LB Broth</td><td>Thermo Fisher Scientific</td><td>10855-001</td><td>1 L: 10 g SELECT Peptone 140, 5 g SELECT Yeast Extract, 5 g sodium chloride&amp;nbsp;</td></tr><tr><td>Anti-mouse CD3</td><td>eBioscience</td><td>11-0031</td><td></td></tr><tr><td>Anti-mouse CD4</td><td>eBioscience</td><td>17-0041</td><td></td></tr><tr><td>Anti-mouse CD45</td><td>Thermo Fisher Scientific</td><td>MCD4530</td><td></td></tr><tr><td>Anti-mouse CD45RB</td><td>eBioscience</td><td>11-0455</td><td></td></tr><tr><td>Anti-mouse RFP</td><td>Abcam</td><td>Ab62341</td><td></td></tr><tr><td>HBSS, no calcium, no magnesium, no phenol red</td><td>Thermo Fisher Scientific</td><td>14175145</td><td>KCl, KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;, Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;, NaHCO&lt;sub&gt;3&lt;/sub&gt;, NaCl, D-Glucose</td></tr><tr><td>Dnase I</td><td>Roche</td><td>10104159001</td><td></td></tr><tr><td>ACK lysing buffer</td><td>Thermo Fisher Scientific</td><td>A1049201</td><td></td></tr><tr><td>Percoll</td><td>GE healthcare life sciences</td><td>17-0891-01</td><td></td></tr><tr><td>Collagenase D</td><td>Roche</td><td>11088858001</td><td></td></tr><tr><td>Dispase II (neutral protease, grade II)</td><td>Roche</td><td>4942078001</td><td></td></tr><tr><td>IX70 inverted fluorescence microscope</td><td>Olympus</td><td></td><td>Ask for quote</td></tr><tr><td>Nikon Eclipse 80i microscope</td><td>Nikon</td><td></td><td>Ask for quote</td></tr><tr><td>Dynal shaker</td><td>Electron Microscopy Science</td><td>61050-10</td><td></td></tr><tr><td>FACSAria</td><td>BD Bioscience</td><td></td><td>Ask for quote</td></tr><tr><td>LSRII SORP/flow cytometry</td><td>Becton, Dickinson and Company&amp;nbsp;</td><td></td><td>Ask for quote</td></tr></tbody></table>

visualization of il-22-expressing lymphocytes using reporter mice

Raportör farenin geniş hedef genlerin ekspresyonu lokalizasyonunu gözlemlemek için kullanılmıştır. Bu protokol, yeni bir transgenik muhabiri fare modeli kurmak için bir strateji üzerinde duruluyor. Biz bu sitokin inflamasyon ile hasarlı dokuların tamir katkıda bağırsak, önemli etkinlikleri de olduğundan interlökin (IL) 22 gen ifadesini görselleştirmek için seçti. Haberci sistemler arasında, in vivo olarak ürünlerin belirlenmesi için diğer yöntemlere göre önemli avantajlar sunmaktadır. IL-22 olması durumunda, diğer çalışmalar, ilk doku hücreleri izole olan ve daha sonra in vitro olarak hücrelerin yeniden uyarılır. IL-22, normal olarak salgılanır, bir ilaç ile hücre içinde sıkışıp edildi ve hücre içi boyama görselleştirmek için kullanılmıştır. Bu yöntem, IL-22 üretebilen hücreleri tanımlayan, ancak in vivo olarak bunu yaparken olup olmadığını o karar vermez. raportör tasarımı, WA, IL-22 geni bir floresan proteini (tdTomato) bir gen sokulması içerirfloresan protein nedenle salgılanır ve edilemez Y in vivo üreten hücrelerin içinde sıkışıp kalmaktadır. Floresan üretici daha sonra doku kesitlerine ya da akış sitometrisi ile ex vivo olarak analiz ile görselleştirilebilir. muhabir gerçek inşaat süreci, IL-22 geni içeren bir bakteriyel yapay kromozom Recombineering dahil. Bu işlenmiş kromozom sonra fare genomu içine verilmiştir. Homeostatik IL-22 raportör ekspresyonu Akışkan sitometri analizi ile dalak, timus, lenf düğümleri, Peyer ve bağırsak dahil olmak üzere, farklı fare dokularda gözlenmiştir. Kolit T hücresi (CD4 + CD45RBhigh) transferiyle uyarılır, ve raportör ekspresyonu gözlendi. Pozitif T hücreleri mezenterik lenf düğümleri ilk mevcuttu, ve sonra onlar distal ince bağırsak ve kolon dokularının lamina propria içinde birikmiş. BAC&#39;ler kullanarak strateji, IL-22 Expres kıyasla iyi sadakat muhabiri ifade verdision ve knock-in prosedürleri daha basittir.

Bir murin IL-22 raportör transgen IL-22 yerini taşıyan bakteriyel suni bir kromozom değiştirmek için Recombineering kullanılarak oluşturuldu. Şekil 1 sacBII geni, bir pozitif seçim markeri ve kloramfenikol antibiyotik dirençli bir gen ihtiva eden 11 pBACe3.6 vektörünün bir diyagramını göstermektedir. Şekil 2&#39;de gösterildiği gibi, ekson 1 içine tdTomato sokulması sonra, sinyal peptid dizisi, kesintiye uğramıştır. Bu nedenle, tdTomato raportör akış sitometrisi ile kendi tespit ve izole edebilecek, IL-22 eksprese eden hücreler içinde sıkışıp oldu. homozigot fare kurucusu hatlarından yetiştirilmiş ve PCR ile taranmıştır ve her zamanki knock-in stratejisinde gerekli olduğu gibi bu, genetik kimliğiyle yavrular elde etmek için geri-melezleme gerektirmeyen edildi. IL-22 muhabir kalitesini test etmek için in vitro -generated splenositler Th22 ya da nötr koşullar altında kültürlenmiştir. <strong&gt; Şekil 3, IL-22-tdTomato de in vitro olarak Th22 hücrelerinde ifade olduğunu göstermektedir, ya da akış sitometrisi veya flüoresans mikroskopisi ile tespit edilir. Şekil 4&#39;te gösterildiği gibi, in vivo, IL-22 raportör homeostatik koşullar altında, farklı fare dokularda tespit edilmiştir. tdTomato sinyalinin en bağırsaktan değil koltuk altı lenf düğümü (ALN), dalak ya da timüste lamina propriya (LP) hücrelerinde bulunmuştur. - / - Farelerde iltihaplı dokuda tdTomato raportör görselleştirmek için, Rag1 içine bildirici CD4 + CD45Rb&#39;si yüksek T hücrelerinin transferiyle yaratılır fare kolit modeli kullanılmıştır. Şekil 5 gazetecilere ilk mezenterik lenf düğümleri bulunan ve daha sonra distal ince bağırsak ve kolon dokularının lamina propria içinde biriken olduğunu göstermektedir. Birlikte ele alındığında, IL-22 raportör farelerin üretimi için yeni bir yöntem, etkili ve zaman tasarrufu. Şekil 1: pBACe3.6 vektörü Site haritası. pBACe3.6 kloramfenikol antibiyotik direnci ve pozitif seçim markeri olarak bir sacBII genini ihtiva etmesiyle karakterize edilir. rekombinasyon sırasında arzu edilen klonlar, sükroz dayanıklı kendi sacBII genini ifade eden ve negatif BAC kolonileri sükroz duyarlı ise, sükroz içeren ortama büyümeye izin verilir yoluyla uygulanır. <img alt="şekil 2" src="/files/ftp_upload/54710/54710fig2.jpg" /> Şekil 2: modifiye RP23-401E11 BAC klon şematik görünümü. Bir tdTomato raportör gen Recombineering teknolojisi kullanılarak, bir murin bakteriyel yapay kromozom (BAC RP23-401E11), IL-22 ve düzenleyici elemanları içeren IL-22 mahaline, sokuldu. Homolog rekombinasyon yoluyla, IL-22, sinyal peptidinin sekansı<html> BAC bozulduğu ve ekzon IL-22 1 tdTomato raportör geni ile değiştirildi. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/54710/54710fig3.jpg" /> Şekil 3: splenositler, IL-22 muhabir tanımlanması in vitro kültürlenmiştir. CD4 T hücrelerinin dalak saflaştırılmış ve daha sonra anti-CD28 ile uyarıldı; Anti-CD3 (nötr durumu); 5 gün veya anti-CD3, anti-CD28, anti-IFNƳ, anti-IL-4, IL-6, TGF-β, ve 6-Formylindolo (3,2-b) karbazol (FICZ). (100 mikron alt iki, ölçek çubuğu), IL-22-tdTomato akışı (iki üst) sitometrili ve floresan mikroskopisi ile analiz edilmiştir. Çeyrek sayılar CD45 + hücrelerinin yüzdesi göstermektedir.target = &quot;_ blank&quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız. <img alt="Şekil 4," src="/files/ftp_upload/54710/54710fig4.jpg" /> Şekil 4: farklı fare doku hücreleri, IL-22 üreten görselleştirilmesi. Tek hücre süspansiyonları, dalak, timus, lenf düğümleri, bağırsak (IEL ve LP) ve Peyer hazırlandı. Daha sonra, FITC-anti-CD3 ile yüzey boyanarak tdTomato ifadesi için incelendi. MLN: mezenterik lenf nodu, ALN: aksiller lenf nodu, PP: Peyer, IEL: ince bağırsak izole intraepitelyal hücreler, LP: lamina propria hücreleri ince bağırsakta arınmış. Çeyrek sayılar CD45 + hücrelerinin yüzdesi göstermektedir. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> Şekil 5: T-hücresi transfer kolit geliştirilmesi sırasında IL-22 muhabir lokalizasyonu. kolitin gelişimi sırasında farklı zaman noktalarında farklı dokularda immünohistokimya ile fareler ve tdTomato sinyalleri değerlendirildi - / - IL-22 raportör farelerden CD4CD45RBHigh T hücreleri Rag1 aktarılmıştır. Oklar, IL-22-tdTomato sinyallerinin işaret etmektedir. Ölçek çubukları 25 mikron =. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54710/54710fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

Raportör fareler kullanılarak IL-22 eksprese eden lenfositlerin Görselleştirme

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

visualization-of-il-22-expressing-lymphocytes-using-reporter-mice

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

8.7K Görüntüleme.  National Cancer Institute, National Institutes of Health. We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse. 

Video: Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Detection and Isolation of Viable Mouse IL-17-Secreting T Cells

The MACS Cytokine Secretion Assay technology allows detection of secreted cytokines on the single cell level and sensitive isolation of viable cytokine-secreting cells. In order to label IL-17-secreting cells, a single cell suspension of mouse splenocytes is prepared and stimulated at 37&deg;C with PMA/ionomycin to induce cytokine secretion. To stop secretion cells are then placed on ice and are exposed to the IL-17 Catch Reagent   a bi-specific antibody that binds to CD45 on the cell surface of leukocytes and to IL-17 as it is secreted and caught near the cell surface. Secretion is then re-started by increasing the temperature to 37&deg;C and IL-17 is trapped by the Catch Reagent. Secretion is then stopped again, by placing cells on ice. To detect the trapped IL-17, cells are incubated with a second IL-17-specific antibody conjugated to biotin and an Anti-Biotin-PE antibody. Cells can now be directly analyzed by flow cytometry or prepared for isolation and enrichment by subsequent labeling with Anti-PE conjugated MicroBeads.

This procedure describes the detection and isolation of mouse TH17 leukocytes that actively secrete IL-17 upon stimulation.

Canlı Fare IL-17 salgılayan T Hücreler Algılama ve İzolasyonu

The MACS Cytokine Secretion Assay technology allows detection of secreted cytokines on the single cell level and sensitive isolation of viable ...

Biyoloji

Long Term Intravital Multiphoton Microscopy Imaging of Immune Cells in Healthy and Diseased Liver Using CXCR6.Gfp Reporter Mice

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, neutrophils, T cell subsets, B cells, natural killer (NK) and NKT cells. Intravital microscopy of the liver for monitoring immune cell migration is particularly challenging due to the high requirements regarding sample preparation and fixation, optical resolution and long-term animal survival. Yet, the dynamics of inflammatory processes as well as cellular interaction studies could provide critical information to better understand the initiation, progression and regression of inflammatory liver disease. Therefore, a highly sensitive and reliable method was established to study migration and cell-cell-interactions of different immune cells in mouse liver over long periods (about 6 hr) by intravital two-photon laser scanning microscopy (TPLSM) in combination with intensive care monitoring.
The method provided includes a gentle preparation and stable fixation of the liver with minimal perturbation of the organ; long term intravital imaging using multicolor multiphoton microscopy with virtually no photobleaching or phototoxic effects over a time period of up to 6 hr, allowing tracking of specific leukocyte subsets; and stable imaging conditions due to extensive monitoring of mouse vital parameters and stabilization of circulation, temperature and gas exchange.
To investigate lymphocyte migration upon liver inflammation CXCR6.gfp knock-in mice were subjected to intravital liver imaging under baseline conditions and after acute and chronic liver damage induced by intraperitoneal injection(s) of carbon tetrachloride (CCl4).
CXCR6 is a chemokine receptor expressed on lymphocytes, mainly on Natural Killer T (NKT)-, Natural Killer (NK)- and subsets of T lymphocytes such as CD4 T cells but also mucosal associated invariant (MAIT) T cells1. Following the migratory pattern and positioning of CXCR6.gfp+ immune cells allowed a detailed insight into their altered behavior upon liver injury and therefore their potential involvement in disease progression.

Stable intravital high-resolution imaging of immune cells in the liver is challenging. Here we provide a highly sensitive and reliable method to study migration and cell-cell-interactions of immune cells in mouse liver over long periods (about 6 hours) by intravital multiphoton laser scanning microscopy in combination with intensive care monitoring.

CXCR6.Gfp Muhabir Fare kullanma Sağlıklı ve hastalıklı Karaciğer Bağışıklık Hücreleri Uzun Vadeli intravital multiphoton Mikroskopi Görüntüleme

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, ...

İmmünoloji ve Enfeksiyon

Intravital Imaging of Neutrophil Priming Using IL-1&#946; Promoter-driven DsRed Reporter Mice

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that enhances the phagocytic functionality of neutrophils. Although extensive studies have unveiled the existence and importance of neutrophil priming during infection and injury, means of visualizing this process in vivo have been unavailable. The protocol provided enables monitoring of the dynamic process of neutrophil priming in living animals by combining three methodologies: 1) DsRed reporter signal &#8212; used as a measure of priming 2) in vivo neutrophil labeling &#8212; achieved by injection of fluorescence-conjugated anti-lymphocyte antigen 6G (Ly6G) monoclonal antibody (mAb) and 3) intravital confocal imaging. Several critical steps are involved in this protocol: oxazolone-induced mouse ear skin inflammation, appropriate sedation of animals, repeated injections of anti-Ly6G mAb, and prevention of focus drift during imaging. Although a few limitations have been observed, such as the limit of continuous imaging time (~ 8 hr) in one mouse and the leakage of fluorescein isothiocyanate-dextran from blood vessels in the inflammatory state, this protocol provides a fundamental framework for intravital imaging of primed neutrophil behavior and function, which can easily be expanded to examination of other immune cells in mouse inflammation models.

This current protocol employs fluorescent reporters, in vivo labeling, and intravital imaging techniques to enable monitoring of the dynamic process of neutrophil priming in living animals.

IL-1β Promoter odaklı DsRed Muhabir Fare kullanma Nötrofil Hazırlama intravital Görüntüleme

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that ...

Phenotypic and Functional Analysis of Activated Regulatory T Cells Isolated from Chronic Lymphocytic Choriomeningitis Virus-infected Mice

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance and homeostasis maintenance by regulating the immune response. The primary role of Treg cells is to suppress the proliferation of effector T (Teff) cells and the production of cytokines such as IFN-&#947;, TNF-&#945;, and IL-2. It has been demonstrated that Treg cells&#39; ability to inhibit the function of Teff cells is enhanced during persistent pathogen infection and cancer development. To clarify the function of Treg cells under resting or inflamed conditions, a variety of in vitro suppression assays using mouse or human Treg cells have been devised. The main aim of this study is to develop a method to compare the differences in phenotype and suppressive function between resting and activated Treg cells. To isolate activated Treg cells, mice were infected with lymphocytic choriomeningitis virus (LCMV) clone 13 (CL13), a chronic strain of LCMV. Treg cells isolated from the spleen of LCMV CL13-infected mice exhibited both the activated phenotype and enhanced suppressive activity compared with resting Treg cells isolated from na&#239;ve mice. Here, we describe the basic protocol for ex vivo phenotype analysis to distinguish activated Treg cells from resting Treg cells. Furthermore, we describe a protocol for the measurement of the suppressive activity of fully activated Treg cells.

Here, we describe a protocol to analyze the phenotype of regulatory T (Treg) cells isolated from na&#239;ve and chronic lymphocytic choriomeningitis virus-infected mice. In addition, we provide a process to evaluate the suppressive activity of the Treg cells.

Fenotipik ve Kronik Lenfositik koryomenenjit Virüs ile enfekte Fare İzole Aktif Düzenleyici T hücrelerinin Fonksiyonel Analiz

Regulatory T (Treg) cells, which express Foxp3 as a transcription factor, are subsets of CD4+ T cells. Treg cells play crucial roles in immune tolerance ...

Isolation and Activation of Murine Lymphocytes

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading pathogen1,2. Understandably, such intricate abilities are controlled by a large number of molecules involved in various cellular processes to ensure timely and spatially regulated immune responses3. Here, we describe experimental procedures that allow rapid isolation of highly purified murine lymphocytes using magnetic cell sorting technology. The resulting purified lymphocytes can then be subjected to various in vitro or in vivo functional assays, such as the determination of lymphocyte signaling capacity upon stimulation by immunoblotting4 and the investigation of proliferative abilities by 3H-thymidine incorporation or carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling5-7. In addition to comparing the functional capacities of control and genetically modified lymphocytes, we can also determine the T cell stimulatory capacity of antigen-presenting cells (APCs) in vivo, as shown in our representative results using transplanted CFSE-labeled OT-I T cells.

Lymphocytes are the major players in adaptive immune responses. Here, we present a lymphocyte purification protocol to determine the physiological functions of the desired molecules in lymphocyte activation in vitro and in vivo. The described experimental procedures are suitable for comparing functional capacities between control and genetically modified lymphocytes.

İzolasyon ve murin lenfositlerin aktivasyonu

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading ...

An IL-8 Transiently Transgenized Mouse Model for the In Vivo Long-term Monitoring of Inflammatory Responses

Airway inflammation is often associated with bacterial infections and represents a major determinant of lung disease. The in vivo determination of the pro-inflammatory capabilities of various factors is challenging and requires terminal procedures, such as bronchoalveolar lavage and the removal of lungs for in situ analysis, precluding longitudinal visualization in the same mouse. Here, lung inflammation is induced through the intratracheal instillation of Pseudomonas aeruginosa culture supernatant (SN) in transiently transgenized mice expressing the luciferase reporter gene under the control of a heterologous IL-8 bovine promoter. Luciferase expression in the lung is monitored by in vivo bioluminescent image (BLI) analysis over a 2.5- to 48-h timeframe following the instillation. The procedure can be repeated multiple times within 2 - 3 months, thus permitting the evaluation of the inflammatory response in the same mice without the need to terminate the animals. This approach permits the monitoring of pro- and anti-inflammatory factors acting in the lung in real time and appears suitable for functional and pharmacological studies.

An IL-8 Transiently Transgenized Mouse Model for the In Vivo Long-term Monitoring of Inflammatory Responses

The method described here allows for the visualization of IL-8 promoter-dependent inflammation activation in the lungs of mice through non-invasive bioluminescence imaging (BLI). The same animal can be subjected to BLI multiple times for up to two months from the time of delivery of the luciferase reporter construct.

Bir IL-8 Geçici Transgenize Edilmiş Fare Modeli<emIn vivo</em&gt; İnflamatuvar Yanıtların Uzun Vadeli İzlenmesi

Airway inflammation is often associated with bacterial infections and represents a major determinant of lung disease. The in vivo determination of the ...

Imaging of In Situ Interferon Gamma Production in the Mouse Spleen following Listeria monocytogenes Infection

Cytokines are small proteins secreted by cells, mediating cell-cell communications that are crucial for effective immune responses. One characteristic of cytokines is their pleiotropism, as they are produced by and can affect a multitude of cell types. As such, it is important to understand not only which cells are producing cytokines, but also in which environment they do so, in order to define more specific therapeutics. Here, we describe a method to visualize cytokine production in situ following bacterial infection. This technique relies on imaging cytokine-producing cells in their native environment by confocal microscopy. To do so, tissue sections are stained for markers of multiple cell types together with a cytokine stain. Key to this method, cytokine secretion is blocked directly in vivo before harvesting the tissue of interest, allowing for detection of the cytokine that accumulated inside the producing cells. The advantages of this method are multiple. First, the microenvironment in which cytokines are produced is preserved, which could ultimately inform on the signals required for cytokine production and the cells affected by those cytokines. In addition, this method gives an indication of the location of the cytokine production in vivo, as it does not rely on artificial in vitro re-stimulation of the producing cells. However, it is not possible to simultaneously analyze cytokine downstream signaling in cells that receive the cytokine. Similarly, the cytokine signals observed correspond&#160;only to the time-window during which cytokine secretion was blocked. While we describe the visualization of the cytokine Interferon (IFN) gamma in the spleen following mouse infection by the intracellular bacteria Listeria monocytogenes, this method could potentially be adapted to the visualization of any cytokine in most organs.

Imaging of In Situ Interferon Gamma Production in the Mouse Spleen following Listeria monocytogenes Infection

Here, we describe a simple confocal imaging method to visualize the in situ localization of cells secreting the cytokine Interferon gamma in murine secondary lymphoid organs. This protocol can be extended for the visualization of other cytokines in diverse tissues.

Listeria monocytogenes enfeksiyonu sonrasında Mouse dalağında In situ Interferon gama üretiminin görüntülenmesi

Cytokines are small proteins secreted by cells, mediating cell-cell communications that are crucial for effective immune responses. One characteristic of ...

Intravital Imaging of Intraepithelial Lymphocytes in Murine Small Intestine

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal epithelium. Due in part to the lack of a definitive ligand for the &#947;&#948; T cell receptor, our understanding of the regulation of &#947;&#948; IEL activation and their function in vivo remains limited. This necessitates the development of alternative strategies to interrogate signaling pathways involved in regulating &#947;&#948; IEL function and the responsiveness of these cells to the local microenvironment. Although &#947;&#948; IELs are widely understood to limit pathogen translocation, the use of intravital imaging has been critical to understanding the spatiotemporal dynamics of IEL/epithelial interactions at steady-state and in response to invasive pathogens. Herein, we present a protocol for visualizing IEL migratory behavior in the small intestinal mucosa of a GFP &#947;&#948; T cell reporter mouse using inverted spinning disk confocal laser microscopy. Although the maximum imaging depth of this approach is limited relative to the use of two-photon laser-scanning microscopy, spinning disk confocal laser microscopy provides the advantage of high speed image acquisition with reduced photobleaching and photodamage. Using 4D image analysis software, T cell surveillance behavior and their interactions with neighboring cells can be analyzed following experimental manipulation to provide additional insight into IEL activation and function within the intestinal mucosa.

We describe a method to visualize GFP-labeled &#947;&#948; IELs using intravital imaging of murine small intestine by inverted spinning disk confocal microscopy. This technique enables the tracking of live cells within the mucosa for up to 4 h and can be used to investigate a variety of intestinal immune-epithelial interactions. &#160;

Murine Ince bağırsak INTRAEPİTELYAL lenfosit intravital görüntüleme

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal ...

Isolation of Group 2 Innate Lymphoid Cells from Mouse Nasal Mucosa to Detect the Expression of CD226

With abundant research on group 2 innate lymphoid cells (ILC2s) published over the years, ILC2s are widely known to be implicated in regulating various pathological processes, including anti-helminth immunity, tissue repair, thermogenesis, and autoimmune diseases such as asthma and allergic rhinitis (AR). ILC2s permanently reside in peripheral tissues such as the skin, gut, lungs, and nasal cavity; however, there is limited information about their exact functions in nasal mucosal immunity. CD226 is an activating costimulatory molecule, mainly expressed on natural killer (NK) cells, T cells, and inflammatory monocytes. However, whether ILC2s express CD226 or play a role in the pathogenesis of ILC2s-related diseases remains unknown. Here, we established a method to isolate and identify ILC2s from the nasal mucosa and detected CD226 expression on ILC2s obtained from healthy and AR mice. Herein, we describe this protocol for the isolation and identification of ILC2s from mouse nasal mucosa, which will help explore the internal pathological mechanism of immunological disorders in nasal mucosal diseases.

Group 2 innate lymphoid cells (ILC2s), implicated in type 2 inflammation, mainly participate in response to helminth infection, allergic diseases, metabolic homeostasis, and tissue repair. In this study, a procedure to isolate ILC2s from murine nasal mucosa and detect the expression of CD226 is demonstrated.

CD226 Ekspresyonunu Saptamak için Grup 2 Doğuştan Gelen Lenfoid Hücrelerin Fare Burun Mukozasından İzolasyonu

With abundant research on group 2 innate lymphoid cells (ILC2s) published over the years, ILC2s are widely known to be implicated in regulating various ...

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response against helminth infections, where it plays an important role in the expulsion of the parasite. In a murine model of Nippostrongylus brasiliensis infection, IL-9 is produced mainly by CD4+ T lymphocytes and innate lymphoid cells found in the lung, small intestine, and draining lymph nodes. Given the technical difficulties involved in the intracellular staining of IL-9, as well as the complexity of isolating hematopoietic cells from the small intestine upon infection, there is a pressing need for a comprehensive but straightforward protocol to analyze the expression of IL-9 in different lymphoid and non-lymphoid tissues in this model. The protocol described here outlines the kinetics of IL-9 produced by CD4+ T cells and innate lymphoid cells in the lung and small intestine, the main organs targeted by N. brasiliensis, as well as in the mediastinal and mesenteric lymph nodes, throughout the infection. In addition, it details the number of larvae needed for infection, depending on the cell type and organ of interest. This protocol aims to assist in the standardization of assays to save time and resources by offering the opportunity to focus on the specific cells, organs, and disease stages of interest in the N. brasiliensis infection model.

A Strategy for the Study of IL-9-Producing Lymphoid Cells in the Nippostrongylus brasiliensis Infection Model

IL-9-expressing T and ILC2 cells are induced during N. brasiliensis infection, yet their characterization has been largely overlooked in the infected intestine due to their low frequency and differential kinetics. This protocol describes the isolation of these cells from different target organs and confirmation of their identity via flow cytometry at different infection stages.

Nippostrongylus brasiliensis Enfeksiyon Modelinde IL-9 Üreten Lenfoid Hücrelerin İncelenmesi İçin Bir Strateji

IL-9 is a pleiotropic cytokine associated with various processes, including antitumor immunity, induction of allergic pathologies, and the immune response ...