Name: hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples
Uploaded: 2016-11-23T15:00:00.000+00:00
Duration: 9 min 38 s
Description: Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

1. Fixation and Embedding
<ol>
	<li>Reagent preparation
	<ol>
		<li>10x Phosphate-buffered saline (PBS)
		<ol>
			<li>Add 80 g NaCl, 2 g KCl, 14.4 g Na2HPO4, and 2.4 g KH2PO4 in 800 ml double distilled water (ddH2O) and adjust the pH to 7.4 with HCl. Add ddH2O to a total volume of 1 L, then add 1,000 &#181;l diethyl pyrocarbonate (DEPC) and shake vigorously. Store PBS overnight at room temperature and autoclave at 121 &#176;C for 20 min the following day.</li>
		</ol>
		</li>
		<li>1x PBS
		<ol>
			<li>Dilute the stock 10x PBS at 1:10 ratio in ddH2O to obtain a final concentration of 0.01 M Na2HPO4, 0.002 M KH2PO4, 0.003 M KCl, and 0.13 M NaCl.</li>
		</ol>
		</li>
		<li>Paraformaldehyde (PFA) fixative 
		Caution: Paraformaldehyde is toxic. Prepare it under a fume hood. Wear gloves.
		<ol>
			<li>To prepare 250 ml PFA fixative, heat 100 ml 1x PBS to 70 - 80 &#176;C and add 1,750 &#181;l of NaOH. Then add 10 g of paraformaldehyde and mix thoroughly until dissolved. Place the solution on ice and then adjust the pH to 7.2 with H2SO4 (260 - 270 &#181;l for 100 ml) after cooling.</li>
			<li>Adjust the volume to 250 ml with 1x PBS, add 625 &#181;l glutaraldehyde to a final concentration of 0.25%. Add 250 &#181;l Triton X-100 and 250 &#181;l Tween 20 to facilitate the infiltration of the fixative. 
			NOTE: The PFA fixative can be stored at 4 &#176;C for one month without losing its fixation ability.</li>
		</ol>
		</li>
		<li>Prepare different concentrations of ethanol (30%, 50%, 70%, 85%, and 95%) with DEPC-treated water.</li>
	</ol>
	</li>
	<li>Plant sample collection
	<ol>
		<li>Axillary buds
		<ol>
			<li>Use mature Phalaenopsis orchid plants at the four-leaf stage. Carefully remove leaves by tearing the leaf following the midrib using hands.</li>
			<li>Use a sharp scalpel to carefully remove axillary buds from the base of the third or fourth leaf on the monopodial stem.</li>
		</ol>
		</li>
		<li>Seed sample
		<ol>
			<li>Harvest mature orchid seed pods at 4 months after pollination. Cut seed pods longitudinally with a scalpel. Shake the opening seed pod gently and release the dry seeds on filter paper.</li>
		</ol>
		</li>
		<li>Protocorm
		<ol>
			<li>Sow mature orchid seeds on a 1/2x Murashige and Skoog agar plate, and grow in a tissue culture room in a 12 hr light period and constant temperature of 25 &#176;C. Sample green protocorm at 7 weeks after sowing.</li>
		</ol>
		</li>
		<li>Protocorm-like bodies (PLBs)
		<ol>
			<li>Grow orchid PLBs on T2 regenerating agar plates as described previously 10 and place under the same growth conditions as in the step 1.2.3.1. Collect 10 PLBs at a height of 5 - 8 mm.</li>
		</ol>
		</li>
		<li>Leaf sample
		<ol>
			<li>Collect leaf tissue from a mature Phalaenopsis orchid plant as described in step 1.2.1.1.</li>
			<li>Use a sharp scalpel to cut a small piece of leaf tissue (7 mm length x 5 mm width) from the second newly developed leaf.</li>
		</ol>
		</li>
		<li>Root sample
		<ol>
			<li>Using the same plant described in the step 1.2.1.1, dissect 1 cm length of root tip tissue using a sharp scalpel.</li>
		</ol>
		</li>
		<li>Young spike
		<ol>
			<li>Use a sharp scalpel to cut young spike tissue from the tip portion of the flower stalk 10 cm in length.</li>
		</ol>
		</li>
		<li>Flower bud
		<ol>
			<li>Excise a small flower bud of 5 mm in diameter from orchid flower stalk. Cut part of the flower bud tissue longitudinally (3 mm in thickness).</li>
		</ol>
		</li>
		<li>Leaf tissues and spikelet tissues of cereal crops
		<ol>
			<li>Cut 1 cm length leaf blade tissue from the first newly developed leaves from rice, wheat and maize plants.</li>
			<li>Collect 10 spikelets from plants (rice, wheat and maize) one day before anthesis.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Fixation
	<ol>
		<li>Fix plant samples immediately by transferring them into a glass scintillation vial containing 15 ml ice-cold PFA fixative.</li>
		<li>Apply a vacuum (~ 720 mm Hg) to plant samples in a 4 &#176;C cool room. Hold the vacuum for 15 - 20 min (small bubbles should be released from the samples). Repeat this step until most of the tissues sink after release of vacuum. Hold the vacuum overnight and release the vacuum slowly the next day.</li>
	</ol>
	</li>
	<li>Dehydration 
	NOTE: Use the same vial from the fixation through the infiltration steps. Pour or use a pipette to drain off the solution in the previous step and replace with 15 ml of new solution into the vial. Depending on the texture of tissues, treat harder tissues such as orchid axillary bud, seed, protocorm, and PLB, and the spikelet of rice, wheat, and maize for a longer time; treat softer tissues such as orchid flower bud, young spike, leaf and root, and the leaf of rice, wheat, and maize for a shorter time.
	<ol>
		<li>After fixation, immerse the sample in 15 ml 1x PBS for 10 min on ice.
		<ol>
			<li>Dehydrate samples in 15 ml ethanol series at room temperature as follows: 30% ethanol for 30 min, 50% ethanol for 30 min, 70% ethanol for 1 hr, 85% ethanol for 54 min for harder tissues and 30 min for softer tissues, 95% ethanol for 54 min for harder tissues and 30 min for softer tissues, and 100% ethanol twice for 54 min for harder tissues and 30 min for softer tissues. 
			NOTE: Plant samples can be stored in 70% ethanol at 4 &#176;C for several months.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Paraffin infiltration
	<ol>
		<li>Infiltrate samples with 15 ml ethanol and xylene substitute mixture for 54 min each for harder tissues and 30 min for softer tissues, at room temperature as follows: ethanol/xylene substitute (2:1, v/v), ethanol/xylene substitute (1:1, v/v), ethanol/xylene substitute (1:2, v/v), and pure xylene substitute twice. Caution: Xylene is toxic. Do this step in fume hood.</li>
		<li>Infiltrate sample in the vial with 15 ml xylene substitute and paraffin mixture in an oven at 60 &#176;C, overnight for harder tissues, and for 60 min for softer tissues as follows: xylene substitute/paraffin (2:1, v/v), xylene substitute/paraffin (1:1, v/v), and xylene substitute/paraffin (1:2, v/v).</li>
		<li>Infiltrate sample with 15 ml pure paraffin twice a day and incubate at 60 &#176;C in an oven.</li>
		<li>Repeat step 1.5.3 the next day.</li>
	</ol>
	</li>
	<li>Tissue embedding
	<ol>
		<li>Switch on the power of the tissue embedding center 1 hr in advance to melt the wax in the paraffin reservoir before embedding tissues in a paraffin block.</li>
		<li>Warm up the metal molds (size of base 3.3 cm length x 2 cm width) on the warming tray at 62 &#176;C, and pour approximately 13 ml of molten wax into the mold base.</li>
		<li>Transfer one tissue sample from section 1.5.4 into the mold with warmed forceps and orient it into the desired position.</li>
		<li>Move the mold onto the cool plate carefully, and leave until the wax is solidified.</li>
	</ol>
	</li>
</ol>
2. Tissue Sectioning
<ol>
	<li>Paraffin sectioning method
	<ol>
		<li>Make a wax base by placing an embedding cassette on the top of a mold (same size in the section 1.6.2), fill with molten wax and remove the mold after the wax is solidified. 
		NOTE: The embedding cassette will form a wax base to anchor the sample paraffin block.</li>
		<li>Trim the paraffin block into an appropriate shape and size, and place some wax pieces on a flat spatula. Heat the wax pieces using an alcohol burner until the wax melts and then place the molten wax on the wax base in section 2.1.1 to adhere the block. Clamp it in the microtome.</li>
		<li>Place a new blade onto the microtome, and adjust the angle to 5 degrees to facilitate the sectioning in the microtome.</li>
		<li>Cut the sample paraffin block into thin slices (10 &#181;m), as described previously 11.</li>
	</ol>
	</li>
	<li>Hybrid-Cut sectioning method
	<ol>
		<li>Trim the sample paraffin block from step 1.6.4 to a column with a trapezoid surface at the top to an appropriate size using a razor blade.</li>
		<li>Add some Optimal Cutting Temperature compound (OCT) to the center of the cryostat stage. Attach the paraffin block to the cryostat stage and then quickly orient the tissue block into the desired position.</li>
		<li>Transfer the paraffin block/stage to a cryostat chamber. Allow OCT to solidify on quick freeze bar at -42 &#176;C for 10 min. Do not move the block during solidification of OCT (Figure 2C).</li>
		<li>Allow the cryostat adaptor and chamber temperature to cool down to -20 &#176;C and -16 &#176;C respectively before attaching the paraffin block/stage to the cryostat adaptor. Section tissues to 10 &#181;m in thickness.</li>
		<li>Pick tissue sections with forceps. Float the sections on 800 &#181;l DEPC-treated water in a Poly-L-lysine coated slide and transfer the slides onto a hot plate at 42 &#176;C.</li>
		<li>Allow the sections to flatten on DEPC-treated water at 42 &#176;C. Use filter paper to drain off the water from the edge.</li>
		<li>Mount tissue on the slide by placing the slide on a 42 &#176;C hot plate overnight.</li>
	</ol>
	</li>
</ol>
3. Tissue Staining
<ol>
	<li>Deparaffinization
	<ol>
		<li>Collect the slides from the hot plate and place them in a staining rack. Add 150 ml xylene into a staining jar in fume hood and immerse the rack in xylene for 5 min.</li>
	</ol>
	</li>
	<li>Rehydration
	<ol>
		<li>Prepare different concentrations of ethanol solutions (100%, 95%, 70%, 50%, and 30%) in DEPC-treated water and fill 150 ml of solution into distinct staining jars, respectively.</li>
		<li>Rehydrate the samples through a series of decreasing ethanol concentration, each step for 3 min at room temperature. Transfer the slides in the staining rack one jar to another jar containing different ethanol concentrations: 100% Ethanol, 95% Ethanol, 70% Ethanol, 50% Ethanol, and 30% Ethanol.</li>
		<li>After rehydration, immerse the specimens in ddH2O for 3 min.</li>
	</ol>
	</li>
	<li>Hematoxylin staining
	<ol>
		<li>Stain tissue samples by immersing tissue slides in hematoxylin solution for 1.5 min.</li>
		<li>Rinse briefly in ddH2O containing 1 - 2 drops of 12 N hydrochloric acid (HCl) for a few seconds, and then wash briefly in ddH2O.</li>
	</ol>
	</li>
	<li>Dehydration
	<ol>
		<li>Dehydrate the samples through a series of increasing ethanol concentrations for 3 min at room temperature: 30% Ethanol, 50% Ethanol, 70% Ethanol, 95% Ethanol, and 100% Ethanol. Clear the specimens with xylene in the fume hood for 5 min.</li>
	</ol>
	</li>
	<li>Mounting
	<ol>
		<li>Drop appropriately 600 &#956;l of xylene-based mounting medium onto slide. Carefully place a coverslip over the specimen. Avoid air bubbles forming to get good quality images.</li>
		<li>Allow the slides to air dry overnight. Observe the specimen under a microscope the next day. 
		Note: Images were captured at 25X to 400X magnification depending on the size of specimens.</li>
	</ol>
	</li>
</ol>
4. In Situ Hybridization
<ol>
	<li>Probe synthesis
	<ol>
		<li>Clone Phalaenopsis aphrodite Actin gene specific coding sequence using primers 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3&#39; and 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; (to get 242 bp PCR amplicon) and CyclinB1;1 gene specific coding sequence using primers 5&#39;-TCGTAGCAAGGTTGCTTGTG-3&#39; and 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; (to get 327 bp PCR amplicon) as described 12.</li>
		<li>Ligate the specific coding sequences into vectors (e.g., pGEMT) according to the manufacturer&#39;s protocol.</li>
		<li>Generate digoxigenin (DIG) labeled sense and antisense probes using SP6/T7 DIG RNA labeling kit according to manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>In situ hybridization
	<ol>
		<li>Cut the 2nd and 3rd axillary bud tissue slices (10 &#181;m thickness) generated using the Hybrid-Cut method, and mount slices onto coated slide.</li>
		<li>Deparaffinize tissue sections in xylene (see 3.1.1), rehydrate in decreasing concentrations of ethanol (see 3.2.2), and digest with 2 mg/ml proteinase K at 37 &#176;C for 30 min.</li>
		<li>Perform in situ hybridization according to the protocol previously described 11,13 with some modifications, i.e., with hybridization temperature for Actin as 59 &#176;C and 60 &#176;C for CyclinB1;1. Hybridize slide with 40 ng DIG-labeled RNA probe.</li>
		<li>Use nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution to detect hybridization signals as described 11.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

Plant cells have rigid cell walls, tough fibers, crystals, and high water content that cause tissue tearing problems during plant tissue sectioning. Even though paraffin-based sectioning is frequently used for plant tissues, the endogenous crystals often lacerate the plant tissue during sectioning (Figure 1). Because of the inherently high water content within the plant cells, cryostat-based sectioning often causes broken cells and cracked tissue sections.
In the present study, a combined paraffin-embedding and cryosection protocol named Hybrid-Cut was developed and good quality tissue sections were obtained. This protocol resolves the problem associated with high water content by introducing paraffin embedding, and reduces the tearing effect by hardening paraffin wax under low temperature during sectioning (Figure 3). Therefore, this modified protocol is advantageous over either paraffin-based sectioning or cryosectioning for preserving plant tissue integrity.
This manuscript demonstrates that the Hybrid-Cut method preserves tissue integrity in many tissues of Phalaenopsis orchid such as axillary bud, seed, and PLB, etc. that contain high levels of crystals (Figures 3-4). Moreover, this protocol is amenable to cereal crops such as reproductive organs and leaves of rice, maize, and wheat that contain high silica (Figures 5-6). Presumably, this protocol may be applied to woody plants containing high fiber.
In general, fixing tissue thoroughly is very important for Hybrid-Cut. We found that formaldehyde-alcohol-acidic acid (FAA) fixative is better than PFA to preserve the tissue integrity of some recalcitrant tissues such as axially buds, roots, etc. However, PFA works better than FAA in preserving the RNA integrity. Therefore PFA is recommended to fix sample for in situ hybridization (ISH) work. The protocol described here is designed for RNA ISH experiment. Therefore, all reagents were prepared to avoid RNA degradation by eliminating RNase contamination by DEPC treatment. If Hybrid-Cut section is for anatomical studies, regular reverse osmosis (RO) water and its derived buffer or reagents are acceptable.
Reducing specimen size and thickness to less than 3 mm is helpful for infiltration. Moreover, increasing immersion time for dehydration and infiltration are necessary for hard texture tissues. Limitation of this protocol might due to problems caused by inadequate fixation, dehydration, and infiltration of specimen. Therefore, adjustment of processing time for each step is critical to produce good quality paraffin block. Normally, harder tissue needs longer processing time than softer tissue.
In addition, we showed that Hybrid-Cut worked successfully in combination with ISH to provide spatial distribution of the selected transcripts (Figure 7). In summary, this protocol is useful for the study of plant anatomy and provides a tissue-specific RNA map of the selected genes. In addition it may be applied to other molecular studies such as terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, fluorescence in situ hybridization (FISH), and immunostaining techniques. In conclusion, this improved tissue sectioning protocol is both useful and helpful for researchers in plant communities.

The paraffin-based sectioning method is a widely-used technique for anatomical studies. Preservation of intact tissue anatomy is important for morphological and biological studies. The paraffin-embedded sectioning technique is advantageous because paraffin-embedding retains cell and tissue morphology. In addition, paraffin blocks can be stored conveniently for long periods of time. However, paraffin-embedded sectioning is not suitable for plant tissues containing intracellular crystals. Crystals within the cells often tear paraffin ribbons and damage tissue integrity during sectioning.
Unlike paraffin sectioning, cryosectioning is relatively fast and sections can be obtained without fixation, serial dehydration or embedding medium infiltration 1. Cryosections are compatible with many applications such as immunohistochemistry, in-situ hybridization, and enzyme histochemistry. The other advantage of cryosectioning is that this method does not go through a potential denaturation processes such as high temperature and chemical treatments, so cellular molecules are well preserved within the tissue sections 2. Cryosectioning is generally preferred over paraffin-based sectioning for studies in animal tissues. However, cryosectioning is not the first choice in plants because freezing temperature sometimes causes formation of ice crystals that affect the quality of section integrity. Although osmoregulation such as sucrose solutions, polyethylene glycol (PEG), or glycerol 3 have been reported to reduce crystal ice formation under freezing conditions, the improvement is less than optimal.
To adapt to different environments, different plants often have distinct tissue texture and plant cells have evolved to form rigid cell walls, tough fibers, and crystals 4,5. For example, insoluble calcium oxalate crystals and silica bodies are fairly common in plants 6. Silicate bodies/crystals have been reported to help maintain plant architecture, erectness, and prevent disease or pest in cereal plants 7-9.
The potted orchids and cut-flower orchid market is flourishing and it is a growing industry. Phalaenopsis aphrodite (moth orchid) is one of the most important export ornamental plants in Taiwan. Significant efforts have been made to understand the morphological and physiological changes of the flowering processes in Phalaenopsis orchids. Floral spikes of Phalaenopsis orchids are initiated from axillary buds at the leaf base. After a period of cool ambient temperature (approximately one and half months), axillary buds enlarge, break dormancy, and protrude from the leaf base to develop into young floral spikes. To understand the physiological, cellular, and molecular processes of spike initiation, it is essential to develop a robust anatomical technique to visualize tissues or markers in a timely manner. However, the presence of ubiquitous crystals in orchid tissues, particularly in axillary buds, makes anatomical work difficult.
Here we sought to improve section integrity of recalcitrant plant tissues that have been hitherto regarded as technically challenging. Here we show an improved protocol named Hybrid-Cut. It is a paraffin-based sectioning method that is performed using a cryostat. Paraffin embedding resolves high water content in plant tissue. Sectioning under low temperature hardens the paraffin block, reduces crystal tearing problem, and improves tissue integrity significantly. This protocol significantly improves tissue integrity for recalcitrant plant samples.

<table><tbody><tr><td>Embedding Center model EC780-1</td><td>CSA</td><td></td><td></td></tr><tr><td>Microtome model RM2255</td><td>Leica</td><td></td><td></td></tr><tr><td>Cryostat model CM 1950</td><td>Leica</td><td></td><td></td></tr><tr><td>Axio Scope A1 microscope&amp;nbsp;</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Murashige &amp;amp; Skoog medium including vitamins</td><td>Duchefa Biochemia</td><td>M0222.0050</td><td></td></tr><tr><td>RNase free surface decontaminant</td><td>Apex</td><td>10-228</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>Bio Basic Inc.&amp;nbsp;</td><td>D801154</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>MDBio, Inc.</td><td>101-7647-14-5</td><td></td></tr><tr><td>Potassium chloride, crystal (KCl)</td><td>J.T. Baker</td><td>7447-40-7</td><td></td></tr><tr><td>Sodium phosphate dibasic (Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7558-79-4</td><td></td></tr><tr><td>Potassium phosphate monobasic (KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7778-77-0</td><td></td></tr><tr><td>Paraformaldehyde (PFA)</td><td>Sigma-Aldrich</td><td>16005</td><td></td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Showa</td><td>19430160</td><td></td></tr><tr><td>Sulfuric acid (H&lt;sub&gt;2&lt;/sub&gt;SO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7664-93-9</td><td></td></tr><tr><td>Glutaraldehyde solution</td><td>Sigma-Aldrich</td><td>111-30-8</td><td></td></tr><tr><td>Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td><td>J.T. Baker</td><td>9005-64-5</td><td></td></tr><tr><td>Octyl Phenol Ethoxylate (Triton X100)</td><td>J.T. Baker</td><td>9002-93-1</td><td></td></tr><tr><td>Glass scintillation vials</td><td>Newastar</td><td>DG60805-00020</td><td></td></tr><tr><td>Desiccator vacuum</td><td>Violet Bioscience Inc.</td><td>TS-402030</td><td></td></tr><tr><td>Rotary vane pump RZ2.5</td><td>Vacuubrand</td><td>36149406</td><td></td></tr><tr><td>Ethanol</td><td>J.T. Baker</td><td>64-17-5</td><td></td></tr><tr><td>Sub-X&amp;nbsp;</td><td>Leica Surgipath</td><td>3803670</td><td>Xylene substitute</td></tr><tr><td>Paraplast Plus&amp;nbsp;</td><td>Leica Surgipath</td><td>39602004</td><td>Tissue embedding paraffin</td></tr><tr><td>SUPERFROST micro slide glass</td><td>Matsunami</td><td>S7441</td><td></td></tr><tr><td>FSC 22 Clear&amp;nbsp;</td><td>Leica Surgipath</td><td>3801480</td><td>Optimal Cutting Temperature compound (OCT)&amp;nbsp;</td></tr><tr><td>Xylenes, Purified</td><td>Leica Surgipath</td><td>3803665</td><td></td></tr><tr><td>Hematoxylin</td><td>Merck</td><td>HX305311</td><td></td></tr><tr><td>Hydrochloric acid (HCl)</td><td>Sigma-Aldrich</td><td>7647-01-0</td><td></td></tr><tr><td>Micromount</td><td>Leica Surgipath</td><td>3801731</td><td>Mounting medium</td></tr><tr><td>pGEM T-easy vector</td><td>Promega</td><td>A1360</td><td></td></tr><tr><td>Proteinase K</td><td>Roche</td><td>3115879001</td><td></td></tr><tr><td>SP6/T7 DIG RNA Labeling Kit</td><td>Roche</td><td>11175025910</td><td></td></tr><tr><td>NBT/BCIP stock solution</td><td>Roche</td><td>11681451001</td><td></td></tr></tbody></table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some plant cells have rigid cell walls, tough fibers and crystals (calcium oxalate, silica, etc.), and high water content that often disrupt tissue integrity during plant tissue sectioning.
This study establishes a simple Hybrid-Cut tissue sectioning method. This protocol modifies a paraffin-based sectioning technique and improves the integrity of tissue sections from different plants. Plant tissues were embedded in paraffin before sectioning in a cryostat at -16 &#176;C. Sectioning under low temperature hardened the paraffin blocks, reduced tearing and scratching, and improved tissue integrity significantly. This protocol was successfully applied to calcium oxalate-rich Phalaenopsis orchid tissues as well as recalcitrant tissues such as reproductive organs and leaves of rice, maize, and wheat. In addition, the high quality of tissue sections from Hybrid-Cut could be used in combination with in situ hybridization (ISH) to provide spatial expression patterns of genes of interest. In conclusion, this protocol is particularly useful for recalcitrant plant tissue containing high crystal or silica content. Good quality tissue sections enable morphological and other biological studies.

Hybrid-Cut Improves the Integrity of Tissue Sections
Understanding the anatomy of the reproductive floral structure is important for investigating the underlying mechanism of flower initiation in orchids. However, the accumulation of intracellular calcium oxalate crystals in Phalaenopsis orchids makes such studies a challenging task. To circumvent the problems associated with tearing caused by crystals during the sectioning process (Figure 1), we developed a system we named Hybrid-Cut. This protocol combines traditional paraffin embedding and cryosection techniques. We first tested Hybrid-Cut in axillary buds of Phalaenopsis orchid because they are notorious for tissue rigidity and high crystal content. Axillary bud tissue was fixed in 4% PFA (see Protocol, step 1.3). After serial ethanol dehydration and paraffin wax infiltration, the axillary bud was embedded in a paraffin block. The block was trimmed to a suitable size before sectioning (Figure 2A). A small amount of OCT was then applied to the center of the cryostat stage (Figure 2B). The paraffin block was then adhered to the stage via OCT. The stage was incubated in a cryostat for 10 min to allow complete solidification of OCT before sectioning (Figure 2C) and then cryosection was performed in a -16 &#176;C chamber (Figure 2D).
As a comparison, a paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. As shown in Figure 1A, severe tearing of the paraffin ribbons was observed after microtome sectioning. The tissue integrity and cellular structure was also compromised (Figure 1B). Hybrid-Cut, on the other hand, produced intact tissue sections (Figure 3A) with preserved structural integrity (Figure 3B).
Application of Hybrid-Cut to Various Tissues of P. aphrodite
To further test the amenability of Hybrid-Cut, we tested different tissues of Phalaenopsis orchids. It is often difficult to obtain sections of seeds with good tissue integrity because of the hardened seed coats. Using this protocol, detailed structures of seeds were preserved after sectioning (Figure 4A). As shown in Figure 4A, protein bodies, the common storage products 14, could be clearly identified. Hybrid-Cut also worked successfully and showed the detailed structures of the shoot apical meristem of the one-month old protocorm (the germinated structure from a seed) (Figure 4B) and protocorm-like-bodies (PLBs, Figure 4C). The intracellular crystals were observed in sections of PLB. Phalaenopsis orchids have thick and succulent leaves and they perform Crassulacean acid metabolism (CAM)-type photosynthesis 15. The transverse section of leaf blade showed large mesophyll cells and vascular bundles containing xylem and phloem (Figure 4D). Few stomatal openings were observed on the abaxial leaf surface during the daytime (Figure 4D). In fact, CAM plants evolved to maximize carbon gain but simultaneously minimize water loss by opening their stomates in the night under arid conditions 15,16. The root apical meristem of P. aphrodite is shown in Figure 4E. The root tip cells appeared to contain a significant number of crystals, which were very well preserved after sectioning (Figure 4E). Longitudinal sections of young floral spikes provided information about the architecture of young floral primordials (Figure 4F). Moreover, sepals, petals, labellum, and pollinia could be clearly identified from the longitudinal section of young flower buds that have completed differentiation in this 5 mm flower bud (Figure 4G). Notice that crystals were accumulated in the sepals of young floral buds. In short, this protocol works consistently to maintain tissue integrity and produces intact morphology enabling anatomical and possible cellular studies.
Hybrid-Cut Preserves Tissue Integrity in Cereal Crops
We also tested Hybrid-Cut on cereal crops such as rice, wheat and maize that contain high silica content 17,18. As shown in Figure 5, the tissue integrity of transverse sections of rice, wheat, and maize leaves were significantly improved by the Hybrid-Cut method. Xylem, phloem, mesophyll cells, stomates, and bulliform cells that control rolling of the leaf blade to avoid water loss were clearly identified from sections of rice leaves. The Kranz anatomy, mesophyll cells, and vascular bundles of the maize leaf 19,20 were clearly identified. It was intriguing to find a high density of stomates on both the adaxial and abaxial sides of maize leaves (Figure 5). The ratio of adaxial and abaxial stomata of 0.7 in maize has been reported previously 21. In addition, this protocol also worked successfully to provide the detailed cell morphology of spikelets from rice, wheat, and maize (Figure 6). Spikelets are known to contain abundant silica 9. Normally, that causes difficulty in conducting tissue sectioning.
In Situ Hybridization
Genomic and transcriptomic approaches are commonly used to annotate the functions of genes. Providing spatial distribution of transcripts of the genes of interest in developmental or environmental contexts is important to add new insight into the possible functions of the genes. In-situ hybridization (ISH) has been developed to localize gene expression patterns at the tissue level 11,22-25. In addition, ISH can provide cellular, and in some cases sub-cellular, resolution of mRNA distribution in multicellular organisms 26. During ISH, RNA and tissue integrity is essential to obtain reliable spatial information about the selected transcript. We tested ISH using the Hybrid-Cut protocol. Actin gene (PATC157348) was cloned using primers 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3&#39; and 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; to get 242 bp PCR amplicon. Cyclin B1:1 (PATC146999) gene specific coding sequence using primers 5&#39;-TCGTAGCAAGGTTGCTTGTG-3&#39; and 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; to get 327 bp PCR amplicon. After ISH, Actin and Cyclin B1:1 gene expression was monitored in young and mature axillary buds (Figure 7). Both genes were expressed in meristematic cells of 2nd and 3rd axillary buds, with stronger signals detected in 3rd axillary buds. These results demonstrated that Hybrid-Cut retain good anatomy and provide spatial gene expression pattern.
<img alt="Figure 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> 
Figure 1: Traditional Paraffin Section Causes Severe Tearing of Tissue. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. Severe tearing of the paraffin ribbons was observed after traditional microtome sectioning (A). The tissue integrity and cellular structure was also compromised (B). The arrows show the severe tearing of the tissue slice. Arrowhead shows the crystal bodies. Scale bar 100 &#181;m. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> 
Figure 2: Hybrid-Cut Sectioning Method. An axillary bud tissue was fixed in PFA and tissues were dehydrated, infiltrated with paraffin wax, and embedded in a paraffin block. The paraffin block was trimmed to an appropriate size (A). Optimal Cutting Temperature compound (OCT) was applied to the center of the cryostat stage (B). The paraffin block was attached to the OCT on the cryostat stage. Under low temperature, the paraffin block was adhered to the cryostat stage via OCT (C). Tissue slices were sectioned in the cryostat chamber at -16 &#176;C (D). Scale bars represent 0.5 cm (A), and 1 cm (B-D). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> 
Figure 3: Hybrid-Cut Improves Section Integrity. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to Hybrid-Cut sectioning (A) and the Hybrid-Cut method produced sections with excellent tissue integrity (B). The arrowhead shows the endogenous crystal bodies embedded in the axillary bud tissue. Scale bar 100 &#181;m. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> 
Figure 4: Application of Hybrid-Cut to Various Tissue Sections of Phalaenopsis orchid. Different orchid tissues were sectioned using the Hybrid-Cut method, such as longitudinal section of orchid seed during the mature stage (A), longitudinal section of protocorm (B), longitudinal section of protocorm-like bodies (PLB) (C), transverse section of leaf blade (D), longitudinal section of root (E), longitudinal section of young flower spike (F), and longitudinal section of young flower buds (G). Tissue sections were stained by hematoxylin. SC, seed coat; PB, protein body; M, meristem; MP, mother PLB; DP, daughter PLB; Ad, adaxial leaf surface; Ab, abaxial leaf surface; St, stomata; MC, mesophyll cell; VB, vascular bundle; RC, root cap; fb, flower bud; Se, sepal; Pe, petal; La, labellum; Po, pollinia; Ro, rostellum; Ca, callus. Arrowheads show crystals. Scale bars represent 20 &#181;m (A-E) and 200 &#181;m (F-G). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> 
Figure 5: Hybrid-Cut Preserves Leaf Tissue Integrity in Several Cereal Crops. Comparison of leaf tissue using the traditional paraffin method (left-hand panel) and the Hybrid-Cut technique developed in this study (right-hand panel). Images show leaf transverse sections of rice, wheat, and maize. MC, mesophyll cell; Ph, phloem; St, stomata; BC, bulliform cell. Arrows show the tearing of tissue slice. Arrowheads show silica bodies. The blue dashed circles indicate Kranz anatomy in C4 maize. Scale bars 20 &#181;m. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> 
Figure 6: Hybrid-Cut Preserves Spikelet Tissue Integrity in Several Cereal Crops. Comparison of tissue integrity of spikelet sections between traditional paraffin and Hybrid-Cut methods. Arrows show the tearing of tissue slice. Arrowheads indicate silica bodies. Scale bars 20 &#181;m (rice), and 200 &#181;m (wheat and maize). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> 
Figure 7: In Situ Hybridization of Actin and CyclinB1;1 Expression Patterns in the Axillary Bud of Phalaenopsis orchid. Tissue slices of the 2nd axillary buds and 3rd axillary bud were prepared using the Hybrid-Cut method. A total of 40 ng of Actin and CyclinB1;1 dig-labeled probe were used for hybridization. The sense probe was used as a negative control. Arrows indicate the reproductive meristem of axillary bud. Scale bars 100 &#181;m. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Universidad San Sebastian

Research

JoVE Journal

Biology

18.8K Views.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Video: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of tissue specific expression is limited because of problems in dissecting individual tissues. Expression data needs to be confirmed and complemented with expression patterns using e.g. in situ hybridization, a technique used to localize cell specific mRNA expression. The in situ hybridization method is laborious, time-consuming and often requires extensive optimization depending on species and tissue. In situ experiments are relatively more difficult to perform in woody species such as the conifer Norway spruce (Picea abies). Here we present a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including P. abies. With just a few adjustments, including altered RNase treatment and proteinase K concentration, we could use the protocol to study tissue specific expression of homologous genes in male reproductive organs of one gymnosperm and two angiosperm species; P. abies, Arabidopsis thaliana and Brassica napus. The protocol worked equally well for the species and genes studied. AtAP3 and BnAP3 were observed in second and third whorl floral organs in A. thaliana and B. napus and DAL13 in microsporophylls of male cones from P. abies. For P. abies the proteinase K concentration, used to permeablize the tissues, had to be increased to 3 g/ml instead of 1 g/ml, possibly due to more compact tissues and higher levels of phenolics and polysaccharides. For all species the RNase treatment was removed due to reduced signal strength without a corresponding increase in specificity. By comparing tissue specific expression patterns of homologous genes from both flowering plants and a coniferous tree we demonstrate that the DIG in situ protocol presented here, with only minute adjustments, can be applied to a wide range of plant species. Hence, the protocol avoids both extensive species specific optimization and the laborious use of radioactively labeled probes in favor of DIG labeled probes. We have chosen to illustrate the technically demanding steps of the protocol in our film.
Anna Karlgren and Jenny Carlsson contributed equally to this study.
Corresponding authors: Anna Karlgren at Anna.Karlgren@ebc.uu.se and Jens F. Sundstr&#246;m at Jens.Sundstrom@vbsg.slu.se

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

We describe a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including Norway spruce. With just a few adjustments, including altered RNase treatment and proteinase K concentration, the protocol may be used in studies of different tissues and species.

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of ...

Multimodal Hierarchical Imaging of Serial Sections for Finding Specific Cellular Targets within Large Volumes

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a combination of light and electron microscopy. Samples embedded in resin are sectioned into arrays consisting of ribbons of hundreds of ultrathin sections and deposited on pieces of silicon wafer or conductively coated coverslips. Arrays are imaged at low resolution using a digital consumer like smartphone camera or light microscope (LM) for a rapid large area overview, or a wide field fluorescence microscope (fluorescence light microscopy (FLM)) after labeling with fluorophores. After post-staining with heavy metals, arrays are imaged in a scanning electron microscope (SEM). Selection of targets is possible from 3D reconstructions generated by FLM or from 3D reconstructions made from the SEM image stacks at intermediate resolution if no fluorescent markers are available. For ultrastructural analysis, selected targets are finally recorded in the SEM at high-resolution (a few nanometer image pixels). A ribbon-handling tool that can be retrofitted to any ultramicrotome is demonstrated. It helps with array production and substrate removal from the sectioning knife boat. A software platform that allows automated imaging of arrays in the SEM is discussed. Compared to other methods generating large volume EM data, such as serial block-face SEM (SBF-SEM) or focused ion beam SEM (FIB-SEM), this approach has two major advantages: (1) The resin-embedded sample is conserved, albeit in a sliced-up version. It can be stained in different ways and imaged with different resolutions. (2) As the sections can be post-stained, it is not necessary to use samples strongly block-stained with heavy metals to introduce contrast for SEM imaging or render the tissue blocks conductive. This makes the method applicable to a wide variety of materials and biological questions. Particularly prefixed materials e.g., from biopsy banks and pathology labs, can directly be embedded and reconstructed in 3D.

This protocol targets specific cells in tissue for imaging at nanoscale resolution using a scanning electron microscope (SEM). Large numbers of serial sections from resin-embedded biological material are first imaged in a light microscope to identify the target and then in a hierarchical manner in the SEM.

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a ...

Developmental Biology

Preparation of Non-human Primate Brain Tissue for Pre-embedding Immunohistochemistry and Electron Microscopy

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and characterize ultrastructural and morphological details of neurons, such as synaptic contacts. Good preservation of brain tissue for electron microscopy can be obtained by rigorous cryo-fixation methods, but these techniques are rather costly and limit the use of immunolabeling, which is crucial to understand the connectivity of identified neuronal systems. Freeze-substitution methods have been developed to allow the combination of cryo-fixation with immunolabeling. However, the reproducibility of these methodological approaches usually relies on costly freezing devices. Moreover, achieving reliable results with this technique is very time-consuming and skill-challenging. Hence, the traditional chemically fixed brain, particularly with acrolein fixative, remains a time-efficient and low-cost method to combine electron microscopy with immunohistochemistry. Here, we provide a reliable experimental protocol using chemical acrolein fixation that leads to the preservation of primate brain tissue and is compatible with pre-embedding immunohistochemistry and transmission electron microscopic examination.

Here, we provide an easy, low-cost, and time-efficient protocol to chemically fix primate brain tissue with acrolein fixative, allowing for long-term preservation that is compatible with pre-embedding immunohistochemistry for transmission electron microscopy.

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and ...

Neuroscience

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

The Cutting and Floating Method for Paraffin-embedded Tissue for Sectioning

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial companies have devised complex section transfer systems using fluid water. To simplify this technology, we created a simple method using homemade equipment that combines cutting and floating within a simple thermostatic chamber; therefore, the sections automatically enter the water bath on the water surface. The hippocampus from adult mouse brains, adult mouse kidneys, embryonic mouse brains, and adult zebrafish eyes were cut using both conventional paraffin sectioning and the presented method for comparison. Statistical analysis shows that our improved method saved time and produced higher quality sections. In addition, paraffin sectioning of a whole specimen in a short time is easy for junior operators.

Here, we present a protocol to improve paraffin sectioning. This method combines cutting and floating using a simple thermostatic chamber to avoid the transfer process required by the conventional method. As a result, the efficiency and the number of intact paraffin sections were greatly improved.

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Medicine

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify transcriptional regulatory networks that govern developmental processes it is necessary to measure the spatial and temporal gene expression profiles of these individual cell types. Therefore, insight into the spatio-temporal control of gene expression is essential to gain understanding of how biological and developmental processes are regulated. Here, we describe a laser-capture microdissection (LCM) method to isolate small number of cells from three barley embryo organs over a time-course during germination followed by transcript profiling. The method consists of tissue fixation, tissue processing, paraffin embedding, sectioning, LCM and RNA extraction followed by real-time PCR or RNA-seq. This method has enabled us to obtain spatial and temporal profiles of seed organ transcriptomes from varying numbers of cells (tens to hundreds), providing much greater tissue-specificity than typical bulk-tissue analyses. From these data we were able to define and compare transcriptional regulatory networks as well as predict candidate regulatory transcription factors for individual tissues. The method should be applicable to other plant tissues with minimal optimization.

Presented here is a protocol for laser-capture microdissection (LCM) of plant tissues. LCM is a microscopic technique for isolating areas of tissue in a contamination-free manner. The procedure includes tissue fixation, paraffin embedding, sectioning, LCM and RNA extraction. RNA is used in the downstream tissue-specific, temporally resolved analysis of transcriptomes.

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify ...

A Simple Dry Sectioning Method for Obtaining Whole-Seed-Sized Resin Section and Its Applications

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are significantly different among different regions of seed. In order to view the morphologies of cells, starch granules and protein bodies clearly, and quantitatively analyze their morphology parameters accurately, the whole-seed-sized section is needed. Though the whole-seed-sized paraffin section can investigate the accumulation of storage materials in seeds, it is very difficult to quantitatively analyze the morphology parameters of cells and storage materials due to the low resolution of the thick section. The thin resin section has high resolution, but the routine resin sectioning method is not suitable to prepare the whole-seed-sized section of mature seeds with a large volume and high starch content. In this study, we present a simple dry sectioning method for preparing the whole-seed-sized resin section. The technique can prepare the cross and longitudinal whole-seed-sized sections of developing, mature, germinated, and cooked seeds embedded in LR White resin, even for large seeds with high starch content. The whole-seed-sized section can be stained with fluorescent brightener 28, iodine, and Coomassie brilliant blue R250 to specifically exhibit the morphology of cells, starch granules, and protein bodies clearly, respectively. The image obtained can also be analyzed quantitatively to show the morphology parameters of cells, starch granules, and protein bodies in different regions of seed.

This technique allows for the fast and simple preparation of whole-seed-sized resin section for the observation and analysis of cells, starch granules, and protein bodies in different regions of the seed.

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are ...

Microscopy Techniques for Interpreting Fungal Colonization in Mycoheterotrophic Plants Tissues and Symbiotic Germination of Seeds

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching mycoheterotrophic plants (i.e., plants that obtain carbon from fungi), remarkable aspects of their structural adaptations, the patterns of tissue colonization by fungi, and the morphoanatomy of subterranean organs can enlighten their developmental strategies and their relationships with hyphae, the source of nutrients. Another important role of symbiotic fungi is related to the germination of orchid seeds; all Orchidaceae species are mycoheterotrophic during germination and seedling stage (initial mycoheterotrophy), even the ones that photosynthesize in adult stages. Due to the lack of nutritional reserves in orchid seeds, fungal symbionts are essential to provide substrates and enable germination. Analyzing germination stages by structural perspectives can also answer important questions regarding the fungi interaction with the seeds. Different imaging techniques can be applied to unveil fungi endophytes in plant tissues, as are proposed in this article. Freehand and thin sections of plant organs can be stained and then observed using light microscopy. A fluorochrome conjugated to wheat germ agglutinin can be applied to the fungi and co-incubated with Calcofluor White to highlight plant cell walls in confocal microscopy. In addition, the methodologies of scanning and transmission electron microscopy are detailed for mycoheterotrophic orchids, and the possibilities of applying such protocols in related plants is explored. Symbiotic germination of orchid seeds (i.e., in the presence of mycorrhizal fungi) is described in the protocol in detail, along with possibilities of preparing the structures obtained from different stages of germination for analyses with light, confocal, and electron microscopy.

This protocol aims to provide detailed procedures for collecting, fixing, and maintaining mycoheterotrophic plant samples, applying different microscopy techniques such as scanning and transmission electron microscopy, light, confocal, and fluorescence microscopy to study fungal colonization in plants tissues and seeds germinated with mycorrhizal fungi.

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching ...

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Summary

Explore More Videos

Chapters in this video

Thin Sectioning of Slice Preparations for Immunohistochemistry

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

Multimodal Hierarchical Imaging of Serial Sections for Finding Specific Cellular Targets within Large Volumes

Preparation of Non-human Primate Brain Tissue for Pre-embedding Immunohistochemistry and Electron Microscopy

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The Cutting and Floating Method for Paraffin-embedded Tissue for Sectioning

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

A Simple Dry Sectioning Method for Obtaining Whole-Seed-Sized Resin Section and Its Applications

Microscopy Techniques for Interpreting Fungal Colonization in Mycoheterotrophic Plants Tissues and Symbiotic Germination of Seeds