Name: hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples
Uploaded: 2016-11-23T15:00:00.000+00:00
Duration: 9 min 38 s
Description: Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

1. 고정 및 포함 <ol><li> 시약 준비 <ol><li> 배 인산 완충 용액 (PBS) <ol><li> 80g의 NaCl, 2 g의 KCl, 14.4 g이 나 HPO 4, 2.4 g의 KH 2 PO 4 800 ml의 증류수 (DDH 2 O)를 추가하고 HCl로 7.4 pH를 조정합니다. 1 L의 총 부피에 O DDH 2를 추가하고 1,000 μl를 디 에틸 피로 카보네이트 (DEPC)를 추가하고 격렬하게 흔들어. 스토어 PBS 하룻밤 20 분 다음 날 121 ° C의 실내 온도와 오토 클레이브에서. </li></ol></li><li> 1X PBS <ol><li> , HPO 4 0.01 M 나트륨 (2)의 최종 농도를 얻기 위해 DDH 2 O 1:10 비로 0.002 M KH 2 PO 4, 0.003 M KCl을, 0.13 M 염화나트륨을 재고 PBS 배 희석. </li></ol></li><li> 파라 포름 알데히드 (PFA) 고정액 주의 : 파라 포름 알데히드는 독성이있다. 흄 후드를 준비합니다. 장갑을 착용 할 것. <ol><li> 250 ml의 PFA의 정착액을 준비하려면 (100)를 가열ml의 1 배 ~ 70 PBS - 80 ° C 및 NaOH를 1,750 μl를 추가합니다. 이어서, 파라 포름 알데히드 10 g을 추가하고 용해 될 때까지 잘 혼합한다. 얼음에 솔루션을 배치 한 후 H 2 7.2로 pH를 조정 SO 4 - 냉각 후 (260 100 ㎖ 270 μL). </li><li> , 1X PBS 250 ml의에 볼륨을 조정 0.25 %의 최종 농도 625 μL 글루 타르 알데히드를 추가합니다. 정착액의 침투를 용이하게하기 위해 250 μL 트리톤 X-100 및 250 ㎕의 트윈 20을 추가합니다. 주 : PFA 정착액이 그 고정 능력을 손실하지 않고 한 달 동안 4 ℃에서 저장 될 수있다. </li></ol></li><li> DEPC 처리 된 물과 에탄올의 다양한 농도 (30 %, 50 %, 70 %, 85 %, 95 %)을 준비한다. </li></ol></li><li> 식물 시료 채취 <ol><li> 겨드랑이 싹 <ol><li> 네 잎 단계에서 성숙 호 접 난초 식물을 사용합니다. 조심스럽게 손을 사용하여 주맥 다음 잎을 찢어하여 잎을 제거 할 수 있습니다. </li><li> caref에 날카로운 메스를 사용하여ully monopodial 줄기에 세 번째 또는 네 번째 잎의 기지에서 겨드랑이 싹을 제거합니다. </li></ol></li><li> 종자 샘플 <ol><li> 수분 후 사개월에서 성숙한 난초 씨앗 포드를 수확. 메스로 종 씨앗 포드를 잘라. 부드럽게 개방 씨앗 포드를 흔들어 필터 종이에 마른 씨앗을 놓습니다. </li></ol></li><li> Protocorm <ol><li> 1 / 2 배 무라 시게 및 스쿡 한천 플레이트에 성숙한 난초 씨앗을 뿌리고, 그리고 조직 문화 12 시간 빛 기간 룸과 25 ° C의 일정한 온도에서 성장합니다. 파종 후 7 주에 녹색 protocorm 샘플. </li></ol></li><li> Protocorm 같은 기관 (PLBs) <ol><li> 단계 1.2.3.1에서와 동일한 성장 조건에 따라 이전에 10 곳 바와 같이 T2는 한천 플레이트 재생에 난초 PLBs 성장. 8mm - (5)의 높이에서 10 PLBs를 수집합니다. </li></ol></li><li> 잎 샘플 <ol><li> 단계에 설명 된대로 성숙한 접 난초 식물의 잎 조직을 수집1.2.1.1. </li><li> 두 번째 새로 개발 된 잎에서 잎 조직 (7mm 길이 X 5mm 폭)의 작은 조각을 잘라 날카로운 메스를 사용합니다. </li></ol></li><li> 루트 샘플 <ol><li> 단계 1.2.1.1에서 설명 된 것과 동일한 설비를 사용하여 날카로운 메스를 사용하여 루트 팁 조직 1cm 길이를 해부. </li></ol></li><li> 젊은 스파이크 <ol><li> 길이 10cm 스토킹 꽃의 끝 부분에서 젊은 스파이크 조직을 잘라 날카로운 메스를 사용합니다. </li></ol></li><li> 꽃 봉오리 <ol><li> 난초 꽃 줄기의 직경 5mm의 작은 꽃 봉오리를 절제. 꽃 봉오리 조직 종 (두께 3mm)의 일부를 잘라. </li></ol></li><li> 잎 조직과 곡물의 이삭 조직 <ol><li> 쌀, 밀, 옥수수 식물의 첫 번째 새로 개발 된 잎에서 1cm 길이 잎 블레이드 조직을 잘라. </li><li> 식물에서 10 이삭 (쌀, 밀, 옥수수) 개화 전에 일일를 수집합니다. </li></ol></li></ol></li><li> 정착<ol><li> 15 mL의 빙냉 PFA 고정 제를 함유하는 유리 섬광 바이알로 전송하여 즉시 식물 시료를 고정. </li><li> 4 ° C 차가운 방에서 식물 샘플을 진공 (~ 720mm 수은)을 적용합니다. 15 진공 상태에서 - 20 분 (작은 거품이 샘플에서 분리되어야한다). 조직의 대부분이 진공의 릴리스 이후에 가라 앉을 때까지이 단계를 반복합니다. 밤새 진공을 잡고 다음날 천천히 진공을 놓습니다. </li></ol></li><li> 탈수 참고 : 침투 단계를 고정에서 같은 병을 사용합니다. 부어 또는 이전 단계에서 솔루션을 배수하고 유리 병에 새로운 솔루션의 15 ㎖로 대체 피펫을 사용합니다. 조직의 질감에 따라, 이러한 긴 시간 동안 난초 겨드랑이 새싹, 씨앗, protocorm 및 PLB, 쌀, 밀 이삭, 옥수수 등 열심히 조직을 치료; 이러한 짧은 시간 동안 난초 꽃 봉오리, 젊은 스파이크, 잎과 뿌리, 쌀, 밀 잎, 옥수수와 같은 부드러운 조직을 취급합니다. <oL&gt; <li> 고정 후, 얼음에 10 분 동안 PBS 1X (15) 용액에 샘플을 담가. <ol><li> 다음 실온에서 15 ml의 에탄올 시리즈 샘플 탈수 : 30 % 에탄올에서 30 분, 50 % 에탄올, 30 분, 70 % 에탄올로 1 시간 동안, 단단한 조직을 54 분, 더 부드러운 조직을 30 분 동안 85 % 에탄올, 더 열심히 조직 54 분, 부드러운 조직에 대한 30 분, 세게 조직 54 분, 부드러운 조직을 30 분 동안 두 번 100 % 에탄올 95 % 에탄올. 주 : 식물 시료는 여러 달 동안 4 ℃에서 70 % 에탄올에 저장 될 수있다. </li></ol></li></ol></li><li> 파라핀 침투 <ol><li> 다음과 같이 실온에서 단단한 조직을 54 분으로 각각 연약한 조직을 30 분 동안 15 ml의 에탄올 및 크실렌 대체 혼합물 샘플을 침투 : 에탄올 / 크실렌 대용품 (2 : 1, V / V), 에탄올 / 크실렌 대체물 (1 : 1, V / V), 에탄올 / 크실렌 대체물 (1 : 2, V / V), 회 순수 크실렌 대체물. 주의 : 크실렌 독성이다. 흄 후드에서이 단계를 수행합니다. </리&gt; <li> 밤새 어렵게 조직에 대해, 60 ° C의 오븐에서 15 ml의 크실렌 대체물 파라핀 혼합물을 유리 병에 시료 침투 및 소프 조직 60 분 동안 다음과 같이 크실렌 대체물 / 파라핀 (2 : 1, V / V) 크실렌 대체물 / 파라핀 (1 : 1, V / V) 및 크실렌 대체물 / 파라핀 (1 : 2, V / V). </li><li> 하루에 두 번 15 ml의 순수한 파라핀 샘플을 침투 오븐에서 60 ° C에서 품어. </li><li> 단계를 반복 다음날 1.5.3. </li></ol></li><li> 조직 삽입 <ol><li> 파라핀 블록에 조직을 삽입하기 전에 파라핀 저수지의 왁스를 녹여 사전에 조직을 포함 센터 1 시간의 전원을 켭니다. </li><li> 62 ° C에서 온난화 트레이의 금형 (기본 3.3 cm 길이 × 2 cm 폭의 크기)를 따뜻하게하고, 몰드베이스로 약 13 ml의 녹은 왁스를 붓는다. </li><li> 가온 집게 금형에 섹션 1.5.4에서 하나의 조직 샘플을 전송하고 원하는 위치로 방향. </li><li> 금형 이동왁스가 응고 될 때까지 조심스럽게 냉각 판에, 떠나. </li></ol></li></ol> 2. 조직 단면 <ol><li> 파라핀 절편 방법 <ol><li> (섹션 1.6.2에 같은 크기) 금형의 상단에 매립 카세트를 배치하여 왁스베이스를 확인 녹은 왁스를 작성하고 왁스가 응고 된 후 몰드를 제거합니다. 참고 : 삽입 카세트 샘플 파라핀 블록을 고정하는 왁스 기반을 형성 할 것이다. </li><li> 적절한 모양과 크기로 파라핀 블록을 손질하고 평평한 주걱에 약간의 왁스 조각을 배치합니다. 왁스 용융 될 때까지 알코올 버너를 사용하여 왁스 조각을 가열 한 다음 블록을 준수 섹션 2.1.1에 왁스베이스에 녹은 왁스를 배치합니다. 마이크로톰에 클램프. </li><li> 마이크로톰에 새로운 블레이드를 배치하고, 마이크로톰의 절편을 촉진하기 위하여 5도까지 각도를 조정합니다. </li><li> 이전 11 설명 된 바와 같이, 얇게 (10 μm의)에 샘플 파라핀 블록을 잘라. </li> &lt;/ OL&gt; </li><li> 하이브리드 잘라 단면 처리 방법 <ol><li> 면도날을 사용하여 적절한 크기의 상단에서 사다리꼴 표면 열에 단계 1.6.4에서 샘플 파라핀 블록을 낸다. </li><li> 그라 이오 스탯 무대의 중심으로 일부 최적의 절단 온도 화합물 OCT ()를 추가합니다. 그라 이오 스탯 단계로 파라핀 블록을 부착하고 신속하게 원하는 위치로 상기 조직 블록을 배향. </li><li> 그라 이오 스탯 챔버에 파라핀 블록 / 스테이지를 전송합니다. OCT를 10 분 동안 -42 ℃에서 빠른 동결 바에서 응고 할 수 있습니다. 10월 (그림 2C)의 응고시에 블록을 이동하지 마십시오. </li><li> 그라 이오 스탯 어댑터와 챔버 온도가 저온 유지 장치 어댑터에 파라핀 블록 / 무대를 부착하기 전에 -20 ° C 및 -16 ° C에 각각 냉각 할 수 있습니다. 두께 10 μm의 섹션 조직. </li><li> 집게로 조직 섹션을 선택합니다. 폴리에 800 μL의 DEPC 처리 된 물에 섹션을 플로트 - L을 - 라이신 COA를테드 슬라이드와 42 ° C에서 핫 플레이트에 슬라이드를 전송합니다. </li><li> 섹션 42 ° C에서 DEPC 처리 된 물에 평평하게 할 수 있습니다. 가장자리에서 물을 배수 필터 종이를 사용합니다. </li><li> 하룻밤 42 ° C 핫 플레이트에 슬라이드를 배치하여 슬라이드에 마운트 조직. </li></ol></li></ol> 3. 조직 염색 <ol><li> 탈 파라핀 <ol><li> 핫 플레이트에서 슬라이드를 수집하고 염색 랙에 배치합니다. 흄 후드에서 염색 항아리에 150 ml의 자일 렌을 추가하고 5 분 동안 크실렌에서 랙을 담그지. </li></ol></li><li> 재수 <ol><li> DEPC 처리 된 물에 에탄올 용액의 다양한 농도 (100 %, 95 %, 70 %, 50 %, 30 %)을 준비하여, 각각 별개의 염색 단지에 용액 150 ㎖를 채운다. </li><li> 에탄올 농도, 실온에서 3 분 동안 각 단계가 감소하는 일련의 샘플 재수. 얼룩에 슬라이드를 이동하면 다른 병 들어있는 D 한 병 랙ifferent 에탄올 농도 : 100 % 에탄올, 95 % 에탄올, 70 % 에탄올, 50 % 에탄올, 30 % 에탄올. </li><li> 수분 보충 한 후, 3 분 동안 DDH 2 O의 표본을 담그지. </li></ol></li><li> 헤 마톡 실린 염색 <ol><li> 1.5 분 동안 헤 마톡 실린 용액 조직 슬라이드를 침지 얼룩 조직 샘플. </li><li> 다음 몇 초 동안 12 N의 염산 (HCL) 2 방울 및 DDH O. 2에 간단히 세척 1 - 2 O가 함유 DDH에서 간단히 헹구어 </li></ol></li><li> 탈수 <ol><li> 30 % 에탄올, 50 % 에탄올, 70 % 에탄올, 95 % 에탄올, 100 % 에탄올 : 실온에서 3 분 동안 에탄올 농도가 증가하는 일련의 샘플을 탈수. 5 분 동안 흄 후드에서 자일 렌으로 표본을 취소합니다. </li></ol></li><li> 설치 <ol><li> 슬라이드에 크실렌 기반 장착 매체의 적절 600 μl를 삭제합니다. 조심스럽게 시편 위에 커버 슬립을 배치합니다. 좋은 품질의 이미지를 얻을 수 형성 공기 방울을 피하십시오. </li><li> 슬라이드가 건조 하룻밤을 방송 할 수 있습니다. 다음 날 현미경으로 시료를 관찰한다. 참고 : 이미지는 표본의 크기에 따라 400 배 배율로 25X에서 촬영되었다. </li></ol></li></ol> 현장 하이브리드 4. <ol><li> 프로브 합성 <ol><li> 복제 접 아프로디테 액틴 유전자 특정 코딩 서열 사용하여 프라이머 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;와 5&#39; AGGACAGAAGTTCGGCTGGC -3&#39;(242 bp의 PCR 증폭 물을 얻기 위해) 및 CyclinB1 1 유전자 특정 코딩 서열 사용하여 프라이머 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39; 및 5&#39; ATGAGCATGGCGCTAATACC-3 &#39;(327 bp의 PCR 증폭 물을 얻기 위해) 12 설명 된대로. </li><li> 제조 업체의 프로토콜에 따라 (예를 들면 pGEMT)를 벡터로 특정 코딩 서열을 결찰. </li><li> 디그 옥시 제닌 생성 (DIG)는 제조업체의 지시에 따라 SP6 / T7 DIG RNA 라벨 키트를 사용하여 센스 및 안티센스 프로브를 표시에스. </li></ol></li><li> 현장 하이브리드에 <ol><li> 하이브리드 컷 방법을 사용하여 생성 된 2 차 및 3 차 겨드랑 꽃 봉오리 조직 조각 (10 μm의 두께) 절단 및 코팅 된 슬라이드에 슬라이스를 탑재합니다. </li><li> 크실렌 Deparaffinize 조직 절편 (3.1.1 참조) 에탄올 농도 (3.2.2 참조) 감소하는 재수, 30 분 동안 37 ° C에서 2 ㎎ / ㎖ 프로 테이나 제 K의 다이제스트. </li><li> 프로토콜에 따라 현장 하이브리드에 수행 이전에 59 ° C 및 CyclinB1 60 ° C로 액틴을위한 하이브리드 온도, 즉 일부 수정과 11,13 설명;. 1 40 NG의 DIG 표지 RNA 프로브와 슬라이드를 혼성화. </li><li> 11 바와 같이 하이브리드 화 신호를 검출하기 nitroblue 테트라 졸륨 / 5- 브로 모 -4- 클로로 -3- 인돌 릴 포스페이트 (NBT / BCIP) 용액을 사용한다. </li></ol></li></ol>

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

식물 세포는 식물 조직 절편 동안 조직 인열 문제를 일으킬 단단한 세포벽 강인한 섬유, 결정, 높은 수분 함량을 갖는다. 파라핀 계 단면 자주 식물 조직에 사용 되더라도 내인성 결정들은 (도 1) 절편 동안 식물 조직을 가르기. 때문에 식물 세포 내에서 본질적으로 높은 수분 함량, 저온 유지 절편 기반 자주 끊어 세포 금 조직 절편시킨다. 본 연구에서는 하이브리드 컷라는 이름의 결합 파라핀 삽입 및 동결 절단 (Cryosections) 프로토콜을 개발하고 좋은 품질의 조직 절편을 얻었다. 이 프로토콜은 파라핀 삽입을 도입하여 높은 수분 함량과 관련된 문제를 해결하고, (그림 3) 절편 동안 낮은 온도에서 파라핀 왁스를 경화에 의해 찢어 효과를 감소시킨다. 따라서이 수정 된 프로토콜은 하나 파라핀 기반 SECTIO 이상 유리하다닝 또는 식물 조직의 무결성을 유지하기위한 냉동 절편. 이 원고는 하이브리드 컷 방법 결정 (그림 3-4)의 높은 수준을 포함하는 등 겨드랑이 새싹, 씨앗, 그리고 PLB, 같은 호 접 난초의 많은 조직에서 조직의 무결성을 유지 것을 보여줍니다. 또한,이 프로토콜은 높은 실리카 (그림 5-6)를 포함 생식 기관, 쌀, 옥수수 잎, 밀 같은 곡물 의무가 있습니다. 아마도,이 프로토콜은 높은 섬유를 함유하는 우디 플랜트에 적용될 수있다. 일반적으로, 고정 조직은 철저히 하이브리드 컷 매우 중요하다. 우리는 포름 알데히드 알코올 산성 산 (FAA) 정착는 PFA는 축 방향 등 싹, 뿌리, 그러나, PFA는 RNA의 무결성을 보존에 FAA보다 더 나은 작품으로 일부 완강히 저항하는 조직의 조직 무결성을 유지하는 것보다 낫다 발견했다. 따라서 PFA는 해결하는 것이 좋습니다현장 하이브리드에서 (ISH) 작업 샘플. 여기에 설명 된 프로토콜을 RNA ISH 실험을 위해 설계된다. 따라서, 모든 시약은 DEPC 처리 된 RNase하여 오염을 제거하여 RNA 분해를 방지하기 위해 제조 하였다. 하이브리드 컷 부분은 해부학 적 연구, 일반 역 삼투압 (RO) 물과 파생 버퍼 또는 시약은 허용합니다. 3 mm 이하로 시험편 크기 및 두께를 감소하기위한 침투 유용하다. 또한, 탈수 및 침투에 대한 증가 침지 시간은 하드 질감 조직을 위해 필요하다. 이 프로토콜의 제한은 불충분 한 고정, 탈수, 그리고 시편의 침투로 인한 문제로 인해 수 있습니다. 따라서, 각 단계에 대한 처리 시간의 조정은 우수한 파라핀 블록을 생성하는 것이 중요하다. 일반적으로, 더 열심히 조직은 부드러운 조직보다 처리 시간 이상이 필요합니다. 또한, 우리는 하이브리드 컷 조합 위스콘신에서 성공적 일 것으로 나타났다제 ISH 선택된 사체 (도 7)의 공간 분포를 제공한다. 요약하면,이 프로토콜은 식물 해부학의 연구에 유용하고, 선택된 유전자의 조직 특이 적 RNA지도를 제공합니다. 또한 그러한 터미널 데 옥시 뉴 클레오 타이 딜 트랜스퍼 dUTP 닉 엔드 (nick end) 표지화 (TUNEL) 분석, 형광성 원위치 하이브리드 화 (FISH), 및 면역 기술과 같은 다른 분자 연구에 적용될 수있다. 결론적으로,이 개선 된 조직 절편 프로토콜은 유용하고 식물 사회 연구원에 도움이 둘입니다.

파라핀 계 단면 처리 방법은, 해부학 적 연구가 광범위하게 사용되는 기술이다. 손상 조직의 해부학의 보존 형태 학적 및 생물학적 연구에 중요하다. 파라핀이 매립 세포 및 조직 형태를 유지하고 있기 때문에, 파라핀 포매 절편 기술이 유리하다. 또한, 파라핀 블록은 오랫동안 편리하게 저장 될 수있다. 그러나, 파라핀 절편 세포 내 결정을 포함하는 식물 조직에 적합하지 않다. 세포 내 결정은 종종 절편 동안 파라핀 리본과 손상 조직의 무결성을 찢어. 파라핀 절편 달리 저온 절편 비교적 빠르며 섹션은 고정 직렬 탈수 또는 중간 침투 한 매립하지 않고 얻을 수있다. 저온부 많은 같은 면역와 같은 응용 프로그램에서 현장 하이브리드 및 효소 조직 화학와 호환됩니다. 냉동 절편의 또 다른 장점은이 방법은 높은 온도와 화학적 처리 등의 잠재적 인 변성 과정을 통과하지 않는, 그래서 세포 분자 잘 조직 2 항 내에서 유지됩니다. 냉동 절편은 일반적으로 파라핀 계 동물 조직에서의 연구에 절편 위에 바람직하다. 온도 차는 것은 때때로 부분의 무결성의 품질에 영향을 얼음 결정의 형성을 초래하기 때문에, 저온 절편 식물의 첫번째 선택이 아니다. 삼투는 수 크로스 용액, 폴리에틸렌 글리콜 (PEG) 또는 글리세롤 (3)로 동결 조건 결정 얼음 형성을 감소하는 것으로보고되었지만, 개선 최적 이하이다. 서로 다른 환경에 적응하기 위해 다른 식물은 종종 별개의 조직 질감과 식물 세포가 단단한 세포벽, 거친 섬유 및 결정 4,5를 형성하기 위해 진화해야합니다. 예를 들어, 불용성 칼슘 옥살 레이트 결정 실리카 몸은 비슷한 공통식물 6. 규산 몸은 / 결정 공장 건축, erectness을 유지하는 데 도움이, 시리얼 공장 7-9에서 질병이나 해충을 방지하기 위해보고되었다. 화분에 심는 난초와 컷 꽃 난초 시장이 번성하고, 그것은 성장하는 산업이다. 접 아프로디테 (엄 난초)는 대만에서 가장 중요한 수출 관상용 식물 중 하나입니다. 상당한 노력이 접 난초의 꽃 프로세스의 형태 학적 및 생리 학적 변화를 이해하게되었습니다. 호 접 난초의 꽃 스파이크는 잎 기지에서 겨드랑이 싹에서 시작됩니다. 멋진 주변 온도의 기간 후에 (약 반 개월), 겨드랑이 싹이 확대, 휴면 휴식, 젊은 꽃 스파이크로 개발하기 위해 잎 기지에서 돌출. 생리 학적, 세포 및 스파이크 개시 분자 과정을 이해하기 위해서는 visua하는 해부학 강력한 기술을 개발하는 것이 필수적이다적시에 리제 조직 또는 마커. 그러나, 런 조직에서 편재 결정의 존재는 특히 겨드랑이 싹 해부학 작업이 곤란한다. 여기에서 우리는 지금까지 기술적 도전으로 간주 된 난 분해성 식물 조직의 섹션의 무결성을 개선하기 위해 노력했다. 여기에서 우리는 하이브리드 컷라는 이름의 개선 된 프로토콜을 보여줍니다. 이는 저온 유지 장치를 이용하여 수행되는 파라핀 계 단면 처리 방법이다. 파라핀 삽입은 식물 조직에서 높은 수분 함량을 해결합니다. 파라핀 블록은 낮은 온도에서 경화 단면, 문제를 찢어 결정을 줄이고, 상당히 조직의 무결성을 향상시킨다. 이 프로토콜은 크게 완강히 저항하는 식물 샘플에 대한 조직의 무결성을 향상시킨다.

<table><tbody><tr><td>Embedding Center model EC780-1</td><td>CSA</td><td></td><td></td></tr><tr><td>Microtome model RM2255</td><td>Leica</td><td></td><td></td></tr><tr><td>Cryostat model CM 1950</td><td>Leica</td><td></td><td></td></tr><tr><td>Axio Scope A1 microscope&amp;nbsp;</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Murashige &amp;amp; Skoog medium including vitamins</td><td>Duchefa Biochemia</td><td>M0222.0050</td><td></td></tr><tr><td>RNase free surface decontaminant</td><td>Apex</td><td>10-228</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>Bio Basic Inc.&amp;nbsp;</td><td>D801154</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>MDBio, Inc.</td><td>101-7647-14-5</td><td></td></tr><tr><td>Potassium chloride, crystal (KCl)</td><td>J.T. Baker</td><td>7447-40-7</td><td></td></tr><tr><td>Sodium phosphate dibasic (Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7558-79-4</td><td></td></tr><tr><td>Potassium phosphate monobasic (KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7778-77-0</td><td></td></tr><tr><td>Paraformaldehyde (PFA)</td><td>Sigma-Aldrich</td><td>16005</td><td></td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Showa</td><td>19430160</td><td></td></tr><tr><td>Sulfuric acid (H&lt;sub&gt;2&lt;/sub&gt;SO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7664-93-9</td><td></td></tr><tr><td>Glutaraldehyde solution</td><td>Sigma-Aldrich</td><td>111-30-8</td><td></td></tr><tr><td>Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td><td>J.T. Baker</td><td>9005-64-5</td><td></td></tr><tr><td>Octyl Phenol Ethoxylate (Triton X100)</td><td>J.T. Baker</td><td>9002-93-1</td><td></td></tr><tr><td>Glass scintillation vials</td><td>Newastar</td><td>DG60805-00020</td><td></td></tr><tr><td>Desiccator vacuum</td><td>Violet Bioscience Inc.</td><td>TS-402030</td><td></td></tr><tr><td>Rotary vane pump RZ2.5</td><td>Vacuubrand</td><td>36149406</td><td></td></tr><tr><td>Ethanol</td><td>J.T. Baker</td><td>64-17-5</td><td></td></tr><tr><td>Sub-X&amp;nbsp;</td><td>Leica Surgipath</td><td>3803670</td><td>Xylene substitute</td></tr><tr><td>Paraplast Plus&amp;nbsp;</td><td>Leica Surgipath</td><td>39602004</td><td>Tissue embedding paraffin</td></tr><tr><td>SUPERFROST micro slide glass</td><td>Matsunami</td><td>S7441</td><td></td></tr><tr><td>FSC 22 Clear&amp;nbsp;</td><td>Leica Surgipath</td><td>3801480</td><td>Optimal Cutting Temperature compound (OCT)&amp;nbsp;</td></tr><tr><td>Xylenes, Purified</td><td>Leica Surgipath</td><td>3803665</td><td></td></tr><tr><td>Hematoxylin</td><td>Merck</td><td>HX305311</td><td></td></tr><tr><td>Hydrochloric acid (HCl)</td><td>Sigma-Aldrich</td><td>7647-01-0</td><td></td></tr><tr><td>Micromount</td><td>Leica Surgipath</td><td>3801731</td><td>Mounting medium</td></tr><tr><td>pGEM T-easy vector</td><td>Promega</td><td>A1360</td><td></td></tr><tr><td>Proteinase K</td><td>Roche</td><td>3115879001</td><td></td></tr><tr><td>SP6/T7 DIG RNA Labeling Kit</td><td>Roche</td><td>11175025910</td><td></td></tr><tr><td>NBT/BCIP stock solution</td><td>Roche</td><td>11681451001</td><td></td></tr></tbody></table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

식물 부분의 무결성을 유지하는 세포, 조직, 또는 기관 수준에서 해부학 적 구조의 상세한 연구를 위해 필수적이다. 그러나, 일부 식물 세포는 단단한 세포벽 강인한 섬유 결정을 (옥살산 칼슘, 실리카 등), 및 높은 수분 함량은 종종 식물 조직 절편 동안 조직의 무결성을 파괴하는. 이 연구는 간단한 하이브리드 잘라 조직 절편 방법을 설정합니다. 이 프로토콜은 파라핀 계 단면 기법을 수정 및 다른 식물의 조직 절편의 무결성을 향상시킨다. 식물 조직은 -16 ℃에서 저온 유지 장치 (cryostat)에 절편 전에 파라핀 하였다. 파라핀 블록, 감소 찢어 및 긁힘, 크게 개선 된 조직의 무결성은 낮은 온도에서을 경화 단면. 이 프로토콜은 성공적으로 생식 ORGA 칼슘 옥살 레이트 풍부한 호 접 난초 조직뿐만 아니라 난 분해성 조직에 적용 하였다NS, 쌀, 옥수수, 밀 잎. 또한, 하이브리드 컷 조직 절편의 높은 품질은 관심 유전자의 발현 패턴의 공간을 제공하기 위해 원위치 혼성화 (ISH)의 병용 할 수있다. 결론적으로,이 프로토콜은 높은 결정 실리카 함량을 함유 분해성 식물 조직에 특히 유용하다. 좋은 품질의 조직 섹션은 형태 학적 및 기타 생물학적 연구를 할 수 있습니다.

하이브리드 컷은 조직 섹션의 무결성을 향상 생식 꽃 구조의 해부학을 이해하는 것은 난초 꽃 개시의 기본 메커니즘을 조사하는 것이 중요하다. 그러나 호 접 난초의 세포 내 칼슘 옥살 레이트 결정의 축적은 연구에게 도전적인 작업을합니다. 섹션화 처리 (도 1) 중에 결정 의한 찢어짐과 관련된 문제를 피하기 위해, 우리는 하이브리드 컷라고하는 시스템을 개발 하였다. 이 프로토콜은 기존의 파라핀 삽입 및 동결 절단 (Cryosections) 기술을 결합합니다. 우리는 최초의 하이브리드 컷들이 조직 강성과 높은 결정 내용에 대한 악명 때문에 접 난초의 겨드랑이 새싹에서 테스트. 겨드랑이 새싹 조직은 4 % PFA에서 수정되었습니다 (프로토콜, 단계 1.3 참조). 시리얼 에탄올 탈수 및 파라핀 왁스 난 후nfiltration, 겨드랑 꽃 봉오리는 파라핀 블록에 포함되었다. 블록은 (그림 2A)을 절편하기 전에 적당한 크기로 손질했다. 의 OCT 소량 후 저온 유지 단계 (도 2b)의 중앙에 적용 하였다. 파라핀 블록이어서 10월 통해 스테이지에 부착 하였다. 스테이지는 (도 2c)를 전 단면 처리의 OCT 완전한 응고를 허용하도록 10 분 동안 저온 유지 장치에서 배양 한 후, 동결 절단 (Cryosections)는 -16에서 수행 하였다 ° C 챔버 (그림 2D). 비교로서, 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록은 일반 마이크로톰 절편을 실시 하였다. 도 1a에 도시 된 바와 같이, 파라핀 리본 심한 인열은 마이크로톰 절편 후에 관찰 하였다. 조직의 무결성 및 세포의 구조는 (그림 1B) 손상되었다. 하이브리드 컷 반면보존 된 구조적 완전성 (도 3b)로 생성 손상 조직 절편 (도 3A). 적용 P.의 다양한 조직에 하이브리드 - 컷 아프로디테 또한 하이브리드 컷의 복종 할 의무를 테스트하기 위해, 우리는 호 접 난초의 다른 조직을 테스트했다. 이 때문에 경화 시드 코트 잘 조직 무결성 종자 부분을 획득하는 것이 어렵다. 이 프로토콜을 이용하여, 종자의 상세한 구조 (도 4a)를 절편 한 후 유지 하였다. 도 4a 단백질 체에 도시 된 바와 같이, 공통 스토리지 제품 (14)은 명확하게 식별 될 수있다. 하이브리드 컷이 성공적으로 일을하고 한 달 오래 protocorm의 촬영 혀끝의 분열 조직 (씨앗에서 발아 구조) (그림 4B)의 세부 구조를 보여protocorm 같은-기구 (PLBs, 그림 4C). 세포 내 결정은 두껍고 즙이 많은 잎 PLB. 호 접 난초의 섹션에서이 관찰되었다 그들은 CAM 식물 (CAM) 형 광합성 (15)을 수행합니다. 리프 블레이드의 횡단면은 목부와 사부 (도 4d)를 포함하는 많은 엽육 세포 관다발을 보였다. 몇몇 기공 개구 낮 (도 4d) 동안에 축외 잎 표면을 관찰 하였다. 사실, CAM 식물 탄소 이득을 최대화하지만, 동시에 건조 조건 하에서 15,16 밤 그들의 stomates를 열어 물 손실을 최소화하도록 진화. P.의 루트 혀끝의 분열 조직 아프로디테는 그림 4E에 표시됩니다. 루트 팁 세포는 잘 (도 4E)를 절편 한 후 보존 된 결정의 상당수를 포함 나타났다. 젊은 꽃 스파이크의 길이 섹션은 정보 흐름을 제공젊은 꽃 primordials (그림 4 층)의 구조에 대해 이온. 또한, 꽃받침 잎은 꽃잎, labellum 및 pollinia 명확하게이 5mm 꽃 봉오리 (그림 4 세대)의 분화를 완료 한 젊은 꽃 봉오리의 종단면에서 확인 할 수있다. 결정이 젊은 꽃 봉오리의 꽃받침 잎에 축적 된 것을 알 수 있습니다. 즉,이 프로토콜은 조직 무결성을 유지하기 위해 지속적으로 작동하고 해부학 가능한 세포의 연구를 가능 본래 형태를 생성한다. 하이브리드 컷은 시리얼 작물의 조직 무결성을 보존 우리는 또한 하이브리드 컷 높은 실리카 함량 (17, 18)를 포함하는 쌀, 밀, 옥수수 등의 곡물 테스트. 도 5에 도시 된 바와 같이, 쌀, 밀, 옥수수 잎의 횡단면의 조직 무결성 크게 향상되었다 하이록BRID 컷 방법을. 수분 손실을 방지하기 위해 리프 블레이드의 롤링을 제어 목부, 체관부, 엽육 세포 stomates 및 bulliform 세포 명확 벼 잎의 섹션에서 확인되었다. 크란츠 해부학, 엽육 세포와 옥수수 잎 (19, 20)의 관다발이 명확하게 확인되었다. 옥수수 잎 (그림 5)의 향축과 배축 양측에 stomates의 높은 밀도를 찾을 흥미로운했다. 옥수수 0.7의 향축과 배축 기공의 비율은 이전 21보고되었다. 또한,이 프로토콜은 쌀, 밀, 옥수수 (도 6)에서 이삭의 상세한 세포 형태를 제공하기 위해 성공적으로했다. 이삭이 풍부한 실리카 구를 포함하는 것으로 알려져있다. 일반적으로, 그 조직 절편을 수행에 어려움이 발생합니다. 현장 하이브리드에 인 - 시튜 하이브리드 화 (ISH)는 티슈 레벨 11에서의 유전자 발현 패턴 국산화 개발되었으며, 22-25. 또한, ISH 셀룰러 제공 할 수있는 경우 서브 셀룰러 다세포 유기체 26 mRNA의 분포 해상도. ISH 중에 RNA 조직 무결성 선택된 스크립트에 대한 신뢰성있는 공간 정보를 얻는 것이 중요하다. 우리는 하이브리드 컷 프로토콜을 사용하여 ISH 테스트 액틴 유전자 (PATC157348가) 프라이머 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;와 5&#39; AGGACAGAAGTTCGGCTGGC -3&#39;242 bp의 PCR의 증폭 사이클린의 B1 얻을 사용하여 복제되었다.. 1 (PATC146999) 유전자가 특정을 코딩 서열 사용하여 프라이머 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39;와 5&#39; ATGAGCATGGCGCTAATACC-3&#39;327 bp의를 얻기 위해 PCR 증폭 물. ISH, 액틴과 사이클린은 B1 후 : 1 유전자 발현 젊은 성숙한 겨드랑이 새싹에서 모니터링 하였다 강한 신호가 3 차 겨드랑이 싹이 검출와 (그림 7). 두 유전자는, 2 차 및 3 차 겨드랑이 새싹의 분열 세포에서 발현되었다. 이러한 결과는 하이브리드 컷 좋은 해부학을 유지하고 공간 유전자 발현 패턴을 제공하고 있다고 설명했다. <img alt="그림 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> 그림 1 : 전통적인 파라핀 섹션 조직의 심한 찢어 원인 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록은 일반 마이크로톰 절편을 실시 하였다.. 파라핀 리본의 심한 파열이 전통적인 마이크로톰 절편 후 관찰되었다 (A) </strong&gt;. 조직의 무결성 및 세포 구조는 (B) 손상되었다. 화살표는 조직 절편의 심한 인열을 나타낸다. 화살촉은 결정 몸을 보여줍니다. 스케일 바 100 μm의. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> 그림 2 :. 하이브리드 컷 단면의 메소드 겨드랑 꽃 봉오리 조직은 PFA에서 수정되었습니다 및 조직은 파라핀 왁스와 함께 침투, 탈수 및 파라핀 블록에 포함. 파라핀 블록을 적당한 크기 (A)로 트리밍 하였다. 최적의 절단 온도 화합물 OCT ()는 저온 유지 스테이지 (B)의 중심에 적용 하였다. 파라핀 블록은 저온 유지 장치 무대에서 OCT를 부착했다. 저온 하에서, 파라핀 블록<html> 10월 (C)를 통해 저온 유지 스테이지에 부착 하였다. 조직 슬라이스는 -16 ° C의 (D)에서 저온 유지 챔버에서 절단 하였다. 스케일 바는 0.5 cm (A), 1 cm (BD)를 나타냅니다. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> 그림 3 : 하이브리드 컷 절 무결성을 향상 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록 (A)를 절편 하이브리드 컷을 실시하고, 하이브리드 컷 방법은 우수한 조직의 무결성 (B)와 섹션을 생산.. 화살촉은 겨드랑이 새싹 조직에 포함 된 내생 결정 몸을 보여줍니다. 스케일 바 100 μm의.rget = &quot;_ 빈&quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> 그림 4 :. 하이브리드 잘라 접 난초의 다양한 조직 섹션에 다른 난초의 응용 프로그램 조직은 성숙 단계 (A), protocorm의 종단면 (B), protocorm 같은 기관의 종단면 (PLB) (C)의 횡단면 동안 난초 씨의 종단면으로, 하이브리드 컷 방법을 사용하여 구분 하였다 잎 블레이드 (D), 루트 (E)의 종단면, 젊은 꽃 스파이크 (F), 젊은 꽃 봉오리 (G)의 종단면의 종단면. 조직 섹션은 헤 마톡 실린으로 염색 하였다. SC, 종피; PB 단백질 본체; 엠,분열 조직; MP, 어머니 PLB; DP, 딸 PLB; 광고, 향축 잎 표면; AB, 배축 잎 표면; 성, 기공; MC, 엽육 세포; VB, 혈관 번들; RC, 루트 캡; FB, 꽃 봉오리; 자체, 꽃받침; PE, 꽃잎; 라, labellum; 포, pollinia; 롬, rostellum; 캘리포니아, 캘러스. 화살촉은 결정을 보여줍니다. 스케일 바는 20 μm의 (AE) 200 μm의 (FG)를 나타냅니다. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> 그림 5 :. 하이브리드 컷이 여러 시리얼 작물의 잎 조직의 무결성을 보존 전통적인 파라핀 방법 (왼쪽 패널) 및 연구 (오른쪽 패널)에서 개발 된 하이브리드 컷 기술을 사용하여 잎 조직의 비교. 이미지는 쌀, 밀, 옥수수의 잎 가로 섹션을 보여줍니다. MC, 엽육 세포; 박사, 체관부; 성, 기공; BC, BU<html> lliform 세포. 화살표는 조직 절편의 파열을 보여줍니다. 화살촉은 실리카 몸을 보여줍니다. 파란색 점선 원은 C4 옥수수에서 크란츠 해부학을 나타냅니다. 규모는 20 μm의 바. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> 그림 6 :. 하이브리드 컷이 여러 시리얼 작물의 이삭 조직 무결성을 보존 전통적인 파라핀과 하이브리드 컷 방법 사이 이삭 부분의 조직 무결성의 비교. 화살표는 조직 절편의 파열을 보여줍니다. 화살촉은 실리카 몸을 나타냅니다. 스케일 바 20 μm의 (쌀), 200 μm의 (밀, 옥수수). <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 1 &quot;&gt; :&quot;유지 - together.within 페이지 = FO &quot;천만에 <img alt="그림 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> 그림 7 : 액틴과 CyclinB1의 제자리 교잡에서, 호 접 난초 2 차 겨드랑이 새싹과 3 차 겨드랑이 새싹의 조직 조각이 하이브리드 컷 방법을 사용하여 제조되었다의 겨드랑이 버드 1 식 패턴.. 액틴 및 CyclinB1 40 NG 총 1 파기 표지 된 프로브가 혼성화에 사용 하였다. 감지 탐침은 음성 대조군으로 사용 하였다. 화살표는 겨드랑이 새싹의 생식 분열 조직을 나타냅니다. 규모는 100 μm의 바. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

하이브리드 컷 : 난 분해성 식물 조직 샘플에 대한 개선 단면 방법

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Universidad San Sebastian

Research

JoVE Journal

Biology

18.8K 조회수.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

비디오: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

Immunohistochemistry에 대한 슬라이스 준비 씬 Sectioning

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

연구

생물학

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of tissue specific expression is limited because of problems in dissecting individual tissues. Expression data needs to be confirmed and complemented with expression patterns using e.g. in situ hybridization, a technique used to localize cell specific mRNA expression. The in situ hybridization method is laborious, time-consuming and often requires extensive optimization depending on species and tissue. In situ experiments are relatively more difficult to perform in woody species such as the conifer Norway spruce (Picea abies). Here we present a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including P. abies. With just a few adjustments, including altered RNase treatment and proteinase K concentration, we could use the protocol to study tissue specific expression of homologous genes in male reproductive organs of one gymnosperm and two angiosperm species; P. abies, Arabidopsis thaliana and Brassica napus. The protocol worked equally well for the species and genes studied. AtAP3 and BnAP3 were observed in second and third whorl floral organs in A. thaliana and B. napus and DAL13 in microsporophylls of male cones from P. abies. For P. abies the proteinase K concentration, used to permeablize the tissues, had to be increased to 3 g/ml instead of 1 g/ml, possibly due to more compact tissues and higher levels of phenolics and polysaccharides. For all species the RNase treatment was removed due to reduced signal strength without a corresponding increase in specificity. By comparing tissue specific expression patterns of homologous genes from both flowering plants and a coniferous tree we demonstrate that the DIG in situ protocol presented here, with only minute adjustments, can be applied to a wide range of plant species. Hence, the protocol avoids both extensive species specific optimization and the laborious use of radioactively labeled probes in favor of DIG labeled probes. We have chosen to illustrate the technically demanding steps of the protocol in our film.
Anna Karlgren and Jenny Carlsson contributed equally to this study.
Corresponding authors: Anna Karlgren at Anna.Karlgren@ebc.uu.se and Jens F. Sundstr&#246;m at Jens.Sundstrom@vbsg.slu.se

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

We describe a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including Norway spruce. With just a few adjustments, including altered RNase treatment and proteinase K concentration, the protocol may be used in studies of different tissues and species.

비 - 방사성 현장에서 하이브 리다이 제이션 노르웨이 스프루스에 대한 해당 프로토콜과 식물 종의 범위

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of ...

Multimodal Hierarchical Imaging of Serial Sections for Finding Specific Cellular Targets within Large Volumes

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a combination of light and electron microscopy. Samples embedded in resin are sectioned into arrays consisting of ribbons of hundreds of ultrathin sections and deposited on pieces of silicon wafer or conductively coated coverslips. Arrays are imaged at low resolution using a digital consumer like smartphone camera or light microscope (LM) for a rapid large area overview, or a wide field fluorescence microscope (fluorescence light microscopy (FLM)) after labeling with fluorophores. After post-staining with heavy metals, arrays are imaged in a scanning electron microscope (SEM). Selection of targets is possible from 3D reconstructions generated by FLM or from 3D reconstructions made from the SEM image stacks at intermediate resolution if no fluorescent markers are available. For ultrastructural analysis, selected targets are finally recorded in the SEM at high-resolution (a few nanometer image pixels). A ribbon-handling tool that can be retrofitted to any ultramicrotome is demonstrated. It helps with array production and substrate removal from the sectioning knife boat. A software platform that allows automated imaging of arrays in the SEM is discussed. Compared to other methods generating large volume EM data, such as serial block-face SEM (SBF-SEM) or focused ion beam SEM (FIB-SEM), this approach has two major advantages: (1) The resin-embedded sample is conserved, albeit in a sliced-up version. It can be stained in different ways and imaged with different resolutions. (2) As the sections can be post-stained, it is not necessary to use samples strongly block-stained with heavy metals to introduce contrast for SEM imaging or render the tissue blocks conductive. This makes the method applicable to a wide variety of materials and biological questions. Particularly prefixed materials e.g., from biopsy banks and pathology labs, can directly be embedded and reconstructed in 3D.

This protocol targets specific cells in tissue for imaging at nanoscale resolution using a scanning electron microscope (SEM). Large numbers of serial sections from resin-embedded biological material are first imaged in a light microscope to identify the target and then in a hierarchical manner in the SEM.

큰 볼륨 내에서 특정 세포 목표를 찾아내기를 위한 직렬 섹션의 복합 계층적 이미징

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a ...

발생학

Preparation of Non-human Primate Brain Tissue for Pre-embedding Immunohistochemistry and Electron Microscopy

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and characterize ultrastructural and morphological details of neurons, such as synaptic contacts. Good preservation of brain tissue for electron microscopy can be obtained by rigorous cryo-fixation methods, but these techniques are rather costly and limit the use of immunolabeling, which is crucial to understand the connectivity of identified neuronal systems. Freeze-substitution methods have been developed to allow the combination of cryo-fixation with immunolabeling. However, the reproducibility of these methodological approaches usually relies on costly freezing devices. Moreover, achieving reliable results with this technique is very time-consuming and skill-challenging. Hence, the traditional chemically fixed brain, particularly with acrolein fixative, remains a time-efficient and low-cost method to combine electron microscopy with immunohistochemistry. Here, we provide a reliable experimental protocol using chemical acrolein fixation that leads to the preservation of primate brain tissue and is compatible with pre-embedding immunohistochemistry and transmission electron microscopic examination.

Here, we provide an easy, low-cost, and time-efficient protocol to chemically fix primate brain tissue with acrolein fixative, allowing for long-term preservation that is compatible with pre-embedding immunohistochemistry for transmission electron microscopy.

면역 조직 화학 및 전자 현미경을 사전은 임베딩에 대한 비 인간 영장류 뇌 조직의 준비

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and ...

신경과학

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

식물의 성적 증명서의 정확한 현지화에 대한 원위치 하이브리드화에서

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

The Cutting and Floating Method for Paraffin-embedded Tissue for Sectioning

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial companies have devised complex section transfer systems using fluid water. To simplify this technology, we created a simple method using homemade equipment that combines cutting and floating within a simple thermostatic chamber; therefore, the sections automatically enter the water bath on the water surface. The hippocampus from adult mouse brains, adult mouse kidneys, embryonic mouse brains, and adult zebrafish eyes were cut using both conventional paraffin sectioning and the presented method for comparison. Statistical analysis shows that our improved method saved time and produced higher quality sections. In addition, paraffin sectioning of a whole specimen in a short time is easy for junior operators.

Here, we present a protocol to improve paraffin sectioning. This method combines cutting and floating using a simple thermostatic chamber to avoid the transfer process required by the conventional method. As a result, the efficiency and the number of intact paraffin sections were greatly improved.

절단 및 파라핀 끼워 넣어진 조직 단면에 대 한 부동 방법

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

샘플링 전략 및 돼지 생물 의학 모델에서 Biobank 조직 샘플의 처리

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

의학

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify transcriptional regulatory networks that govern developmental processes it is necessary to measure the spatial and temporal gene expression profiles of these individual cell types. Therefore, insight into the spatio-temporal control of gene expression is essential to gain understanding of how biological and developmental processes are regulated. Here, we describe a laser-capture microdissection (LCM) method to isolate small number of cells from three barley embryo organs over a time-course during germination followed by transcript profiling. The method consists of tissue fixation, tissue processing, paraffin embedding, sectioning, LCM and RNA extraction followed by real-time PCR or RNA-seq. This method has enabled us to obtain spatial and temporal profiles of seed organ transcriptomes from varying numbers of cells (tens to hundreds), providing much greater tissue-specificity than typical bulk-tissue analyses. From these data we were able to define and compare transcriptional regulatory networks as well as predict candidate regulatory transcription factors for individual tissues. The method should be applicable to other plant tissues with minimal optimization.

Presented here is a protocol for laser-capture microdissection (LCM) of plant tissues. LCM is a microscopic technique for isolating areas of tissue in a contamination-free manner. The procedure includes tissue fixation, paraffin embedding, sectioning, LCM and RNA extraction. RNA is used in the downstream tissue-specific, temporally resolved analysis of transcriptomes.

레이저 캡처 미세 절 RNA-시퀀싱 용 공간 및 측두 조직 -특정 유전자 발현 분석

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify ...

A Simple Dry Sectioning Method for Obtaining Whole-Seed-Sized Resin Section and Its Applications

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are significantly different among different regions of seed. In order to view the morphologies of cells, starch granules and protein bodies clearly, and quantitatively analyze their morphology parameters accurately, the whole-seed-sized section is needed. Though the whole-seed-sized paraffin section can investigate the accumulation of storage materials in seeds, it is very difficult to quantitatively analyze the morphology parameters of cells and storage materials due to the low resolution of the thick section. The thin resin section has high resolution, but the routine resin sectioning method is not suitable to prepare the whole-seed-sized section of mature seeds with a large volume and high starch content. In this study, we present a simple dry sectioning method for preparing the whole-seed-sized resin section. The technique can prepare the cross and longitudinal whole-seed-sized sections of developing, mature, germinated, and cooked seeds embedded in LR White resin, even for large seeds with high starch content. The whole-seed-sized section can be stained with fluorescent brightener 28, iodine, and Coomassie brilliant blue R250 to specifically exhibit the morphology of cells, starch granules, and protein bodies clearly, respectively. The image obtained can also be analyzed quantitatively to show the morphology parameters of cells, starch granules, and protein bodies in different regions of seed.

This technique allows for the fast and simple preparation of whole-seed-sized resin section for the observation and analysis of cells, starch granules, and protein bodies in different regions of the seed.

전체 종자 크기의 수지 섹션 및 응용 프로그램을 얻기위한 간단한 건조 단면 방법

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are ...

Microscopy Techniques for Interpreting Fungal Colonization in Mycoheterotrophic Plants Tissues and Symbiotic Germination of Seeds

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching mycoheterotrophic plants (i.e., plants that obtain carbon from fungi), remarkable aspects of their structural adaptations, the patterns of tissue colonization by fungi, and the morphoanatomy of subterranean organs can enlighten their developmental strategies and their relationships with hyphae, the source of nutrients. Another important role of symbiotic fungi is related to the germination of orchid seeds; all Orchidaceae species are mycoheterotrophic during germination and seedling stage (initial mycoheterotrophy), even the ones that photosynthesize in adult stages. Due to the lack of nutritional reserves in orchid seeds, fungal symbionts are essential to provide substrates and enable germination. Analyzing germination stages by structural perspectives can also answer important questions regarding the fungi interaction with the seeds. Different imaging techniques can be applied to unveil fungi endophytes in plant tissues, as are proposed in this article. Freehand and thin sections of plant organs can be stained and then observed using light microscopy. A fluorochrome conjugated to wheat germ agglutinin can be applied to the fungi and co-incubated with Calcofluor White to highlight plant cell walls in confocal microscopy. In addition, the methodologies of scanning and transmission electron microscopy are detailed for mycoheterotrophic orchids, and the possibilities of applying such protocols in related plants is explored. Symbiotic germination of orchid seeds (i.e., in the presence of mycorrhizal fungi) is described in the protocol in detail, along with possibilities of preparing the structures obtained from different stages of germination for analyses with light, confocal, and electron microscopy.

This protocol aims to provide detailed procedures for collecting, fixing, and maintaining mycoheterotrophic plant samples, applying different microscopy techniques such as scanning and transmission electron microscopy, light, confocal, and fluorescence microscopy to study fungal colonization in plants tissues and seeds germinated with mycorrhizal fungi.

균종속영양 식물 조직의 곰팡이 집락화 및 종자의 공생 발아를 해석하기 위한 현미경 기술

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching ...