Bu eser Guangdong doğal Bilim Vakfı Çin (2015A030313500), il anahtar uluslararası kooperatif araştırma platformu ve büyük bilimsel araştırma projesi, Guangdong Yükseköğretim (2015KGJHZ015), bilim tarafından finanse edildi ve Teknoloji planı Guangdong tütün tekel Yönetim (201403, 201705), bilim ve teknoloji planı Guangdong, Çin (2016B020201001), Ulusal İnovasyon eğitimi projesi için lisans öğrencileri (201711078001). Ticari adlar veya ticari ürünler bu yayındaki söz yalnızca belirli bilgileri sağlamak amacıyla ve tavsiye veya bize Tarım Bakanlığı tarafından onaylandığı anlamına gelmez. USDA bir fırsat eşitliği sağlayıcı ve işveren olduğunu.

1. SSR işaretleri PCR ürünlerinin hazırlanması
<ol><li>Tüm kimyasallar ve Kimyasalları şablon DNA içeren PCR reaksiyonları için hazırlamak (30 ng/µL), 2 × PCR ana mix (2 × PCR arabellek, her dNTP, 3 mM MgCl2, 0.1 U/µL Taq DNA polimeraz ve boyalar 0.4 mM içeren), her 10 µM ileriye ve geriye doğru astar ve distile veya deiyonize su (dH2O). Not: mevcut çalışmada kullanılan SSR işaretleri PT51333 idi (ileri astar sıra: 5 ' - GCACCTTTGGTTATCCGACA - 3' ve ters astar Sıralaması: 5 '- TGCTTTAAGTCATGTACCAAATTGA - 3') ve PT50903 (ileri astar sıra: 5 ' - AAATTTCTTTCGGTGTGATAACTG - 3' ve ters astar sıra: 5'-AGAGACTGCCGTTTGATTTGA-3 ') tütün ve CX-43 (ileri astar sıra: 5'-TGGGGATGTGAGCTTCTTCT-3' ve ters astar sıra: 5' - AGGGTTCCTTTGGGGTGATA-3') ve CX-157 (ileri astar sıra: 5 '- TCGACGCTGACTTCACTGAC-3 ' ve ters astar sıra: 5 '- GGACAGCTTCACACATTTGC - 3') için çiçekli Çin lahanası.</li>
	<li>2 µL şablonunun DNA, 2 × PCR ana karışımı, her ileri astar ve ters astar 0.2 µL ve dH2O. 2.6 µL 5 µL ekleyerek amplifikasyon için 10 µL PCR karışımı hazırlayın</li>
	<li>PCR güçlendirme tepki thermocycler 94 ° C 5 min için bir ilk adım ile gerçekleştirmek, 45 38 döngüsü tarafından takip için denatürasyon, 45 94 ° C'de s s astar tavlama için 55 ° c ve 1 dk. uzantılı 72 ° C'de ve son uzantısı adım 10 dk 72 ° C; o zaman PCR ürünleri daha sonra kullanmak için 4 ° C'de depolayın.</li>
</ol>2. Polyacrylamide için çözümler hazırlanması döküm jelleri
<ol><li>5 × TBE tampon 1 L 54 g Tris temel ve 27,5 g Borik asit dH2O içinde eriterek, 20 mL 0.5 M EDTA (pH 8.0) ekleme ve çözüm için 1, 000 mL dH2O. son hacmi ayarlama hazırlayın Not: TBE tampon oda sıcaklığında ay depolanabilir.</li>
	<li>0,5 × TBE tampon 2 L 200 mL 5 × TBE tampon dH2O 2 L son hacmiyle ekleyerek hazırlamak ve oda sıcaklığında saklayın.</li>
	<li>29 g moleküler biyoloji sınıf Akrilamid ve moleküler biyoloji sınıf N, N 1 g çözülerek % 6 Sigara denaturing polyacrylamide jel çözüm hazır olun '-0,5 × TBE tampon son hacmiyle 500 mL methylenebisacrylamide. Alüminyum folyo ve daha sonra kullanmak için 4 ° C'de mağaza ile çözüm şişe kapağı. Dikkat: Akrilamid güçlü bir nörotoksin kabul edilir ve dikkatle ele alınmalıdır. Her zaman ne zaman toz ve o içermek işleme çözümleri tartı eldiven.</li>
	<li>Bir % 20 amonyum persülfat (APS) çözüm APS 2 g dH2O son hacmiyle 10 mL ile çözülerek hazırlayın. -20 ° C'de ay depolanabilir. Not: kolaylık sağlamak için 10 mL % 20 APS çözeltisi 1,5 mL veya santrifüj tüpleri için depolama-20 ° C'de 2 mL bölünmemeli olabilir Çözülme ve de kullanmadan önce karıştırın.</li>
	<li>Seyreltilmiş bağlama-silane çözüm bağlama-silane %0,5 Asetik asit içeren % 95 etanol 0.997 ml 3 µL çözülerek hazırlayın. Bu hafta için 4 ° C'de muhafaza edilebilir. Dikkat: Bind-silane zehirlidir, çözüm işlerken eldiven giymek ve havalandırılmış Oda tutmak.</li>
</ol>3. hazırlanması Polyacrylamide Jel Elektroforez için
<ol><li>Musluk suyu, bir tam dH2ile O. hava kuru plakaları raf kurutma bir tabak içinde ayarlayarak durulama tarafından takip bir dizi cam plakanın ve çubukları deterjan ile yıkayın.</li>
	<li>1 mL bağlama-silane çözeltisi bir dikdörtgen cam levha ve 5 min için Kuru iç yüzeyine dağıtmak. Not: bind-silane çözüm plaka yüzeyinde düzgün yaymamak jel boyama sırasında ayrılmış olarak ve tatmin edici bir boyama etkisi sonucunda.</li>
	<li>Çentikli cam levha bir bez ile iç yüzeyine püskürtmek-silane 1 mL dağıtmak, aşırı püskürtmek-silane kağıt mendil ile yok etmek ve 5 min için kurutma. Not: repel-silane cam levha yüzeyine eşit şekilde kat değil, jel kısmen sıyırma tarafından zarar verebilir.</li>
	<li>Çentikli plakalı Paspayı ile cam plakanın üzerine montajı ve montaj kelepçeleri döküm ile her iki kelepçe.</li>
	<li>Uygun miktarda (40 mL) 33 cm genişlik × 10 cm yükseklik ve spacer kalınlığı 1.5 mm plaka kümesi için bir ölçek için % 6 Sigara denaturing polyacrylamide jel çözüm dökün, tetramethylethylenediamine (TEMED) 20 µL ve 200 µLfresh %20 eklemek APS ve karışımı yavaşça. Not: Uygun miktarda jel çözüm (40 mL) iki tabak iç birimden çubukları (30 cm × 8,5 cm × 0,15 cm) kalınlığı ile hesaplanır. Jel polimerizasyon için TEMED ve APS miktarı gelince jel eriyik-e doğru TEMED ve başvuru17tarihinde dayalı APS standart bir oran vardır. Yukarıda açıklanan jel çözüm 4 ° C'de depolanan Jel çözüm oda sıcaklığında, TEMED 20 µL ve APS kullanılması gereken % 20 100 µL depolanır. Jel çözüm çözüm içinde hava kabarcıkları önlemek için bir cam sopa ile karışımı hafifçe karıştırın.</li>
	<li>Hemen solüsyonu dökün ve dikkatle çentikli tabak kenarı boyunca monte cam kalıplara neredeyse tepeye boşluğu doldurmak ve tarak ekleyin. Jel çözüm küçük hacmi tarak ekleyin. Not: cam plakanın jel sızıntı gelen önlemek için yatay tutun. Herhangi bir kabarcıklar balonu kanca ile kaldırın.</li>
	<li>Jel 30 dk için oda sıcaklığında ayarlamak izin verir. Not: Jel çözüm ve ortam sıcaklıklarında polimerizasyon süre değişebilir.</li>
	<li>Sonra jel tamamen polimerizasyonu, döküm kelepçeler kaldırmak ve üst arabellek rezervuar doğru bakan çentikli plakalı Elektroforez tankı biriminde tabak seti getirin ve büyük kelepçeler tank birimine ayarla plaka bağlamak için kullanın.</li>
	<li>1 L 0,5 × TBE tampon her üst ve alt rampaları dökün. Tarak kaldırmak ve tüm wells bir pipet veya şırınga kullanarak arabellek ile kanül. Not: jel sandviç alt plaka tamamen olmadan herhangi bir kabarcıklar arabellekte batırılmış olun.</li>
</ol>4. koşma jelleri
<ol><li>Yaklaşık 1 µL PCR ürününün polyacrylamide jel her kuyunun içine yükleyin. DNA boyutu merdivenle jel örnekleri PCR ürünlerinin yanı sıra her iki taraf için yükleyin. Emniyet kapak üst arabellek odasına düzeltmek.</li>
	<li>Müşteri adaylarını kırmızı-kırmızı ve siyah-siyah renk kodlu eşleşen güç kaynağına bağlayın. Jel boya normal ~ 70 dk için tanımlanmış bir konuma ulaşana kadar 110 V sabit bir gerilim çalıştırın. Not: Gerilim ve çalışan zaman PCR ürünleri büyüklüğüne göre ayarlanabilir.</li>
</ol>5. gümüş sigara-Polyacrylamide jel içinde SSR işaretleri algılamak için boyama
<ol><li>Elektroforez sonra bir büyük kabı üzerinden kapak üst odası arabelleğinden drenaj. Yan kelepçeler ayırmak, tabakları cihazları kaldırmak, dikkatle çentikli cam levha bir kenarı boyunca bir spatula ile ayırmak ve diğer cam levha bağlı jel kalır bağlama silane ile kaplı olduğundan emin olun.</li>
	<li>AgNO3 ' te 1 litre dH2O. hazırlamak 1 L / taze geliştirme çözümü 1,5 g NaOH 10 g dH2O 900 ml çözülerek çözülerek taze emprenye çözüm 1 L yapmak, 1 mL % 37 formaldehit ekleyin ve 1 L dH2O. kullanarak son bir seviyesini ayarlamak Not: eldiven giymek ve yukarıdaki kimyasallar ve çözümleri itina ile başa. Çözümler ve çözümleri ile ilgili adımlar bıraktığımız gerek yoktur.</li>
	<li>Dikkatle jel ve cam plaka Elektroforez arabellek kaldırma sonra plaka jel plastik bir tepsi yukarı dönük olacak şekilde yerleştirin ve emprenye çözüm 1 litre jel daldırın geniş dH2O ile yıkayın. Tepsiyi bir shaker koymak.</li>
	<li>Tepsiyi hafifçe 60 r/dk 3-4 dk için salla. Not: Saat sallayarak jel kalınlığı ve emprenye çözümde gümüş nitrat yoğunluğuna göre ayarlanabilir.</li>
	<li>Emprenye çözüm dışarı plaka taşımak ve başka bir tepsi koydu. Plaka ve geniş dH2O iki kez 3-5 s için her kullanarak jel yüzeyi kapalı kalan emprenye çözümden durulayın.</li>
	<li>Yukarı dönük olacak şekilde başka bir tepsi jel ile plaka koyun, geliştirme çözüm, 1 L plaka daldırın sonra tepsiyi hafifçe 50 r/dak ~ 3 dakika DNA görünümünü parçaları monitör süreyle sallamak. ve en yüksek oranı sinyal DNA parçaları geliştirme durdurur arka plan gürültü görülmektedir (Bu adım ~ 3 dakika sürer).</li>
	<li>Plaka ve jel ile geniş dH2O iki kez durulama ve jel tabak kağıt mendil ile kurulayın.</li>
	<li>Uygun bir tarayıcı kullanarak jel inceden inceye gözden geçirmek. 300 dpi çözünürlüğe DNA parçalarının açık bir görselleştirme verir. Jel de bir kamera ile fotoğrafı olabilir.</li>
	<li>SSR işaretleri bantlama deseni tabanlı görüntü DNA parçalarının üzerinde toplam.</li>
</ol>

<ol>
	<li>Jiang, G. L., Anderson, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+markers+and+marker-assisted+breeding+in+plants.">Molecular markers and marker-assisted breeding in plants.</a> Plant breeding from laboratories to fields. , 45-83 (2013).</li><li>Powell, W., Machray, G. C., Provan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymorphism+revealed+by+simple+sequence+repeats.">Polymorphism revealed by simple sequence repeats.</a> Trend Plant Sci. 1, 215-222 (1996).</li><li>Varshney, R. K., Graner, A., Sorrells, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genic+microsatellite+markers+in+plants:+features+and+applications.">Genic microsatellite markers in plants: features and applications.</a> Trend Biotechnol. 23, 48-55 (2005).</li><li>Tuler, A. C., Carrijo, T. T., N&#243;ia, L. R., Ferreira, A., Peixoto, A. L., da Silva Ferreira, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SSR+markers:+a+tool+for+species+identification+in+Psidium+(Myrtaceae).">SSR markers: a tool for species identification in Psidium (Myrtaceae).</a> Mol. Biol. Rep. 42, 1501-1513 (2015).</li><li>Rabilloud, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+protein+silver+staining+in+polyacrylamide+gels:+a+10-year+synthesis.">Mechanisms of protein silver staining in polyacrylamide gels: a 10-year synthesis.</a> Electrophoresis. 11, 785-794 (1990).</li><li>Bassam, B. J., Caetano-Anoll&#233;s, G., Gresshoff, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+silver+staining+of+DNA+in+polyacrylamide+gels.">Fast and sensitive silver staining of DNA in polyacrylamide gels.</a> Anal. Biochem. 196, 80-83 (1991).</li><li>Liang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+effective+method+for+silver+staining+of+PCR+products+separated+in+polyacrylamide+gels.">A rapid and effective method for silver staining of PCR products separated in polyacrylamide gels.</a> Electrophoresis. 35, 2520-2523 (2014).</li><li>Switzer, R. C., Merril, C. R., Shifrin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+highly+sensitive+silver+stain+for+detecting+proteins+and+peptides+in+polyacrylamide+gels.">A highly sensitive silver stain for detecting proteins and peptides in polyacrylamide gels.</a> Anal. Biochem. 98, 231-237 (1979).</li><li>Sanguinetti, C., Dias, N., Simpson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+silver+staining+and+recovery+of+PCR+products+separated+on+polyacrylamide+gels.">Rapid silver staining and recovery of PCR products separated on polyacrylamide gels.</a> Biotechniques. 17, 915-919 (1994).</li><li>Ji, Y., Qu, C., Cao, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimal+method+of+DNA+silver+staining+in+polyacrylamide+gels.">An optimal method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 28, 1173-1175 (2007).</li><li>Qu, L., Li, X., Wu, G., Yang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+and+sensitive+method+of+DNA+silver+staining+in+polyacrylamide+gels.">Efficient and sensitive method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 26, 99-101 (2005).</li><li>An, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+silver+staining+procedure+for+nucleic+acids+in+polyacrylamide+gels+without+fixation+and+pretreatment.">A silver staining procedure for nucleic acids in polyacrylamide gels without fixation and pretreatment.</a> Anal. Biochem. 391, 77-79 (2009).</li><li>Byun, S. O., Fang, Q., Zhou, H., Hickford, J. G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+effective+method+for+silver-staining+DNA+in+large+numbers+of+polyacrylamide+gels.">An effective method for silver-staining DNA in large numbers of polyacrylamide gels.</a> Anal. Biochem. 385, 174-175 (2009).</li><li>Kumar, M., Kim, S. R., Sharma, P. C., Pareek, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+way+to+detect+small+polymorphic+bands+in+plants.">Simple and efficient way to detect small polymorphic bands in plants.</a> Genome Data. 5, 218-222 (2015).</li><li>Liu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+simple+and+effective+silver+staining+protocol+for+detection+of+DNA+fragments.">Development of a simple and effective silver staining protocol for detection of DNA fragments.</a> Electrophoresis. 38, 1175-1178 (2017).</li><li>Wang, D., Shi, J., Carlson, S. R., Cregan, P. B., Ward, R. W., Diers, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low-cost,+high-throughput+polyacrylamide+gel+electrophoresis+system+for+genotyping+with+microsatellite+DNA+markers.">A low-cost, high-throughput polyacrylamide gel electrophoresis system for genotyping with microsatellite DNA markers.</a> Crop Sci. 43, 1828-1832 (2003).</li><li>Echt, C. S., May-Marquardt, P., Hseih, M., Zahorchak, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+microsatellite+markers+in+eastern+white+pine.">Characterization of microsatellite markers in eastern white pine.</a> Genome. 39, 1102-1108 (1996).</li></ol>

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Jel yıkandıktan sonra emprenye kritik bir adımdır. Yetersiz yıkama zaman ve su hacmi plaka ve jel yüzeyi üzerinde emprenye çözüm eksik kaldırılmasına neden ve karanlık bir arka planda neden. Uygun gelişmekte olan zaman başka bir önemli adım, aşırı geliştirme koyu kahverengi arka plan DNA parçalarının düşük kontrast görüntü ile sonuçlanabilir. Buna ek olarak, emprenye adım DNA parçalarının boyama verimliliğini önemli ölçüde etkiler. Her ne kadar boyama kalite emprenye süresi 5 dk ...

PCR tabanlı işaretleri gelişimi bilim üreme1ve bitki genetik devrim yarattı. Basit sıralı tekrar (SSR) işaretleri arasında en sık kullanılan ve en çok yönlü DNA işaretlerine vardır. Onların geniş genom kapsamı, bereket, genom özgüllük ve tekrarlanabilirlik heterozigoz genotip2tespiti için ek olarak kendi codominant devralma SSR işaretleri yararları bazılarıdır. Çeşitli çalışmalarda SSR işaretleri genetik çeşitlilik araştırmak, soy izlemek, genetik bağlantı haritalar oluşturmak ve ekonomik açıdan önemli özellikleri3,4için gen eşlemek için kullandık.
PCR ürünleri SSR işaretleri kullanarak özel veya polyacrylamide Jel Elektroforez ve etidyum bromür ile boyama sonra gümüş boyama ile veya UV ışığı altında görüntülenir yaygın olarak ayrılır. Polyacrylamide jeller DNA parçalarının gümüş boyama diğer boyama yöntemleri5,'6 dan daha duyarlı ve yaygın olarak DNA parçalarının SSR işaretleri7gibi algılamak için kullanılan.
Gibi birçok biyolojik laboratuvar teknikleri, gümüş polyacrylamide jeller boyama giderek onun ilk bir parçası görselleştirme teknik 19798' olarak rapor ediliyor beri geliştirdi. Teknik DNA parçalarının tespiti için başlangıçta Bassam vd tarafından güncellenmiştir 6 1991 ve 1994 yılında Sanguinetti ve iş arkadaşlarınızla9 tarafından geliştirilmiş. Yöntem daha son birkaç on yıl6,7,9,10,11,12,13,14 ' te optimize , 15. ancak, iletişim kurallarının Güncellenme Zamanı bu sürümleri çoğu hala bu protokolleri7uygulama sınırı, yüksek teknik talep ve uzun süre fiksasyon için işleme ve6, montaj gibi bazı dezavantajları var 11. DNA parçası algılama yüksek verimlilik ile düşük maliyetli birleştiren bir en iyi Protokolü acilen biyolojik araştırmada boyama gümüş rutin uygulama için gereklidir.
Buna ek olarak, polyacrylamide jel denaturing ve sigara denaturing polyacrylamide jeller bölünmüş olabilir ve her ikisi de gümüş boyama yöntemi kullanarak SSR işaretleri tespiti için kullanılabilir. Etkisi ve kararlılık-in hangi önemli ölçüde farklı değildir, ama sigara denaturing polyacrylamide jeller süreci daha kolay ve daha az zaman16almak.
Önceki araştırma15temel alınarak, geçerli çalışmanın amacı ayrıntılı SSR işaretleri bir sigara denaturing polyacrylamide jel içinde hızlı, kolay ve düşük maliyetli algılanması için protokol boyama en iyi duruma getirilmiş bir gümüş tarif etmektir.

<table><tbody><tr><td>PCR master mix (Green Taq Mix)</td><td>Vazyme Biotech Co. Ltd, China</td><td>#P131-03</td><td></td></tr><tr><td>50-2000 bp DNA Ladder</td><td>Bio-Rad, USA</td><td>#170-8200</td><td></td></tr><tr><td>DL500 DNA marker</td><td>Takara Bio Inc., Japan</td><td>#3590A</td><td></td></tr><tr><td>Tris base</td><td>Sangon Biotech Shanghai, China</td><td>#77-86-1</td><td></td></tr><tr><td>Boric acid</td><td>Sangon Biotech Shanghai, China</td><td>#10043-35-3</td><td></td></tr><tr><td>EDTA-Na&lt;sub&gt;2&lt;/sub&gt;</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#6381-92-6</td><td></td></tr><tr><td>Acrylamide</td><td>Sangon Biotech Shanghai, China</td><td>#79-06-1</td><td></td></tr><tr><td>N,N&#039;-methylene-bis-acrylamide</td><td>Sangon Biotech Shanghai, China</td><td>#110-26-9</td><td></td></tr><tr><td>N,N,N&#039;,N&#039;-Tetramethylethylenediamine</td><td>Sangon Biotech Shanghai, China</td><td>#110-18-9</td><td></td></tr><tr><td>Ammonium persulfate</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#7727-54-0</td><td></td></tr><tr><td>Bind-silane</td><td>Solarbio Beijing, China</td><td>#B8150</td><td></td></tr><tr><td>AgNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td><td>#7761-88-8</td><td></td></tr><tr><td>Formaldehyde</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#50-00-0</td><td></td></tr><tr><td>NaOH</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#1310-73-2</td><td></td></tr><tr><td>Acetic acid</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#64-19-7</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;3&lt;/sub&gt;</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#497-19-8</td><td></td></tr><tr><td>Ethanol</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#64-17-5</td><td></td></tr><tr><td>HNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#7697-37-2</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;S&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;3&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td><td>#10102-17-7</td><td></td></tr><tr><td>Eriochrome black T(EBT)</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#1787-61-7</td><td></td></tr><tr><td>Plastic tray</td><td>Shanghai Yi Chen Plastic Co., Ltd, China</td><td>-</td><td></td></tr><tr><td>TS-1 Shaker</td><td>Qilinbeter JiangSu, China</td><td>-</td><td></td></tr><tr><td>BenQ M800 Scanner</td><td>BenQ, China</td><td>-</td><td></td></tr><tr><td>DYY-6C Power supply</td><td>Beijing Liuyi Instrument Factory, China</td><td>-</td><td></td></tr><tr><td>High throughout vertical gel systems, JY-SCZF</td><td>Beijing Tunyi Electrophoresis Co., Ltd, China</td><td>-</td><td></td></tr></tbody></table>

a fast silver staining protocol enabling simple and efficient detection of ssr markers using a non-denaturing polyacrylamide gel

Basit dizi tekrar (SSR) bitki ve hayvan genetik araştırma ve moleküler ıslah programlarında kullanılan en etkili işaretleri biridir. Gümüş boyama SSR işaretleri polyacrylamide jel içinde tespiti için yaygın olarak kullanılan bir yöntemdir. Ancak, gümüş boyama için geleneksel teknik olarak zor ve zaman alıcı iletişim kurallarıdır. Gibi birçok biyolojik laboratuvar teknikleri, iletişim kuralları boyama gümüş sürekli algılama verimliliği artırmak için optimize edilmiştir. Burada, önemli ölçüde reaktif maliyetlerini azaltır ve algılama çözünürlük ve görüntü netliğini artırır yöntem boyama basitleştirilmiş bir gümüş raporu. Yeni yöntem için sigara denaturing polyacrylamide jel iki önemli adım (emprenye ve geliştirme) ve üç reaktifler (Gümüş nitrat, sodyum hidroksit ve formaldehit) ve sadece 7 dakika işleme gerektirir. Daha önce raporlanmış iletişim kurallarına göre bu yeni yöntem daha hızlı, daha kolaydır ve daha az kimyasal reaktifler SSR algılama için kullanır. Bu nedenle, bu basit, düşük maliyetli ve verimli gümüş Protokolü boyama genetik haritalama ve marker-yardım etmek üreme SSR işaretçisi veri hızlı bir nesil tarafından yararlanacaktır.

PCR amplicons çiçekli Çin lahanası ve tütün ilgili SSR astar çiftleri kullanılarak üretildi. Elektroforez sonra belirsizliğe yer bırakmadan SSR işaretleri (şekil 1) bantlama şekillerinin Algılandı iletişim kuralı boyama yukarıdaki gümüş kullanarak polyacrylamide jeller lekeli.
Farklı gümüş protokolleri boyama algılama verimliliğini karşılaştırmak için PCR ürünleri ...

Watch this Scientific Journal Video about A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel at JoVE.com

A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Burada, sadece üç reaktifler ve 7 min işleme gerektirir ve yüksek kaliteli SSR veri genetik analiz hızlı üretimi için uygundur Protokolü boyama basit ve düşük maliyetli bir gümüş raporu.

Bir hızlı gümüş boyama Protokolü etkinleştirme basit ve SSR bir sigara denaturing Polyacrylamide jel kullanarak işaretleri, verimli algılama

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver ...

a-fast-silver-staining-protocol-enabling-simple-efficient-detection

Universidad San Sebastian

Research

JoVE Journal

Genetics

10.7K Görüntüleme.  Guangzhou University. Burada, sadece üç reaktifler ve 7 min işleme gerektirir ve yüksek kaliteli SSR veri genetik analiz hızlı üretimi için uygundur Protokolü boyama basit ve düşük maliyetli bir gümüş raporu.

Video: A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Kızılötesi Floresan Boya-etiketli oligonükleotidler kullanılarak Elektroforetik Hareketlilik Kaydırma Testi için optimize Protokol

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. ...

Biyokimya

DNA Staining Method Based on Formazan Precipitation Induced by Blue Light Exposure

DNA staining methods are very important for biomedical research. We designed a simple method that allows DNA visualization to the naked eye by the formation of a colored precipitate. It works by soaking the acrylamide or agarose DNA gel in a solution of 1x (equivalent to 2.0 &#181;M) SYBR Green I (SG I) and 0.20 mM nitro blue tetrazolium that produces a purple precipitate of formazan when exposed to sunlight or specifically blue light. Also, DNA recovery tests were performed using an ampicillin resistant plasmid in an agarose gel stained with our method. A larger number of colonies was obtained with our method than with traditional staining using SG I with ultraviolet illumination. The described method is fast, specific, and non-toxic for DNA detection, allowing visualization of biomolecules to the "naked eye" without a transilluminator, and is inexpensive and appropriate for field use. For these reasons, our new DNA staining method has potential benefits to both research and industry.

This method allows selective staining and quantification of DNA in gels by soaking the gel in a SYBR Green I/Nitro Blue Tetrazolium solution and then exposing it to sunlight or a blue light source. This produces a visible precipitate and requires almost no equipment, making it ideal for field use.

DNA Formazan yağış mavi ışığa maruz tarafından indüklenen esas alarak yöntemini boyama

DNA staining methods are very important for biomedical research. We designed a simple method that allows DNA visualization to the naked eye by the ...

Staining Proteins in Gels

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. This unit describes protocols for detecting proteins by four popular methods. Coomassie blue staining is an easy and rapid method. Silver staining, while more time consuming, is considerably more sensitive and can thus be used to detect smaller amounts of protein. Fluorescent staining is a popular alternative to traditional staining procedures, mainly because it is more sensitive than Coomassie staining, and is often as sensitive as silver staining. Staining of proteins with SYPRO Orange and SYPRO Ruby are also demonstrated here.

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. Staining of proteins with Coomassie Blue, Silver Staining, SYPRO Orange, SYPRO Ruby are demonstrated in this video.

Jeller içinde Proteinler Boyama

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. This unit describes protocols for ...

Biyoloji

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Flourogenik DNAzymes kullanarak Bakterilerin Tespiti

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

İmmünoloji ve Enfeksiyon

Fluorescent Silver Staining of Proteins in Polyacrylamide Gels

Silver staining is a colorimetric technique widely used to visualize protein bands in polyacrylamide gels following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The classic silver stains have certain drawbacks, such as high background staining, poor protein recovery, low reproducibility, a narrow linear dynamic range for quantification, and limited compatibility with mass spectrometry (MS). Now, with the use of a fluorogenic Ag+ probe, TPE-4TA, we developed a fluorescent silver staining method for the total protein visualization in polyacrylamide gels. This new stain avoids the troublesome silver reduction step in traditional silver stains. Moreover, the fluorescent silver stain demonstrates good reproducibility, sensitivity, and linear quantification in protein detection, making it a useful and practical protein gel stain.

Here, we describe a detailed protocol outlining a new fluorescent staining technique for total protein detection in polyacrylamide gels. The protocol utilizes a silver ion-specific fluorescence turn-on probe, which detects Ag+-protein complexes, and eliminates certain limitations of traditional chromogenic silver stains.

Floresan gümüş Polyacrylamide jeller proteinlerin boyama

Silver staining is a colorimetric technique widely used to visualize protein bands in polyacrylamide gels following sodium dodecyl sulfate-polyacrylamide ...

Fluorescent Visualization of Mango-tagged RNA in Polyacrylamide Gels via a Poststaining Method

Native and denaturing polyacrylamide gels are routinely used to characterize ribonucleoprotein (RNP) complex mobility and to measure RNA size, respectively. As many gel-imaging techniques use nonspecific stains or expensive fluorophore probes, sensitive, discriminating, and economical gel-imaging methodologies are highly desirable. RNA Mango core sequences are small (19&#8211;22 nt) sequence motifs that, when closed by an arbitrary RNA stem, can be simply and inexpensively appended to an RNA of interest. These Mango tags bind with high affinity and specificity to a thiazole-orange fluorophore ligand called TO1-Biotin, which becomes thousands of times more fluorescent upon binding. Here we show that Mango I, II, III, and IV can be used to specifically image RNA in gels with high sensitivity. As little as 62.5 fmol of RNA in native gels and 125 fmol of RNA in denaturing gels can be detected by soaking gels in an imaging buffer containing potassium and 20 nM TO1-Biotin for 30 min. We demonstrate the specificity of the Mango-tagged system by imaging a Mango-tagged 6S bacterial RNA in the context of a complex mixture of total bacterial RNA.

Here we present a sensitive, rapid, and discriminating post-gel staining method to image RNAs tagged with RNA Mango aptamers I, II, III, or IV, using either native or denaturing polyacrylamide gel electrophoresis (PAGE) gels. After running standard PAGE gels, Mango-tagged RNA can be easily stained with TO1-Biotin and then analyzed using commonly available fluorescence readers.

Polyacrylamide jeller içinde Mango-Tagged RNA floresan görselleştirme bir Poststaining yöntemi ile

Native and denaturing polyacrylamide gels are routinely used to characterize ribonucleoprotein (RNP) complex mobility and to measure RNA size, ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (&#948;15N and &#948;13C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Most common gut content analyses of macroinvertebrates are visual. Requiring intense knowledge about morphological diversity of prey organisms, they miss soft bodied prey and, due to strong comminution of prey, are nearly impossible for some organisms, including amphipods. We provide detailed, novel genetic approaches for macroinvertebrate prey identification in the diet of amphipods.

Su Macroinvertebrates kullanma gruba özel rDNA astar genetik Gut içerik analizleri için laboratuvar iletişim kuralı

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Detection of Glycosaminoglycans by Polyacrylamide Gel Electrophoresis and Silver Staining

Sulfated glycosaminoglycans (GAGs) such as heparan sulfate (HS) and chondroitin sulfate (CS) are ubiquitous in living organisms and play a critical role in a variety of basic biological structures and processes. As polymers, GAGs exist as a polydisperse mixture containing polysaccharide chains that can range from 4000 Da to well over 40,000 Da. Within these chains exists domains of sulfation, conferring a pattern of negative charge that facilitates interaction with positively charged residues of cognate protein ligands. Sulfated domains of GAGs must be of sufficient length to allow for these electrostatic interactions. To understand the function of GAGs in biological tissues, the investigator must be able to isolate, purify, and measure the size of GAGs. This report describes a practical and versatile polyacrylamide gel electrophoresis-based technique that can be leveraged to resolve relatively small differences in size between GAGs isolated from a variety of biological tissue types.

This report describes techniques to isolate and purify sulfated glycosaminoglycans (GAGs) from biological samples and a polyacrylamide gel electrophoresis approach to approximate their size. GAGs contribute to tissue structure and influence signaling processes via electrostatic interaction with proteins. GAG polymer length contributes to their binding affinity for cognate ligands.

Glikozamid Jel Elektroforez ve Gümüş Boyama ile Glikozaminolikanların Tespiti

Sulfated glycosaminoglycans (GAGs) such as heparan sulfate (HS) and chondroitin sulfate (CS) are ubiquitous in living organisms and play a critical role ...

Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis for Protein Analysis: A Technique to Separate and Visualize Proteins Based on Molecular Weight

Source: Sultana, S. et al. <a href="https://www-jove-com.bdigitaluss.remotexs.co/v/62628">Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor</a>. J. Vis. Exp. (2021).
This video demonstrates a denaturing polyacrylamide-based separation technique for proteins. This technique helps in the preliminary identification of proteins based on their molecular weights.

Protein Analizi için Sodyum Dodesil Sülfat Poliakrilamid Jel Elektroforezi: Moleküler Ağırlığa Göre Proteinleri Ayırmak ve Görselleştirmek İçin Bir Teknik

Source: Sultana, S. et al. Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor. J. Vis. ...

JoVE Encyclopedia of Experiments

Biyolojik Teknikler

Elektroforez Teknikleri

Fluorescent Silver Staining: A Technique to Visualize Total Protein in Polyacrylamide Gels

After electrophoresis, submerge the gel in a 100-milliliter solution containing ethanol and acetic acid on an orbital shaker, and incubate twice for 30 minutes each, at room temperature while shaking at 50 RPM. Next, wash the gel three times with ultrapure water in a clean container, with each wash lasting 10 minutes.
First, dissolve 0.01 grams of silver nitrate in 10 milliliters of ultrapure water to prepare a stock solution with a concentration of 0.1%. Add 100 microliters of this stock solution into 100 milliliters of ultrapure water to make the silver nitrate working solution. In a fume hood, submerge the gel in 100 milliliters of the silver nitrate working solution in a sealed glass chamber.
Use aluminum foil to protect the gel from light during impregnation, and incubate for 1 hour while shaking at 50 RPM on an orbital shaker. After this, wash the gel twice with ultrapure water in a clean container, with each wash using approximately 100 milliliters of water and lasting 60 seconds.
It is important to use ultrapure water to clean the gel after the silver impregnation step to minimize background staining.
First, add 50 milliliters of ultrapure water to 3 milligrams of TPE-4TA dye. Sonicate the solution for 3 minutes, and add 5 microliters of 1 molar sodium hydroxide solution in between each sonication session, to help dissolve the dye, usually up to three times. Then, check the fluorescence of the solution under a 365-nanometer UV lamp to ensure that the dye is fully dissolved. Only weak or non-emissive solutions indicate full dissolution.
To prepare the fluorogenic developing solution, add 10 milliliters of the TPE-4TA stock solution to 90 milliliters of ultrapure water. Use a pH meter to check the pH of the solution. Tune the solution to a pH between 7 and 9, using diluted sodium hydroxide solution or acetic acid, if the pH is out of range.
Next, transfer the gel to a clean and sealable container with 100 milliliters of the fluorogenic developing solution, and ensure that the gel is completely immersed. Seal the container, and cover it to protect it from light. Shake the container overnight on an orbital shaker at 50 RPM and at room temperature.
Transfer the gel to a clean container, and de-stain it in 100 milliliters of 10% ethanol for 30 minutes. Then, rinse the gel in ultrapure water for 5 minutes. The gel can be visualized on a benchtop trans-illuminator, or imaged on a gel documentation machine at the 365-nanometer channel or the 302-nanometer channel.