Name: cryosectioning method for microdissection of murine colonic mucosa
Uploaded: 2015-07-12T13:00:00.000+00:00
Duration: 6 min 16 s
Description: Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

실험은 나이 10 12 주 사이에 C57BL / 6 마​​우스를 사용했다. 동물을 사용하는 모든 절차를 검토하고에 모리 대학 기관 동물 관리 및 사용위원회의 승인을 보건 기준의 국립 연구소에 따라 수행 하였다되었다. 1. 실험 설정 <ol><li> 의 저온는 설정 <ol><li> 마이크로톰 블레이드와 척을 포함, -20 ° C의 저온 유지 장치를 평형 (블레이드 주위에 극단적 인주의를 기울여야!). </li><li> 10월와 빈 cryomold (최적의 절단 온도 화합물)를 작성하고 -20 ° C (~ 30 분)에 평형. 금형에서 냉동 OCT를 제거하고 액체 월에 척에 고정합니다. 마이크로톰 팔 블록 / 척을 배치하고 OCT를 10 분 동안 설정할 수 있습니다. </li><li> 섹션 당 10 μm의 저온 유지 장치를 설정하고 평면 때까지 OCT의 블록을 면도. 몇 센티미터 떨어진 날로부터 마이크로톰 팔을 백업합니다. 이 시점에서 EXPER의 나머지 날 또는 척을 조정하지 마십시오iment. </li></ol></li><li> 면도날을 준비 : 샘플 당 2 면도날을 준비합니다. 금속 파일을 사용하여, 블레이드 에지의 sharped 무딘. 다음, 집게와 알루미늄 플랜지를 제거합니다. </li><li> 드라이 아이스에 파이렉스 접시 또는 기타 평평한 표면을 사전 진정. </li><li> 10 ~ 15 해부 핀 해부 접시를 준비합니다. 실리콘 가득 10cm 조직 배양 접시 50 %는 충분합니다. 실온에서 행크스 버퍼의 5 ML을 추가합니다. </li></ol> 원위부 대장 조직의 2 해부 <ol><li> 이소 플루 란 흡입 자궁 전위에 의해 장소 밀폐 된 챔버에 마우스 및 마우스 안락사 후 복부와 흉부 (12)에 70 % 에탄올을 스프레이. </li><li> 가위로 복부의 피부에 작은 절개를 한 후 절개가 복강을 노출 할 수 있습니다. 비슷한 절차는 여기에 12 설명 찾을 수 있습니다. </li><li> 항문에서 대장을 잘라 대장이 될 때까지 장간막을 떨어져 애타게. </li><li> 원위 결장을 절제항문에서 0 ~ 6cm 사이의 세그먼트. 여기서, 토굴 깊이 ~ 150 μm의 (도 1b 참조). 가위를 사용하여 길이 방향으로 결장을 열고 배설물 내용을 제거 컷. </li><li> 점막면이 위를 향하도록 해부 접시에 조직을 핀입니다. 행크스 완충액 실리콘 접시 조직 절개하여 핀 늘려서 RT (도 1C)에서 10 분 동안 휴식을 보자. 이 조직에서 주름을 제거하고 근육 층 휴식 할 수 있습니다. </li></ol> 단면 용의 저온 3. 마운트 조직 <ol><li> 조직의 원하는 섹션에서 면도날을 밀어 다음 행크스 버퍼를 붓는다. 샌드위치를​​ 만들고, 상단에 다른 면도날을 추가합니다. 조직 세그먼트를 잘라 핀을 제거합니다. 드라이 아이스에 면도날 / 조직 샌드위치를​​ 전송합니다. (5 ~ 10 분, 그림 1D) 조직이 동결하도록 허용합니다. </li><li> 면도기 / 조직 샌드위치를​​ 들고는 상단 (BL)에 손가락을 배치하여 약간 따뜻하게 할 수ADE (점막면이 위로. 이것은 기저 근육층 먼저 절단되도록 조직 배향.). 샌드위치 분리하여 조직 세그먼트의 가장자리 주위 잘랐다. 조직 세그먼트 약 0.5 센티미터 X 1cm를 잘라. 엣지 영역이 직렬 섹션 많은 조직층을 포함하는 원인 컬링하는 경향이있다. 이상 절단에서 절단보다 더 사용한다는 점에 유의주의의 측면에 잘못. </li><li> 조직의 상단에있는 얼음이 녹기 시작 때까지 조직을 따뜻하게 할 수 있습니다. 이 시점에서 신속하고 신중하게 저온 유지 장치에 OCT의 블록으로 조직을 누릅니다. </li><li> 샘플을 통해 손가락을 배치하여 블레이드를 분리합니다. 열 전달은 조직을 방해하지 않고 블레이드를 제거 할 수 있습니다. </li><li> 코트 OCT를 가진 조직과는 5 분 동안 평형. 10 μm의 (그림 1E, F)에서 섹션을 잘라. 지하실이 볼 때까지 시각적으로 섹션을 검사합니다. 1.5 ml의 튜브 또는 슬라이드에 배치 섹션. </li><li> 의 mRNA 또는 단백질, 장소 (T)의 분석을 위해5 토굴베이스, 과도 (5), 및 튜브 당 5 표면 섹션 튜브에 그 샘플. RNA 수집을위한 1 ml의에게 상업 분리 시약을 추가하고 실온에서 10 분 동안 품어. 제조업체의 지침에 따라 RNA 정화를 수행합니다. cDNA의 생성을 위해 전체 RNA의 5 ~ 10 μg의를 사용합니다. </li><li> 단백질 정제의 경우, 차가운 RIPA 0.5 ml의 5 섹션 당 버퍼 (플러스 단백질 분해 효소 억제제)를 용해 추가합니다. 얼음에서 70 % 주기로 3 회 초음파 처리. <ol><li> SDS 페이지 로딩 버퍼 (램 믈리 버퍼)에 샘플을 추가하고 10 분 동안 100 ° C에서 품어. SDS 페이지 및 전송에 따라 샘플은 다음 2 시간 동안 5 % 우유 / PBS에 차단합니다. (500 1) 4 ℃에서 O / N KLF4 항체와 인큐베이션 웨스턴 블롯 분석을 수행합니다. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

대장 상피 세포 증식 및 분화에 관여하는 분자 메커니즘이 제대로 이해된다. 이 대장 상피 지하실의 기지에서 줄기 세포 구획의 세포 신호 환경에 대한 우리의 이해의 간격을 포함한다. enterocyte 분화의 기초 처리에 대한 관심의 증가가있다. 예를 들어, 생체 내 분화의 이해 체외 차 장 시스템 (16)을 생산하기위한 연구에 대한 벤치 마크 필요 증가했다. 위의 절차를 추가 작업이 필요한 여러 단계가 포함되어 있습니다. 첫째, 냉동 조직 세그먼트 주위의 가장자리를 (3.2 절에서 논의 된 바와 같이)를 제거하는 해부 및 동결시 컬 조직의 가장자리로 필요합니다. 이 가장자리 결과를 이동하지 않으면 표면과 토굴 기본 세포의 혼합 인구입니다. 미리 냉장, 수평 10월 블록에 조직을 설치하는 것은 필수적이다. 티그 프로토콜은 각 풀 섹션 번호를 변경하여 원위 결장의 다른 영역에 적용 할 수있다. 도 1b에 도시 된 바와 같이 예를 들어, 점막 토굴 길이는 150-300 μm의 사이에서 변화한다. 항문에서 4cm-6cm 사이의 영역을 공부할 때 따라서, 섹션의 수가 중요한 것은 30 15 증가한다,이 프로토콜은 근위 대장에 대한 제안되지 않는다 (7 CM-9cm)에 의한 주름에 ( 시리얼 절편에 의한 별도의 표면과 토굴 기반 세포를 할 수 없도록 루멘으로 확장 plicae obliquae). 직렬 단면 기법 토굴 계를 연구 및 인간 상피 세포 집단을 표면에 사용되어왔다. 그러나, 우리의 프로토콜에 의한 쥐의 조직의 작은 크기에 필요한 추가 단계를 추가합니다. 우리는 상기 프로토콜 유전자 취급 용이 마우스 시스템에 토굴 계 및 표면 상피 세포 집단의 조사를 허용 것이라고 제안한다. 실제로, 풀 섹션 yieLD 고품질 단백질 및 RNA 적합한 하류 분석. 미래의 응용 프로그램은 세포 신호 전달 경로 또는 크로 마틴 면역의 연구를 포함 할 수있다. 그러나, 전술 한 다른 방법의 여러 원한다면, 결과 섹션 상피와 점막 고유 간질 세포의 혼합물을 포함하고 있음을 주목해야한다. 결론적으로, 여기에 설명 된 프로토콜은 뮤린 대장 점막의 공간적으로 별개의 영역에서 분자 수준의 분석을위한 신속하고 높은 수율의 방법을 제공한다.

결장 상피 라이닝 상주 ​​줄기 세포가 수일마다 한 조직 보급과 고도로 재생 조직이다. 이러한 재생 처리는 증식 성 줄기 세포 구획의 유지 보수를 필요로한다. 시간이 지남에 따라 새로 생성 된 딸 세포는 증식 잠재력을 잃고 장의 내강면을 향해 이동한다. 마이그레이션과 일치는 전구 세포는 성숙한 배리어 형성 장 세포 또는 점액 생산 배 세포로 분화. 이 분화 프로그램의 실패는 염증성 장 질환 및 결장암 2,3-에서 관찰 된 바와 같이 상피 장벽을 저하에 기여하는 것으로 생각된다. 위의 과정의 자세한 연구는 토굴베이스 및 표면 세포 인구를 분리하는 방법이 필요합니다. 여러 방법이 고유 한 장점과 단점이 각각 존재한다. 장 상피 세포의 분리를위한 현재의 방법은 채널을 포함실험 조건에 의존하는 전체 4,5- 지하실, 상피 시트, 또는 단일 세포의 분리 결과 elating 에이전트 및 기계적 해리. 이러한 높은 수율의 방법이 있습니다, 아직 세포 간 신호의 변화는 네이티브 환경 6,7를 대표하지 않을 수 있습니다 이러한 조건에서보고되었다. 레이저 캡처 미세 절제는 공간 별개의 자료의 수집을 허용하지만, 저 분자량 수익률 8,9을 달성한다. 인간 결장 조직, 일련의 수평 저온 절편 방법 10이 개발되었다. 그러나 쥐의 점막 조직이 기술의 직접 처분에 대한 엄청나게 작다. 사람에서 대장 (지하실베이스 및 표면 세포 사이의 먼) 장 토굴 길이는 μm의 100-1,000 ~ 11 사이의 다릅니다. 마우스에서, 지하실 길이는 μm의 50-300 ~ 사이 (그림 1A 참조)이다. 쥐 지하실의 작은 크기는 솔라에 도전을 선물한다기존의 프로토콜을 사용하여 두 세포 집단의 기. 우리는 이제 저렴한 비용으로, 토굴베이스의 분리를위한 높은 수율 방법을 설명하고 쥐의 대장 조직에서 상피 세포 인구 표면. 이러한 방식으로 수확 된 조직을 면역 염색 한 다음, RT-PCR (실시간 중합 효소 연쇄 반응) 또는 웨스턴 블 롯팅을 포함하여 표준 하류 애플리케이션들에 의해 분석 될 수있다.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

대장 조직 섹션은 조직 학적 평가와 H &amp; E (13)를 염색 처리했다. 점막 전통적인 단면도는도 2a에서 볼 수있다. 기저 영역은 주로 원형 근층 구성 근층의 실외가 포함되어 있습니다. 루멘을 향해 진행되어, 근층 점막이 토굴 계 상피 세포에 인접 명백, 전이 세포는 조직의 중간에 있고, 마지막으로 표면 세포 집단은 장내 루멘에 직면한다. 여기에 설명 된 일련 절편 방법은 점막 근육 판 (도 2C)이어서 종 및 원형 근층 처음 (도 2B)에 발생되도록 배향을 유지한다. 화상의 상부 좌측 비 - 근육 간질 세포의 모양을 참고. 다운 스트림 분석 아래에 설명을 위해, 근육 부분은 삭제됩니다. 다음 섹션은 상피 세포 및 간질 조직을 포함 (고유 층), 토굴 기반 세포 (그림 2D)로 시작. 인해 치밀한 핵으로 어둡게 나타나는 지하실, 대부분의 중앙 루멘의 부재를 참고. 이 층은 증식 성 구획을 포함합니다. 전환 세포는 단단히 눈에 띄는 중앙 루멘 (그림 2E)과 땀샘을 포장 나타납니다. 마지막으로, 표면의 세포 집단은 얼굴 (그림 2 층) KO 볼 상피 단층 지역으로, 불규칙적 인 구조를 가지고있다. (여기에서 (14)의 설명 참조) 전술 한 바와 같이 직렬 섹션은 또한 면역 표지 및 공 초점 현미경에 대해 처리 될 수있다.도 2G는 핵 (청색) 및 세포 - 세포 접합 단백질 Zonula 스테인드이어서 고정 및 100 % 메탄올 투과성이 고립 된 소낭을 보여 Occludens 1 (ZO-1, 녹색). 기존의 단면 방향에서, 지하실 및 표면 세포 (그림 2G를 동시에 볼 수 있습니다 </stronG&gt;). 참고 ZO-1 접합부 얼룩 라인이 대장 토굴의 루멘. 루멘이 Z0-1 라이닝 또한 원형 땀샘 (도 2G)의 중심에, 이행 세포 개체군의 직렬 단면 시료에서 볼 수있다. 향상된 ZO-1 얼룩 표면 세포 집단 (그림 2I 및 J)에서 볼 수있다. 몇몇 분화 인자 토굴 투면 축을 따라 시공간 방식으로 발현되는 것으로 알려져있다. 이것은 표면의 세포 집단이 풍부한 것으로 알려진 전사 인자 크 룹펠 같은 인자 4 (KLF4)를 포함한다. 전통적인 단면 처리 방법을 사용하여, KLF4 표면 세포 집단 (도 2K)를 대향 루멘의 핵에서 발견된다. 따라서 우리는 KLF4 mRNA를 주로 표면의 세포 집단으로 표현 될 것이라고 추측했다. 이를 테스트하려면, 직렬 섹션 수집 및 표면, 전이, 그리고 토굴베이스 샘플로 분류 하였다. Subsequently, RNA를 분리하고, RNeasy 열 및 DNase의 처리에 의해 추가로 정제하여, 표준 트리 졸 추출을 사용하여 수확했다. RNA를 샘플 당 총 RNA의 μg의 5 ~ 10 사이에 굴복 5 풀링 연속 섹션에서 수집되었다. 이 샘플은 다음과 KLF4 기준 유전자, TATA 박스 결합 단백질 1 (TBP-1) (도 2L) (14) 모두에 대해 반 정량적 실시간 PCR을 실시 하였다. 도 2L에 나타내는 바와 같이, TBP-1로 정규화 한 후, 세포 표면 토굴 세포에서 발현되는 8 배까지 KLF4 mRNA를 발현하는 것으로 확인되었다. 마찬가지로 KLF4 단백질 수준 토굴면 축을 따라 공간적 조절을 나타내는 것으로 밝혀졌다. 4 ° C에서 20 분 동안 용해 완충액에서 상술하고 인큐베이션 시리얼 섹션 모았다. 이 샘플 당 단백질의 200-250 μg의 사이에 굴복. 샘플은 SDS-PAGE (도 2M) (15)에 의해 분석을 실시 하였다. 도 2M에 도시 된 바와 같이, 피 KLF4rotein 레벨은 극적 표면 세포 집단에서 더 높다. 상기 결과는 뮤린 결장 점막 표면과 토굴 상피 세포 대량 분리하는이 프로토콜의 능력을 입증한다. <img alt="그림 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> 그림 1 : (A) 도식 보여주는 쥐의 대장 점막 및 외부 근육 층. 우리의 방법은 시리얼 냉동 절편 (10 μm의 각)에 의해 분리 된 표면 셀과 토굴 기반 세포 인구를 수집하는 것을 목표로하고있다. 외부 근육 층은 삭제됩니다. (B) 크립트 높이가 콜론 (토굴베이스 및 표면 층 사이의 거리)의 길이를 따라 달라집니다. 데이터 포인트는 개별 토굴 측정 및 심볼 생물학적 복제를 나타내는 표시 (N = 4). (C) 결장 세그먼트 수집 타개 및 실리콘 해부 접시 상에 고정. SE (D) 조직항문에서 약 3cm가 면도날에 사이에 누를 드라이 아이스에 냉동되어 gment. (E) 조직은 사전 평탄화 OCT 블록에 장착된다. (F) 저온부 제거하고 시각적으로 검사한다. <img alt="그림 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> 그림 2. 대표 데이터 원형 근층 (cm)를 보여주는 단면도 헤 마톡 실린 - 에오신 염색 (A) 결장 조직 근층 점막 (mm), 토굴 계 세포 전이 세포 및 표면 세포. (B - C) 대장 근육 층. (D) 크립트 기반 세포. 중앙 루멘의 부재를 참고. (E) 과도 세포. (F) 표면 세포. 격리 된 대장 지하실의 (G) 면역 형광 염색법. ZO-1 (녹색) 및 핵 (청색)의 단면이 관찰된다. (안녕) ZO-1과 이행 및 표면 세포에서 핵 염색. (J) ZO-1 염색의 확대도. (K) KLF4 (녹색)는 표면의 세포 집단에 충실. (L) 세 구획 사이의 KLF4 mRNA 수준의 실시간 PCR 평가. (M)이 세포 집단에서 KLF4 단백질 수준의 웨스턴 블롯 분석.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

쥐 대장 점막의 이외에 Microdissection을위한 냉동 절편 방법

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Universidad San Sebastian

Research

JoVE Journal

Biology

17.3K 조회수.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

비디오: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's patches (PPs) are integral components of the gut-associated lymphoid tissues (GALT) and play a central role in intestinal immunosurveillance and homeostasis. Particulate antigens and microbes in the intestinal lumen are continuously sampled by PP M cells in the follicle-associated epithelium (FAE) and transported to an underlying network of dendritic cells (DCs), macrophages, and lymphocytes. In this article, we describe protocols in which murine PPs are (i) dissociated into single cell suspensions and subjected to flow cytometry and (ii) prepared for cryosectioning and immunostaining. For flow cytometry, PPs are mechanically dissociated and then filtered through 70 &mu;m membranes to generate single cell suspensions free of epithelial cells and large debris. Starting with 20-25 PPs (from four mice), this quick and reproducible method yields a population of &gt;2.5 x 106 cells with &gt;90% cell viability. For cryosectioning, freshly isolated PPs are immersed in Optimal Cutting Temperature (OCT) medium, snap-frozen in liquid nitrogen, and then sectioned using a cryomicrotome. Tissue sections (5-12 &mu;m) are air-dried, fixed with acetone or methanol, and then subjected to immunolabeling.

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues. Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

림프구와 손쥐 Peyer의 패치에서 수지상 세포를 분리하고 Immunostaining

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

연구

면역학 및 감염병학

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of experimental models needs to be as rigorous as that applied for human samples. Indeed, drawing reliable and accurate conclusions is critically influenced by the quality of tissue section preparation. Here, we describe a protocol for histopathological analysis of murine tissues that implements several automated steps during the procedure, from the initial preparation to the paraffin embedding of the murine samples. The reduction of methodological variables through rigorous protocol standardization from automated procedures contributes to increased overall reliability of murine pathological analysis. Specifically, this protocol describes the utilization of automated processing and embedding robotic systems, routinely used for the tissue processing and paraffin embedding of human samples, to process murine specimens of intestinal inflammation. We conclude that the reliability of histopathological examination of murine tissues is significantly increased upon introduction of standardized and automated techniques.

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding&#160;human samples.

로봇 시스템을 사용 하 여 처리 하 고 저 승 Murine 샘플 조직학 분석 포함

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

신선한 냉동 인간 조직에서 장의 중추의 격리에 대 한 레이저 캡처 서의 최적화

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

신경과학

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount importance when studying diseases of the gastrointestinal (GI) tract. The murine colonic pinch biopsy model is a useful tool to define these processes. Additionally, the interplay between gut luminal content (e.g., microbes) and the colon can be studied. However, wound induction and the ability to track wound closure over time in a reliable manner can be challenging. Moreover, tissue preparation and orientation must be carried out in a standardized way to optimally interrogate histologic and molecular changes. Here, we present a detailed method describing biopsy-induced injury and the monitoring of wound closure through repeat colonoscopies. An approach is described that ensures consistent and reproducible measurements of wound size, the ability to collect the wound bed for molecular analyses as well as visualize the wound bed upon sectioning of tissues. The ability to successfully carry out these techniques allows for studies of the acute injury response, wound healing and luminal-host interactions within the colon.

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

마우스에서 대장 내 시경 유도 핀치 생검을 수행하고 후속 조직 변화를 평가

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount ...

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The myofibroblast is a stromal cell of the gastrointestinal (GI) tract that has been gaining considerable attention for its critical role in many GI functions. While several myofibroblast cell lines are commercially available to study these cells in vitro, research results from a cell line exposed to experimental cell culture conditions have inherent limitations due to the overly reductionist nature of the work. Use of primary myofibroblasts offers a great advantage in terms of confirming experimental findings identified in a cell line. Isolation of primary myofibroblasts from an animal model allows for the study of myofibroblasts under conditions that more closely mimic the disease state being studied. Isolation of primary myofibroblasts from human colon tissue provides arguably the most relevant experimental data, since the cells come directly from patients with the underlying disease. We describe a well-established technique that can be utilized to isolate primary myofibroblasts from both mouse and human colon tissue. These isolated cells have been characterized to be alpha-smooth muscle actin and vimentin-positive, and desmin-negative, consistent with subepithelial intestinal myofibroblasts. Primary myofibroblast cells can be grown in cell culture and used for experimental purposes over a limited number of passages.

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

마우스와 인간의 대장 조직에서 주요 근육 섬유 모세포의 분리

The myofibroblast is  a stromal cell of the gastrointestinal (GI) tract that has been gaining  considerable attention for its critical role in many GI ...

생물학

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

유전자 발현 및 조직 학적 분석을위한 단일 마우스 골격근의 연속 지역의 냉동 절편

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory cells, EC cells sense luminal stimuli and convert them into serotonin (5-hyroxytryptamine, 5-HT) release events. However, the electrophysiology of these cells is poorly understood because they are difficult to culture and to identify. The method presented in this paper outlines primary EC cell cultures optimized for single cell electrophysiology. This protocol utilizes a transgenic cyan fluorescent protein (CFP) reporter to identify mouse EC cells in mixed primary cultures, advancing the approach to obtaining high-quality recordings of whole cell electrophysiology in voltage- and current-clamp modes.

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

기본 교양된 Murine Enterochromaffin 셀의 전체 셀 전기 생리학

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory ...

Snap Freezing of Muscle Tissue for Sectioning: A Protocol to Obtain Ultrathin Sections of Rapidly Frozen Murine Muscle Tissue

Source: Bonetto, A. et al. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/54893" target="_blank">The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia.</a> J. Vis. Exp. (2016)
This video describes the procedure for snap freezing muscle tissue and obtaining its thin sections. The technique can help study cancer-related cachexia in colon cancer mouse models.

절편을 위한 근육 조직의 스냅 동결: 급속 동결된 쥐 근육 조직의 초박형 절편을 얻기 위한 프로토콜

Source: Bonetto, A. et al. The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia. J. Vis. Exp. (2016)
This video ...

JoVE Encyclopedia of Experiments

암 연구학

Gastrointestinal Cancer

Animal model studies

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

Source: Schewe, M. et al. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/56329" target="_blank">The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a technique to isolate whole crypts from a mouse&#8217;s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine 모델

Source: Schewe, M. et al. The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells. J. Vis. Exp. (2017)
In ...

Frozen Mouse Brain Tissue Sectioning: A Procedure to Obtain Thin Frozen Tissue Sections from Frozen Murine Brain Tissue

Source: Comba, A. et al. <a href="https://www-jove-com.bdigitaluss.remotexs.co/v/60939/laser-capture-microdissection-glioma-subregions-for-spatial-molecular">Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the sectioning of a frozen mouse brain tumor tissue using a cryostat. The frozen brain tissue sections so obtained are stored at low temperatures until further analysis.

동결 마우스 뇌 조직 절편: 냉동 쥐 뇌 조직에서 얇은 동결 조직 절편을 얻는 절차

Source: Comba, A. et al. Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, ...