Name: evaluation of zebrafish kidney function using a fluorescent clearance assay
Uploaded: 2015-02-20T13:00:00.000+00:00
Duration: 8 min 13 s
Description: Watch this Scientific Journal Video about Evaluation of Zebrafish Kidney Function Using a Fluorescent Clearance Assay at JoVE.com

Jaipreet Bharj에서 제공하는 기술 지원. 이 작품은 EU-F​​P7 (SYSCILIA -241955)와 네덜란드의 신장 재단 (CP11.18)에서 보조금에 의해 지원되었다.

윤리 문 : 동물 관리, 축산 및 절차는 동물 (과학적 절차) 법 1986 모든 동물 실험은 생물을 준수 내무 장관 (PIL 번호 7천8백92분의 70)에 의해 부여 된 라이센스에 따라 수행 된에 ​​의해 정의 및 제어 서비스 관리 그룹 및 생물학적 서비스 윤리위원회, SGUL, 런던, 영국. 모든 노력은 사용되는 동물의 수를 감소시키고 복지 고통을 최소화하고 강화하기 위하여 두 절차 및 사육을 구체화 하였다. 1. 악기, 마취의 준비, 형광 염료 <ol><li> 마이크로 피펫 풀러와 (필라멘트없이) 붕규산 표준 벽의 모세 혈관에 미세 주입 (그림 1A)에 적합한 길이의 바늘을 끌어 사용. </li><li> 심낭 (그림 1B)에 쉽게 주입 배아의 방향에 대한 아가로 오스 금형을 확인합니다. 접착제 약 10 유리 현미경 SL함께 십오 오프셋 슬라이드 &#39;계단&#39;을 형성한다. 최상의 결과를 위해, 각 슬라이드의 중심에 신속한 세트 에폭시 수지 접착제의 드롭을 사용한다. </li><li> 제거, 분젠 버너 가열 메스를 사용하여 두 개의 10 ml의 플라스틱 피펫을 통해 길이의 중간에 약 78mm의 일부를 잘라 피펫은 적절하게 끝납니다. 부착하고 적층 유리 슬라이드에 접착제 (에폭시 수지) 피펫 섹션 몰드 90mm 페트리 접시 파고 있도록 안정성을 제공한다. 슬라이드 모서리가 배양 접시 바닥에 수직으로 정렬도록 모든 노력을합니다. 접착제 시간을 설정할 수 있습니다. </li><li> 물고기 물에서 만든 2 % 아가로 오스 용액에 금형 주조 (수족관에서 얻은). 90mm 페트리 접시에 아가로 오스 붓고 적층 슬라이드 아가로 오스 표면에서 각도로 잠수하는 에지를 허용, 페트리 접시 위에 금형을 배치합니다. 30 분 동안 실험실 벤치에 설정 둡니다. </li><li> 슬라이드 캐스트를 제거하고 신선한 생선 물 슬라이드 각인 아가 로스를 커버Tricaine 마취제를 함유 1시 25분 비율 (단계 1.9 참조). </li><li> 로다 민 덱스 트란 (RD) 염료의 솔루션을합니다. 재현 탁 로다 민 B 10,000 MW 50 ㎎ / ㎖의 스톡 농도 있도록 멸균 된 초순수 표지 덱스 트란. 마이크로 인젝션, 상기 멸균 초순수에 5 mg / ml의 최종 농도로 희석 스톡. 참고 : 착색 된 세포는 24 시간 후 수정 (HPF)에서 제브라 피쉬에서 차별화하기 시작; 다음은 이미지 수집시 형광 마커를 모호하게 할 수 있습니다. </li><li> 블록 티로시나제의 억제를 통해 멜라닌 N -Phenylthiourea (PTU)를 사용하여 멜라닌 생성을 억제한다. 완전히 용해 60 ° C에서 수족관 물, 열 용액에 PTU 분말을 용해하여 PTU의 0.003 %의 원액을 확인합니다. </li><li> , 메틸렌 블루 용액, 순한 살균제에 제브라 피쉬 배아를 품어 곰팡이 꽃을 방지하고 생존을 증가. U에서 0.1 % 메틸렌 블루 포함, 메틸렌 블루 원액 2 ㎖를 추가ltrapure 물, 표준 배아 수족관 매체로서 물 및 1 L의 용도에 관한 것이다. </li><li> &#39;Zebrafish의 책&#39;(23)의 지침에 따라 Tricaine / 에틸 3 아미노 벤조 에이트 메탄 소금의 15 mM의 재고 농도를 확인합니다. 배아를 마취 결과적 microinjection의 절차를 수행하도록 고정화. </li><li> 배아를 마취 한 후, 메틸 셀룰로즈 무독성 고 점성 특성을 이용하여 촬상을 위해, 이들의 방향. 3 % 메틸 셀룰로오스의 200 ml의 준비을 얼음에 30 분 장소를 -20 ° C에서 물 130 ml에 진정합니다. 유리 비이커에 80 ° C의 물을 70㎖의 히트 메틸 6 g을 넣고, 모든 입자가 균일하게 습윤 될 때까지 분산 유리 막대를 이용하여 교반한다. 얼음처럼 차가운 물을 첨가 혼합하고, 준비 50 ㎖ 튜브에 분취하기 전에 30 분 동안 4 ° C에서 냉각 할 수 있습니다. 참고 : 온도를 낮추는 것은 메틸 셀룰로오스가 용해 될 수 있습니다. 용액을 두껍게 될 것이다분말 수화물 등. 3 % 메틸 셀룰로오스 세균 4 ° C에서 일주일의 짧은 기간 동안 성장 또는 -20 ° C에서 길게 함이없이 저장 될 수있다. 메틸 사용하기 전에 실온에 도달해야합니다. </li><li> 제브라 피쉬에 형광 염료의 주사를 수행하려면 표준 미세 주입 설정 (그림 1C)를 사용합니다. 이것은 1.0 외경 모세관 함께 사용하기위한 스트레이트 피펫 홀더에 공급하는 압력 조절 시스템에 연결된 공기 압축기로 구성된다. 피펫 홀더는 자성 독립하여 스틸베이스 플레이트에 고정 MM33 소형의 3 축 제어 미세 조작기 내에 수용되어야한다. 배아 조작, 시각화 스테레오 해부 현미경을 사용하여 주입 될 수있다. </li></ol> 2. Zebrafish의 축산 및 사전 주입 치료 <ol><li> 이전 23 설명 된대로 제브라 피쉬를 유지한다. 28.5 ° C의 일정 온도로 순환 공급되는 물을 제공 수족관 셋업을 사용pH 6.8 이하로 조절 - 7.2 탄산 수​​소 나트륨 및 인스턴트 오션 바다 소금과 450-550 μS의 전도도를 각각. 8 L 탱크 당 15 여성 15 남성의 입식 밀도를 유지, 실험에 적절한 야생형 또는 형질 전환 제브라 피쉬 라인을 사용합니다. 오전 9시에서 오후 11시까지 사이의 일광의 14 시간에 물고기 시설 photocycle를 설정합니다. </li><li> Zebrafish의 산란은 빛이 아침에 켜 photocycle의 시작 부분에 시작한다. 수집하기 전에 야생형 재고 탱크에 저녁을 사육 탱크 (제브라 피쉬 전문가에서 사용할 수 포함 메쉬 삽입) 잠수함, 최대 계란 물고기를 방해하지 않고 수집 할 수 있도록합니다. </li><li> 이후 차 여과기와 신선한 수족관의 물을 사용하여 계란을 수집하고 린스, 물고기 40 분 산란 - 수집의 날, 30 수 있습니다. 90mm 페트리 접시 포함 배아 매체에 청소 계란을 입금 28.5 ° C에서 배양한다. </li><li> 멜라노을 억제 PTU와 배아 치료기원. 8 HPF에서 1 포함하는 새로운 배양 접시에 최소한의 액체에 가능한 배아를 전송 : 배아 매체에 100 PTU를 추가로 72 HPF까지 28.5 ° C에서 배양한다. 참고 : PTU 그래서 8 HPF 단계를 게시 제한해야 초기 단계에서 사용하면 발달 결함을 일으킬 수 있지만, 늦게 24 HPF로 처리 할 수​​있다. PTU의 늦은 또한 완전히 눈 색소 침착을 차단하지만, 일반적으로 성공과 트렁크 멜라닌 세포 형성을 억제하지 않습니다. </li></ol> 3. 미세 주입 참고 : 심낭은 심장을 둘러싼 다하지만, 심낭 공동 내에 유체에 의해 보호 및 심장 운동의 용이성을 위해 분리된다. 이 절차의 목적은이 혈관 시스템의 신속한 흡수 색소 허용, 심낭 RD 공동 내로 주입한다. <ol><li> 6 μL와로드 바늘 - microloader 팁을 사용하여 RD 희석과 미세 조작기의 바늘 홀더에 고정합니다. 미세 tipp를 사용 바늘의 끝 브레이크에드 집게 (그림 1A). , 분 설정으로 펄스 지속 시간을 극대화하여 바늘의 끝 부분에 RD 솔루션을 이동이 완료되면 밀리으로 다시 돌아올 수 있습니다. </li><li> 직경 100 ㎛, 토출 방울의 크기를 조정 (집게를 사용) 니들 팁 길이 스테이지 마이크로 미터, 압력 조정기, 및 정교화 사용이 0.5 NL 볼륨 (도 2A) 총점. 참고 : 바늘을 위반하는 경우, 그렇지 않으면 어려운 주입 볼륨을 교정 할 것 떨어져 너무 많이 파괴하지 않도록주의. 필요한 경우, 추가 그러나 방울 크기를 증가 조직에 과도한 굽힘 또는 손상없이 심낭 진입을 허용하는 바늘의 두께를 유지하기 위해 니들 팁을 깰. </li><li> 주 사전에, 배아 Tricaine 함유 배지에서 배아를 마취. 5 ml의 배아 매체, 라벨 하나 &#39;Tricaine&#39;다른 &#39;복구&#39;를 포함하는 2 × 35mm 배양 접시를 설정합니다. </li><li> 200 추가적절하게 레이블 접시에 재고 Tricaine의 μL. 주입 한 번 준비, 72 HPF에서 개별 배아를 선택하고 Tricaine 접시에 최소한의 액체에 전송합니다. 배아의 활동을 모니터, 배아 마취 및 절단 microloader 팁을 사용하여 부드러운 교반에 의해 고정화 테스트합니다. </li><li> 사출 금형에 마취 된 배아를 전송하고 왼쪽이 위를 향 시야의 왼쪽에있는 심장의 위치를​​되도록 아가로 오스 저점에서 배아의 방향을. </li><li> 마음에 RD를 주입하기 위해 바늘과 심낭을 관통하고 마취 배아 (그림 2B, 오른쪽 패널)의 심낭 공동으로 RD 1 NL을 주입. 주사 후 바늘을 철회. &#39;복구 요리&#39;최소한의 액체 주입 된 배아를 전송하고 1 분 동안 모니터링 할 수 있습니다. 1ml의 신선한에게 배아 매체 (PTU 함유)을 함유하는 24- 웰 플레이트에 각각의 배아를 적절히 이동시켜 라벨. 참고: 심낭가 힘든, 그러나 심낭가 ventro - 꼬리 인두 아치와 dorso - 주동이의 난황 (그림 2B 화살촉)을 충족 ​​교차로에서 주목할만한 약점이있다. 바늘이 홈에 문의해야합니다. 바늘이 제자리에있을 때, 미세 조작기 위에 손가락의 확고한 수돗물 심낭 공동 내로 진입을 용이하게한다. </li><li> 별도의 잘 고유 labelto 허가 개별 실험 속행 각 물고기를 배치, 실험 그룹 당 적어도 10 배아 3.6 - 반복 3.2 단계를 반복합니다. 3 시간 동안 28.5 ° C에서 품어. </li></ol> 4. 영상 취득 <ol><li> 전술 한 바와 같이 3 시간 포스트 분사 (HPI)에서 배아를 마취 3 % 메틸 셀룰로오스를 함유하는 35mm 페트리 접시로 옮긴다. 조심스럽게 메틸 셀룰로오스로 배아를 밀어 측면 이미지를 만들 수 있도록 찾으시는. </li><li> 시각화 O위한 필터를 사용하여 UV 하에서 배아의 화상을 취득F는 570 nm의 (그림 2C)에서 빛을 방출. 이미지 획득 후, 배아 지정된 웰에 교체하기 전에 복구 할 수있다. 삽입 된 모든 배아 이미지를 획득하고 더 28.5 ° C에서 품어. 참고 : 우리는 TXR 필터 세트, DFC300FX 카메라와 각각의 응용 프로그램 소프트웨어와 함께 형광 실체 현미경을 사용하는이 프로토콜에서. 다음 이미지 수집에 대한 정확한 수집 설정을 적어 둡니다. </li><li> 전술 한 바와 같이 24 HPI에서, 화상의 두 번째 라운드를 획득. 모든 이미지를 구입하면, 3 HPI 24 HPI 모두에서 인도적으로 배아의 폐기하거나 다른 실험 방법 예를 들어, 면역 조직 화학 염색을 위해 사용합니다. </li></ol> 5. 이미지 처리 <ol><li> NIH의 ImageJ에 소프트웨어를 사용하여 이미지를 분석하여, 3, 24 HPI HPI에서, 각 주입 배아의 형광 강도를 정량화. 형광 강도를 측정 ImageJ에있는 이미지를 열고 하나에서의 ROI를 지정하려면00 PX 2 (편집 → 선택 → 지정). </li><li> 투자 수익 (그림 2C)의 중앙에 마음을 놓고 (→ 측정 분석) 측정을 수행, (→ 설정 측정 분석) 평균 그레이 스케일과 영역을 포함하는 측정을 설정합니다. 배아 당, 3 HPI 24 HPI에서, 이미지의 각 세트에 대해 완료 및 추가 처리를 위해 스프레드 시트로 평균 그레이 스케일 값을 전송합니다. 참고 :이 배아 사이에 개인의 마음을 포함로 우리는 100 픽셀이 고정 된 투자 수익의 크기를 선택했습니다. 심장 인해 종래 신장 들어가기 피 형광 함량을 측정하기 편리한 위치에있게되는 큰 크기로 측정을 수행하도록 선택 하였다. </li><li> 적절한 통계 소프트웨어를 사용하여 통계 분석을 수행합니다. 학생의 t-test를 이용하여 통계적 유의성에 대한 그룹을 비교. </li></ol>

<ol>
	<li>Hentschel, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acute+renal+failure+in+zebrafish:+a+novel+system+to+study+a+complex+disease.">Acute renal failure in zebrafish: a novel system to study a complex disease.</a> Am J Physiol Renal Physiol. 288 (5), 923-929 (2005).</li><li>Drummond, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+a+zebrafish+kidney:+a+tale+of+two+tubes.">Making a zebrafish kidney: a tale of two tubes.</a> Trends Cell Biol. 13 (7), 357-365 (2003).</li><li>Ma, M., Jiang, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Jagged2a-notch+signaling+mediates+cell+fate+choice+in+the+zebrafish+pronephric+duct.">Jagged2a-notch signaling mediates cell fate choice in the zebrafish pronephric duct.</a> PLoS Genet. 3 (1), e18 (2007).</li><li>Liu, Y., Pathak, N., Kramer-Zucker, A., Drummond, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+controls+the+differentiation+of+transporting+epithelia+and+multiciliated+cells+in+the+zebrafish+pronephros.">Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros.</a> Development. 134 (6), 1111-1122 (2007).</li><li>Drummond, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kidney+development+and+disease+in+the+zebrafish.">Kidney development and disease in the zebrafish.</a> J Am Soc Nephrol. 16 (2), 299-304 (2005).</li><li>Cardenas-Rodriguez, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CCDC28B+reveals+its+role+in+ciliogenesis+and+provides+insight+to+understand+its+modifier+effect+on+Bardet-Biedl+syndrome.">Characterization of CCDC28B reveals its role in ciliogenesis and provides insight to understand its modifier effect on Bardet-Biedl syndrome.</a> Hum Genet. 132 (1), 91-105 (2013).</li><li>Osborn, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+FTO+antagonises+Wnt+signaling+and+leads+to+developmental+defects+associated+with+ciliopathies.">Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.</a> PLoS One. 9 (2), e87662 (2014).</li><li>Pearson, C. G., Osborn, D. P., Giddings, T. H., Beales, P. L., Winey, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+body+stability+and+ciliogenesis+requires+the+conserved+component+Poc1.">Basal body stability and ciliogenesis requires the conserved component Poc1.</a> J Cell Biol. 187 (6), 905-920 (2009).</li><li>Tobin, J. L., Beales, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoration+of+renal+function+in+zebrafish+models+of+ciliopathies.">Restoration of renal function in zebrafish models of ciliopathies.</a> Pediatr Nephrol. 23 (11), 2095-2099 (2008).</li><li>Torres, V. E., Harris, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autosomal+dominant+polycystic+kidney+disease:+the+last+3+years.">Autosomal dominant polycystic kidney disease: the last 3 years.</a> Kidney Int. 76 (2), 149-168 (2009).</li><li>Bogdanova, N., Markoff, A., Horst, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autosomal+dominant+polycystic+kidney+disease+-+clinical+and+genetic+aspects.">Autosomal dominant polycystic kidney disease - clinical and genetic aspects.</a> Kidney Blood Press Res. 25 (5), 265-283 (2002).</li><li>Harris, P. C., Ward, C. J., Peral, B., Hughes, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycystic+kidney+disease.+1:+Identification+and+analysis+of+the+primary+defect.">Polycystic kidney disease. 1: Identification and analysis of the primary defect.</a> J Am Soc Nephrol. 6 (4), 1125-1133 (1995).</li><li>Reynolds, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+splicing+in+the+PKD2+gene+as+a+cause+of+polycystic+kidney+disease.">Aberrant splicing in the PKD2 gene as a cause of polycystic kidney disease.</a> J Am Soc Nephrol. 10 (11), 2342-2351 (1999).</li><li>Pazour, G. J., San Agustin, a. j. t., Follit, J. A., Rosenbaum, J. L., Witman, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycystin-2+localizes+to+kidney+cilia+and+the+ciliary+level+is+elevated+in+orpk+mice+with+polycystic+kidney+disease.">Polycystin-2 localizes to kidney cilia and the ciliary level is elevated in orpk mice with polycystic kidney disease.</a> Curr Biol. 12 (11), R378-R380 (2002).</li><li>Yoder, B. K., Hou, X., Guay-Woodford, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polycystic+kidney+disease+proteins,+polycystin-1,+polycystin-2,+polaris,+and+cystin,+are+co-localized+in+renal+cilia.">The polycystic kidney disease proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal cilia.</a> J Am Soc Nephrol. 13 (10), 2508-2516 (2002).</li><li>Baker, K., Beales, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+sense+of+cilia+in+disease:+the+human+ciliopathies.">Making sense of cilia in disease: the human ciliopathies.</a> Am J Med Genet C Semin Med Genet. 151C (4), 281-295 (2009).</li><li>Veland, I. R., Awan, A., Pedersen, L. B., Yoder, B. K., Christensen, S. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cilia+and+signaling+pathways+in+mammalian+development,+health+and+disease.">Primary cilia and signaling pathways in mammalian development, health and disease.</a> Nephron Physiol. 111 (3), 39-53 (2009).</li><li>Hruscha, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+CRISPR/Cas9+genome+editing+with+low+off-target+effects+in+zebrafish.">Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish.</a> Development. 140 (24), 4982-4987 (2013).</li><li>Bedell, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome+editing+using+a+high-efficiency+TALEN+system.">In vivo genome editing using a high-efficiency TALEN system.</a> Nature. 491 (7422), 114-118 (2012).</li><li>Eisen, J. S., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Controlling+morpholino+experiments:+don't+stop+making+antisense.">Controlling morpholino experiments: don't stop making antisense.</a> Development. 135 (10), 1735-1743 (2008).</li><li>Gerlach, G. F., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kidney+organogenesis+in+the+zebrafish:+insights+into+vertebrate+nephrogenesis+and+regeneration.">Kidney organogenesis in the zebrafish: insights into vertebrate nephrogenesis and regeneration.</a> Wiley Interdiscip Rev Dev Biol. 2 (5), 559-585 (2013).</li><li>Wingert, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cdx+genes+and+retinoic+acid+control+the+positioning+and+segmentation+of+the+zebrafish+pronephros.">The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros.</a> PLoS Genet. 3 (10), 1922-1938 (2007).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio Rerio). , (2000).</li><li>Forsythe, E., Beales, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bardet-Biedl+syndrome).">Bardet-Biedl syndrome).</a> Eur J Hum Genet. 21 (1), 8-13 (2013).</li><li>Corbetta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+prevalence+of+simple+kidney+cysts+in+patients+with+primary+hyperparathyroidism.">High prevalence of simple kidney cysts in patients with primary hyperparathyroidism.</a> J Endocrinol Invest. 32 (8), 690-694 (2009).</li><li>Veleri, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockdown+of+Bardet-Biedl+syndrome+gene+BBS9/PTHB1+leads+to+cilia+defects.">Knockdown of Bardet-Biedl syndrome gene BBS9/PTHB1 leads to cilia defects.</a> PLoS One. 7 (3), e34389 (2012).</li><li>Vize, P., Woolf, A. S., Bard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Kidney: From Normal Development to Congenital Disease. , (2003).</li><li>Chang, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Permselectivity+of+the+glomerular+capillary+wall+to+macromolecules.+II.+Experimental+studies+in+rats+using+neutral+dextran.">Permselectivity of the glomerular capillary wall to macromolecules. II. Experimental studies in rats using neutral dextran.</a> Biophys J. 15 (9), 887-906 (1975).</li></ol>

저자가 공개하는 게 없다.

Zebrafish의 인간의 유전 질환을 모델링하는 유용한 도구를 제공하고, 생체 내 연구를위한 과학적인 도구로서 자신의 사용은 신장을 포함한 많은 생물학적 시스템의 유전자 분석의 상세한 연구를 활성화. 대부분은 지금 제브라 피쉬 신장 개발 및 기능을하는 방법에 대해 알 수있다. 인간의 nephrogenesis과 질병의 원인 유전자 (21)와 동성에 눈에 띄는 유사점 이해하는 기초가 얼마나 제브라 피쉬의 도시가 얼마나 신장 질환의 병리에 유전자 기능 리드의 결함. 사실, 유전자 조작 여유롭게 안티센스 모르 폴리 노 녹다운 기술 또는 TALENS 또는 CRISPR 같은 고급 대상으로 게놈 편집 도구를 사용하여 제브라 피쉬에 달성 될 수있다. 의심 신장 질환의 원인 유전자 최저의 또는 돌연변이 모델을 만들기 질병 발현에서의 참여를 이해하는 첫 번째 단계입니다. 신장 기능에 대한 신뢰성 분석 받고자 이렇게하려면후보 유전자가 환자에서 관찰되는 병리에 대한 가능성이 책임이 있는지 여부를 나타냅니다. 신장 기능 검사는 일반적으로 혈액이나 소변에 존재하는 용질의 수준을보고, 인간에 수행 할 간단하고 상대적으로 저렴합니다. 그러나, 이러한 방법으로 인해 작은 크기와 수생 서식지에 제브라 피쉬에 적용 할 수 없습니다. 여기에 기재된 덱스 트란 로다 분석은 혈액으로부터 저 분자량 성분을 필터링하는 pronephric 세뇨관의 능력을 이용한다. 족 세포는 봉투 사구체 모세 혈관, 물과 같은 작은 분자, 이온 성 염 자유로운 통과를 허용하고, 슬릿 (27)을 통해 진동판 포도당 것을 신장의 사구체 주머니 내에 위치. 여과 슬릿은 상기 혈액으로부터 매크로 단백질 손실을 방지하는 기능을한다. 여과 정도 (혈청 알부민 (28)의 크기로 차단 된 분자 5 kDa의 위와 거의 완전히위한 제한된0 65 kDa의). 심낭 공동 내로 공지 농도에서 대략 10 kDa의 덱스 트란의 형광 염료를 주입함으로써, 우리는 시간이 지남에 따라 혈액의 형광 세기를 측정 할 수있다. 정상적인 조건에서 초기 형광의 약 85 %는 신장을 통해 분비를 통해 24 시간 동안, 혈액에서 손실됩니다. 하나는 심낭 공간으로 주입 혈관에 자유롭게 통과 낮은 MW 덱스 트란 만 가능하다는 것을주의해야한다. 따라서,이 분석은 저 분자량 성분에 대한 통관 속도에 대한 판독을 제공하고 사구체 여과의 효과에 대한 정보를 제공하지 않습니다. 후자는보다 직접적으로 혈관이 아닌 심낭 공간으로 주입이 필요한, ​​70 kDa의 고 분자량의 염료를 사용하여 평가 될 수있다. 실제로, 다양한 덱스 트란의 MW를 더욱 신장 기능 (28)을 절개하는데 사용될 수있다. 제브라 피쉬 pronephric 세관은 매우 개월과 섬모가있다배설강 3,4- 향해 여액의 이동을 용이 타일 섬모. 섬모 기계의 결함은 신장 질환에 연루되어있다. BBS는 어린 시절 발병 망막 변성, 초기 발병 비만,인지 장애, 다지증을 비롯한 다양한 기형 및 신장 기형 (24)을 특징으로하는 유전자 이기종, 상 염색체 열성 질환이다. 현재까지 20 BBS 유전자 (BBS1-20)이 확인되었다. 게시판의 중단은 제브라 피쉬 9 신장 낭종 형성과 결함이 pronephric 함수에 연결됩니다. BBS9은 BBS 케이스 (24)의 6 %를 차지 돌연변이있는 적절한 ciliogenesis에 대한 BBSome 책임을 형성하기 위해 다른 BBS 단백질과 상호 작용한다. 제브라 피쉬 bbs9 녹다운 모델이보고 된 반면, 신장 표현형의 설명 (26)이 결여되었다. 모르 폴리 방식을 사용하여, 제브라 피쉬 bbs9 내려 노크함으로써 결정 방법으로서 신장 클리어런스 분석의 사용을 보여신장 질환 모델에서 신장 기능. 여기서 우리는 bbs9의 morphant 배아는 신장이 낮은 MW의 용질을 제거하지 못했음을 나타내는 혈류에서이 악화 형광 허가를 표시 있음을 보여준다. 따라서, 때문에 ciliogenesis에 bbs9의 참여 및 여과 액의 움직임을 촉진 pronephric 속눈썹의 역할, morphants에서 관찰 된 신장 클리어런스 비정상적인 섬모 기능에 의한 될 가능성이 높습니다. 이 방법은 제브라 피쉬의 질병 모델에서 신장 기능을 평가하기위한 유용한 도구를 나타냅니다.

인간의 신장은 혈액에서 신진 대사 폐기물을 필터링 및 세포의 항상성을 유지하는 데 필요한 용질을 복구하는 데 중요한 역할을한다. 신장 기능 장애를 일으킬 인간 유전 질환들이있다. 가장 흔한 유전 신장 질환은 신장의 세뇨관 내에 채워진 유체 주머니의 발달을 특징으로 염색체 우성 다낭성 신장 질환 (ADPKD)이고; cystogenesis에 의한 피해는 신장 기능 (10)에 해로운 것입니다. 800-1 : ADPKD 1의 발생을 갖고 1000 8 차지하고 - 말기 신부전 (ESRF) 11 명 중 10 %. 여러 유전자는 약 85 % 각각 12, 13의 경우 15 %를 차지, polycystin-1 (PKD1) -2 (PKD2)를 포함 ADPKD 원인이 연루되어있다. 또한, 유전자 PKD1을위한 제품과 -2는 섬모에 지역화 및 ciliogenesis (14, 15)의 기초입니다. 로 알려진 인간의 유전 질환의 인식 가족은 지금이섬모 기능에 영향을 CKD (16)이 발생할 ciliopathies. 섬모 개발 및 기능에 영향을 미치는 인간의 유전 질환의 증가는 한번 고려 흔적 세포 기관의 글로벌 관심을 끌고있다. 섬모, 머리와 같은 세포 돌기, 수용체 및 주요 세포 신호 이벤트의 전달에 필요한 이온 채널 풍부하다. 섬모는 일반적으로 또는 단일 항 미세 소관의 중심 쌍없이 구 방사형으로 배열 된 미세 소관는 이중으로 구성 미세 소관 기반 axoneme로 구성되어 있습니다. axonemal 구조 섬모 작용의 유형 및 모드를 정의한다. 9 + 2 미세 소관 배열이 상피 표면에서 유체의 이동에 사용된다 섬모에 운동성을 부여한다. 9 + 0 구성이 아닌 운동성이 있지만 세포 신호 이벤트 (17)에 주로 기능에 생각된다. 그렇다 CKD에서, 섬모 기능 장애의 결과는 특성의 집합, 비만, 망막 변성, 다지증을 비롯한 다양한 기형 및인지 장애 (16)를 포함 ciliopathy 기능. 그러나, CKD는 환자의 삶의 질에 가장 해로운 따라서 섬모 관련 CKD에 대한 생체 내 모델에서 적절한 개발 뒤에 주요 원동력 사이입니다. 제브라 피쉬는 인간의 유전 질환의 원인을 이해하는 훌륭한 모델입니다. 이들의 빠른 개발, 계란의 많은 수의, 투명한 조직 및 전 자궁 내 성장의 생산은 제브라 피쉬의 발달 과정을 시각화 및 생물학적 이벤트가 상당한 쉽게 조작 할 수 있습니다. 유전자는 유전자, 게놈 편집 도구 (CRISPR 18 TALENS 19)의 최근 성공을 사용하여 변경 안티센스 모르 폴리 노 기술 (20)를 사용하여 무너 뜨렸다, 또는 약리학 자신의 수생 환경 화합물의 첨가에 의해 조절 될 수있다. 실제로, 제브라 피쉬 전자를 수행 할 수있는 플랫폼을 제공다른 동물 모델에서 허용되지 않습니다 xperiments. 제브라 피쉬 동안 그들이 인간과 공통으로 많은 기능 보존 기관, 유전자 및 신호 프로세스를 공유 (인간에 비해) 비교적 간단한 척추 동물이다. 예컨대, 제브라 피쉬 (21, 22)의 신장은 인간에 비해 구조와 기능에 상당히 유사하다. 그러나 단계의 연속을 통해 개발 포유류의 신장과 달리, 각각의 선진 신장 (pronephros, mesonephros 및 metanephros)로 표시, 배아 제브라 피쉬는 pronephros, 신장의 가장 미숙 한 형태를 개발하고 있습니다. 네프론의 수백만 포유류 신장의 빌딩 블록을 형성 찾을 수 있습니다 동안, 제브라 피쉬 배아는 두 가지를 가지고있다. 초기 혈액 여과 액을 허용 사구체는, 대동맥에 중간 선 단지 복부에 융합되어있다. 하수구로 배출하기 전에 융합 축을 따라 꼬리 쪽 실행 pronephric 세관에 사구체를 통해 혈액 필터. pronephric 부엉bules 심하게 꼬리 출구 3,4으로 여과 액의 흐름을 허용하는 경우에는 운동성 섬모와 섬모가있다. 이 간단한 pronephric 구조는 결국 더 복잡한 mesonephros 구조 (21)로 발전 애벌레 성장의 몇 주를 통해 제브라 피쉬의 항상성을 유지한다. 그러나, 제브라 피쉬는 metanephros (21)을 개발하지 않았다. 제브라 피쉬의 특이성에도 불구하고, 제브라 피쉬의 네프론은 포유 동물에서 관찰 된 것과 동일한 유전자 발현 프로파일로 분할되고, 따라서 nephrogenesis 3,22에 대한 생체 내 모델에서 타의 추종을 불허을 제공합니다. 정기적으로 환자는 혈액과 소변 일련의 테스트를 통해 신장 기능 검사를하고 있습니다. 일반적으로 혈액 용해 염, 우레아 및 크레아티닌에 대해 분석된다. 우레아, 크레아티닌 및 비정상적인 염농도가 높은 수준의 신장 기능에 문제를 나타낸다. 비색 딥 스틱을 사용하여 소변 검사는 단백질, (B100)를의 이상을 검출D, 고름, 박테리아 및 소변 샘플에서 설탕 선물. 혈액 10 ml의 - 이러한 테스트는 일반적으로 소변의 약 30 ml의 5 필요합니다. 그것은 주로 분석을 수행 할 충분한 혈액 또는 소변 수집 불가능 특성상 이러한 제브라 생체 내 모델 유기체, 작은 검정에 이러한 유형의 번역하기 어려웠다. 여기서는 적절한 지브라 피쉬 신장 기능 검사의 부족을 해결하기 위해 연구 및 혁신적인 기술을 설명한다. 혈류 내로 형광 염료를 주입함으로써, 우리는 신장을 통하여 혈액 여과 및 형광 활성의 배설을 개별적으로 모니터링하고 시간이 지남에 따라 수치화 할 수있다. 이 방법은 우리의 예를 제공하는 질환으로 인한 신장 손상을 연구하는데 이용 될 수있다.

<table><tbody><tr><td>P-97 SUTTER Flaming/Brown type micropipette puller</td><td>Intracel</td><td>P-97</td><td></td></tr><tr><td>borosilicate standard wall capillaries</td><td>Harvard Apparatus</td><td>30-0017</td><td></td></tr><tr><td>Glass microscope slides</td><td>VWR International</td><td>631-0109</td><td></td></tr><tr><td>Epoxy Resin Glue</td><td>Evo-Stik</td><td></td><td></td></tr><tr><td>Rhodamine B 10,000 MW labeled Dextran</td><td>Life technologies&amp;nbsp;</td><td>D-1824</td><td></td></tr><tr><td>N-Phenylthiourea&amp;nbsp;</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P7629</td><td></td></tr><tr><td>Methylene blue&amp;nbsp;</td><td>Sigma-Aldrich</td><td>M9140</td><td></td></tr><tr><td>Ethyl 3-aminobenzoate methanesulfonate salt</td><td>Sigma-Aldrich</td><td>A5040</td><td></td></tr><tr><td>methylcellulose</td><td>Sigma-Aldrich</td><td>M0512</td><td></td></tr><tr><td>air compressor&amp;nbsp;</td><td>Jun-Air</td><td>OF302-15</td><td></td></tr><tr><td>Picospritzer III&amp;nbsp;</td><td>Parker Instruments&amp;nbsp;</td><td>051-0500-900</td><td></td></tr><tr><td>compact 3-axis control micromanipulator&amp;nbsp;</td><td>Marzhauser</td><td>MM33&amp;nbsp;</td><td></td></tr><tr><td>Dissecting stereo microscope</td><td>Nikon</td><td>SMZ1000</td><td></td></tr><tr><td>microloader tips</td><td>Eppendorf</td><td>5242956003</td><td></td></tr><tr><td>Dumont #5 forceps&amp;nbsp;</td><td>Sigma-Aldrich</td><td>F6521</td><td></td></tr><tr><td>stage micrometer&amp;nbsp;</td><td>Pyser- SGI</td><td>02A00404</td><td></td></tr></tbody></table>

evaluation of zebrafish kidney function using a fluorescent clearance assay

제브라 피쉬 배아 형성기를 공부하고 인간의 유전 질환을 모델로 다루기 쉬운 모델을 제공합니다. 그 단순함에도 불구하고, 제브라 피쉬의 신장 개발 및 인간과 거의 같은 방식으로 작동합니다. 인간 신장의 구성에 큰 차이를 갖는 두 지브라 피쉬 비교 네프론 수백만의 존재이다. 그러나, 기본 기능 단위로 같은 복잡한 시스템을 단순화하면 신장이 개발하고 운영하는 방법에 대한 우리의 이해를 도왔습니다. 제브라 피쉬에서 사구체에있는 중간 선은 배설강에서 서로 융합하기 전에 배아 축 아래로 양측 실행 분기 두 pronephric 세관에 초기 혈액 여과를 담당합니다. pronephric 세관은 크게 마지막으로 배설강 2-4로 종료하기 전에 다양한 용질의 교환을 허용, 분할 가느 다란 관을 따라 여과 액의 이동을 용이하게 운동성 섬모에 의해 채워집니다. CKD, INC에 대한 책임을 많은 유전자ciliogenesis에 관련된 사람들을 luding, 제브라 피쉬 (5)에서 연구되고있다. 그러나, 주요 연신 다시 유전자 조작 후에 지브라 피쉬 신장 기능 평가에있어서의 어려움이 있었다. 인간은 주로 자신의 수중 환경과 작은 크기로, 제브라 피쉬의 비 번역을 입증 한 전통적인 분석은 신장 기능 장애를 측정합니다. 예를 들어, 배아 및 우레아 크레아티닌 함량의 분석을 위해 준비된으로부터 물고기가 너무 작을 경우, 혈액을 추출하기 위해 물리적으로 불가능하다. 또한, 제브라 피쉬는 종종 초기 환자 시험 중에 수행되는 간단한 단백뇨 &#39;봉&#39;에서 테스트에 대한 충분한 소변을 생산하지 않습니다. 우리는 신기능 1,6-9에서 판독을주고, 혈관계로부터 밖으로 신장을 통해 정량적으로 시간이 지남에 따라 형광 염료의 간극을 모니터링 지브라 피쉬의 광학적 투명성을 이용하여 형광 분석법을 설명한다.

전 세계적으로 16 16만명 : Bardet-Biedl 증후군 (BBS)는 약 1에 영향을 미치는 희귀 이종 ciliopathy입니다. 다낭성 신장을 포함하여 관련된 문제의 번호와 현재의 환자는, 이후 환자는 자주 신장 투석 또는 이식 (24)를 필요로한다. ESRF CKD 16은 현상 환자의 약 30 %로, BBS에서 사망의 가장 흔한 원인이다. 현재, 20 비 관련 유전자는 게시 된 유전자형 - 표현형 협회 BBS에 연루되어있다. BBS 단백질은 환자의 특성 특성과 함께, ciliopathy 진단을 추론, 섬모와 기초 단체 내에서 일반적인 단백질 현지화 도메인을 공유 할 수 있습니다. BBS9 함께 다른 BBS와 (BBS1, BBS2, BBS4, BBS5, BBS7, BBS8) 단백질이 주 섬모 (24)의 형성에 BBSome 복잡한 책임의 핵심을 형성 Parathyoid 호르몬 응답 B1 (PTHB1) 단백질을 암호화한다. BBS (c)의 6 %에 대한 BBS9 계정의 돌연변이ASE에 24. 또한, PTH는 신장 결함 (25)를 표시 할 수 있습니다 제브라 피쉬의 bbs9 기능의 손실을 제안, 신장 상피 세포 증식의 촉진을 통해 신장 낭종 형성에 관여하고있다. bbs9 넉다운 제브라 피쉬 모델을 이용하여 이전 보고서 기재된 신장 기능 분석 (26)을 설명 할 수있는 기회를 제시하는, 신장에 대한 설명을 제외. bbs9 기능의 최저는 1 - 4 셀 단계에서 주입하여 제브라 피쉬에서 인간의 베타 - 글로빈의 인트론 변이에 대해 유전자 특정 bbs9 번역 및 병렬 표준 음성 대조군 모르 폴리 노에를 차단하는 안티센스 모르 폴리 노를 달성했다 (4 NG bbs9 MO, 순서 : GGCCTTAAACAAAGACATCCTGTAA 4 NG 제어 MO, 순서 : CCTCTTACCTCAGTTACAATTTATA). 우리는이 분석 할 수있는 적절한 모델이었다 제안, bbs9 기능의 손실이 5 DPF에 의해 pronephric 낭종을 표시 배아의 40 %의 결과 발견로다 민 덱스 트란 통관 분석법을 이용하여 신장 기능. 61.0 ± 10.3 SEM, N = 10 : bbs9 MO; 14.8 ± 1.2 SEM N = 9 : 사기꾼 - 우리는 24 HPI는 대조군과 비교 한 후 morphant 물고기 (그림 3) 형광 염료를 취소 할 수있는 능력의 현저한 감소가 관찰 ; 짝 t 테스트 값 P : 0.002). 감소 혈액 순환으로 인해 수 클리어런스를 감소 가능성을 배제하기 위해, 배아가 심장 박동 및 순환 혈액 세포를 평가 하였다, 제어 및 morphant 물고기는 모두 유사한 심장 박동과 혈액의 흐름을했다. 이러한 데이터는 신장 기능이 bbs9의 morphants에 손상을 나타냅니다. 실제로, bbs9 morphant 배아 BBS 환자에서 관찰 동시 낭성 pronephric 세관을 개발한다. <img alt="그림 1" src="/files/ftp_upload/52540/52540fig1highres.jpg" width="700" /> 그림 1. 장비 준비및 설정을. (A) 붕규산 모세 혈관은 적절한 바늘 풀러를 사용하여 미세 주입을 위해 당겨해야합니다. 바늘이 바늘을 종료 RD 수 있도록 집게 (점선)와 속보 필요,주의가 너무 많이 교정 할 수없는 바늘을 렌더링 바늘을 중단하지 않도록주의해야한다. 스케일 바 :. 200 μm의 (B) 배아 조작 및 방향에 대한 아가로 오스 금형 유리 슬라이드 및 플라스틱 피펫을 함께 접착으로 유행 할 수있다 (C) 표준 미세 주입 설정.. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52540/52540fig1highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오 .</a> <img alt="그림 2" src="/files/ftp_upload/52540/52540fig2highres.jpg" width="700" /> 심장 막 주머니에 로다 민 덱스 트란 그림 2. 미세 주입. (A) (10) INC의 드롭 크기를 보정rements 1mm 무대 십자선에 (100 ㎛). (B) 조직 (화살표)를 관통 용이하게 꼬리 인두 아치, 난황과 마음 사이의 교차점을 표시 틈에 바늘 (검은 색 화살표)의 정확한 위치. 스케일 바 :. 200 μm의 (C) 로다 민 덱스 트란 빠르게 전체 혈관 (흰색 화살표)에 의해 흡수 볼 수 있습니다. 100 픽셀 중앙 마음 (노란색 사각형)을 포함하는 이익의 2 영역은 평균 회색 값 때문에 픽셀 / 형광 강도의 측정을 위해 사용되어야한다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52540/52540fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52540/52540fig3highres.jpg" width="700" /> bbs9 그림 3. 넉다운에 결함이 신장 FUNC 발생제브라 피쉬의 기. (A) 배아 제어 또는 bbs9의 morphant 배아 중 하나에 각각 3 HPI 24 HPI, 상단과 하단에 두 개의 패널에서 로다 민 덱스 트란과 심낭에 주입. 화살촉은 심장을 나타냅니다; 화살표는 pronephric 낭종의 형성을 나타냅니다. (B) 비율 형광 강도가 bbs9의 MO 배아 대 제어 24 HPI 후 남아. 오차 막대는 평균 (SEM)의 표준 오차를 표시 ** P ≤ 0.01. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52540/52540fig3highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Evaluation of Zebrafish Kidney Function Using a Fluorescent Clearance Assay at JoVE.com

Evaluation of Zebrafish Kidney Function Using a Fluorescent Clearance Assay

제브라 피쉬는 만성 신장 질환 (CKD)을 모델로 인기있는 도구입니다. 그러나, 작은 크기 것이 불가능 전통적인 방법을 이용하여 신장 기능을 평가한다. 우리는 CKD에 제브라 피쉬의 신장 기능의 정량 분석을 할 수있는 형광 염료 신장 클리어런스 분석 한 설명합니다.

형광 정리 분석을 사용하여 Zebrafish의 신장 기능의 평가

The zebrafish embryo offers a tractable model to study organogenesis and model human genetic disease. Despite its relative simplicity, the zebrafish ...

evaluation-zebrafish-kidney-function-using-fluorescent-clearance

Universidad San Sebastian

Research

JoVE Journal

Biology

13.1K 조회수.  University College London.  제브라 피쉬는 만성 신장 질환 (CKD)을 모델로 인기있는 도구입니다. 그러나, 작은 크기 것이 불가능 전통적인 방법을 이용하여 신장 기능을 평가한다. 우리는 CKD에 제브라 피쉬의 신장 기능의 정량 분석을 할 수있는 형광 염료 신장 클리어런스 분석 한 설명합니다. 

비디오: Evaluation of Zebrafish Kidney Function Using a Fluorescent Clearance Assay

Kidney Regeneration in Adult Zebrafish by Gentamicin Induced Injury

The kidney is essential for fluid homeostasis, blood pressure regulation and filtration of waste from the body. The fundamental unit of kidney function is the nephron. Mammals are able to repair existing nephrons after injury, but lose the ability to form new nephrons soon after birth. In contrast to mammals, adult fish produce new nephrons (neonephrogenesis) throughout their lives in response to growth requirements or injury. Recently, lhx1a has been shown to mark nephron progenitor cells in the adult zebrafish kidney, however mechanisms controlling the formation of new nephrons after injury remain unknown. Here we show our method for robust and reproducible injury in the adult zebrafish kidney by intraperitoneal (i.p.) injection of gentamicin, which uses a noninvasive visual screening process to select for fish with strong but nonlethal injury. Using this method, we can determine optimal gentamicin dosages for injury and go on to demonstrate the effect of higher temperatures on kidney regeneration in zebrafish.

Here we present a reliable method to study adult kidney regeneration by inducing acute kidney injury by gentamicin injection. We show that injury is dependent on gentamicin dosage and environmental temperature using in situ hybridization to label lhx1a+ developing new nephrons.

겐타 마이신 유도 부상으로 성인 Zebrafish의에서 신장 재생

The kidney is essential for fluid homeostasis, blood pressure regulation and filtration of waste from the body. The fundamental unit of kidney function is ...

연구

발생학

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

광 변환 한 후 형광 붕괴를 사용하여 생활 Zebrafish의 태아의 단백질 안정성을 측정 (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Analysis of Zebrafish Kidney Development with Time-lapse Imaging Using a Dissecting Microscope Equipped for Optical Sectioning

In order to understand organogenesis, the spatial and temporal alterations that occur during development of tissues need to be recorded. The method described here allows time-lapse analysis of normal and impaired kidney development in zebrafish embryos by using a fluorescence dissecting microscope equipped for structured illumination and z-stack acquisition. To visualize nephrogenesis, transgenic zebrafish (Tg(wt1b:GFP)) with fluorescently labeled kidney structures were used. Renal defects were triggered by injection of an antisense morpholino oligonucleotide against the Wilms tumor gene wt1a, a factor known to be crucial for kidney development.
The advantage of the experimental setup is the combination of a zoom microscope with simple strategies for re-adjusting movements in x, y or z direction without additional equipment. To circumvent focal drift that is induced by temperature variations and mechanical vibrations, an autofocus strategy was applied instead of utilizing a usually required environmental chamber. In order to re-adjust the positional changes due to a xy-drift, imaging chambers with imprinted relocation grids were employed.
In comparison to more complex setups for time-lapse recording with optical sectioning such as confocal laser scanning&#160;or light sheet microscopes, a zoom microscope is easy to handle. Besides, it offers dissecting microscope-specific benefits such as high depth of field and an extended working distance.
The method to study organogenesis presented here can also be used with fluorescence stereo microscopes not capable of optical sectioning. Although limited for high-throughput, this technique offers an alternative to more complex equipment that is normally used for time-lapse recording of developing tissues and organ dynamics.

The method described here allows time-lapse analysis of organ development in zebrafish embryos by using a fluorescence dissecting microscope capable of performing optical sectioning and simple strategies of readjustment to correct focal and planar drift.

해부 현미경을 사용하여 시간 경과 영상과 Zebrafish의 신장 개발의 분석 광학 단면에 대한 장착

In order to understand organogenesis, the spatial and temporal alterations that occur during development of tissues need to be recorded. The method ...

Precise Cellular Ablation Approach for Modeling Acute Kidney Injury in Developing Zebrafish

Acute Kidney Injury (AKI) is a common medical condition with a high mortality rate. With the repair abilities of the kidney, it is possible to restore adequate kidney function after supportive treatment. However, a better understanding of how nephron cell death and repair occur on the cellular level is required to minimize cell death and to enhance the regenerative process. The zebrafish pronephros is a good model system to accomplish this goal because it contains anatomical segments that are similar to the mammalian nephron. Previously, the most common model used to study kidney injury in fish was the pharmacological gentamicin model. However, this model does not allow for precise spatiotemporal control of injury, and hence it is difficult to study cellular and molecular processes involved in kidney repair. To overcome this limitation, this work presents a method through which, in contrast to the gentamicin approach, a specific Green Fuorescent Protein (GFP)-expressing nephron segment can be photoablated using a violet laser light (405 nm). This novel model of AKI provides many advantages that other methods of epithelial injury lack. Its main advantages are the ability to &#34;dial&#34; the level of injury and the precise spatiotemporal control in the robust in vivo animal model. This new method has the potential to significantly advance the level of understanding of kidney injury and repair mechanisms.

This work presents a new in vivo model of segmental kidney injury using kidney GFP transgenic zebrafish. The model allows for the induction of the targeted ablation of kidney epithelial cells to show the cellular mechanisms of nephron injury and repair.

Zebrafish 개발에 급성 신부전 모델링을위한 정확한 세포 제거 방법

Acute Kidney Injury (AKI) is a common medical condition with a high mortality rate. With the repair abilities of the kidney, it is possible to restore ...

Intravenous Microinjections of Zebrafish Larvae to Study Acute Kidney Injury

In this video article we describe a zebrafish model of AKI using gentamicin as the nephrotoxicant.  The technique consists of intravenous microinjections on 2 dpf zebrafish. This technique represents an efficient and rapid method to deliver soluble substances into the bloodstream of zebrafish larvae, allowing for the injection of 15-20 fish per hour. In addition to AKI studies, this microinjection technique can also be used for other types of experimental studies such as angiography.  We provide a detailed protocol of the technique from equipment required to visual measures of decreased kidney function. In addition, we also demonstrate the process of fixation, whole mount immunohistochemistry with a kidney tubule marker, plastic embedding and sectioning of the larval zebrafish. We demonstrate that zebrafish larvae injected with gentamicin show morphological features consistent with AKI: edema, loss of cell polarity in proximal tubular epithelial cells, and morphological disruption of the tubule.

We describe a technique of microinjecting the aminoglycoside, gentamicin, into 2 days post-fetilization (dpf) zebrafish larvae to induce acute kidney injury (AKI). We also describe a method for whole mount immunohistochemistry, plastic embedding and sectioning of zebrafish larvae to visualize the AKI mediated damage.

급성 신장 상해를 공부하기 위해 Zebrafish 애벌레의 정맥 Microinjections

In this video article we describe a zebrafish model of AKI using gentamicin as the nephrotoxicant.  The technique consists of intravenous microinjections ...

생물학

Transplantation of Cells Directly into the Kidney of Adult Zebrafish

Regenerative medicine based on the transplantation of stem or progenitor cells into damaged tissues has the potential to treat a wide range of chronic diseases1. However, most organs are not easily accessible, necessitating the need to develop surgical methods to gain access to these structures. In this video article, we describe a method for transplanting cells directly into the kidney of adult zebrafish, a popular model to study regeneration and disease2. Recipient fish are pre-conditioned by irradiation to suppress the immune rejection of the injected cells3. We demonstrate how the head kidney can be exposed by a lateral incision in the flank of the fish, followed by the injection of cells directly in to the organ. Using fluorescently labeled whole kidney marrow cells comprising a mixed population of renal and hematopoietic precursors, we show that nephron progenitors can engraft and differentiate into new renal tissue - the gold standard of any cell-based regenerative therapy. This technique can be adapted to deliver purified stem or progenitor cells and/or small molecules to the kidney as well as other internal organs and further enhances the zebrafish as a versatile model to study regenerative medicine.

Cell transplantation is an essential technique for studying tissue regeneration and for developing cell-based therapies of disease. We demonstrate here a microsurgical technique that permits the transplantation of genetically labeled cells directly into the kidney of adult zebrafish fish.

직접 성인 Zebrafish의 신장에 세포의 이식

Regenerative medicine based on the transplantation of stem or progenitor cells into damaged tissues has the potential to treat a wide range of chronic ...

Dissection of the Adult Zebrafish Kidney

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem cells during normal homeostasis and disease states. The understanding of adult stem cells has broad reaching implications for the future of regenerative medicine1. For example, better knowledge about adult stem cell biology can facilitate the design of therapeutic strategies in which organs are triggered to heal themselves or even the creation of methods for growing organs in vitro that can be transplanted into humans1. The zebrafish has become a powerful animal model for the study of vertebrate cell biology2. There has been extensive documentation and analysis of embryonic development in the zebrafish3. Only recently have scientists sought to document adult anatomy and surgical dissection techniques4, as there has been a progressive movement within the zebrafish community to broaden the applications of this research organism to adult studies. For example, there are expanding interests in using zebrafish to investigate the biology of adult stem cell populations and make sophisticated adult models of diseases such as cancer5. Historically, isolation of the zebrafish adult kidney has been instrumental for studying hematopoiesis, as the kidney is the anatomical location of blood cell production in fish6,7. The kidney is composed of nephron functional units found in arborized arrangements, surrounded by hematopoietic tissue that is dispersed throughout the intervening spaces. The hematopoietic component consists of hematopoietic stem cells (HSCs) and their progeny that inhabit the kidney until they terminally differentiate8. In addition, it is now appreciated that a group of renal stem/progenitor cells (RPCs) also inhabit the zebrafish kidney organ and enable both kidney regeneration and growth, as observed in other fish species9-11. In light of this new discovery, the zebrafish kidney is one organ that houses the location of two exciting opportunities for adult stem cell biology studies. It is clear that many outstanding questions could be well served with this experimental system. To encourage expansion of this field, it is beneficial to document detailed methods of visualizing and then isolating the adult zebrafish kidney organ. This protocol details our procedure for dissection of the adult kidney from both unfixed and fixed animals.
Dissection of the kidney organ can be used to isolate and characterize hematopoietic and renal stem cells and their offspring using established techniques such as histology, fluorescence activated cell sorting (FACS)11,12, expression profiling13,14, and transplantation11,15. 
We hope that dissemination of this protocol will provide researchers with the knowledge to implement broader use of zebrafish studies that ultimately can be translated for human application.

The zebrafish kidney is home to both renal and hematopoietic adult stem/progenitor cells, and represents an outstanding opportunity to study these cell types and their progeny in a vertebrate model organism. Here, we demonstrate a detailed dissection procedure that enables the researcher to identify and surgically remove the adult zebrafish kidney, which can be used for applications such as cell isolation, transplantation, and expression studies of kidney and/or blood cell populations.

성인 Zebrafish의 신장의 해부

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem ...

Analysis of Nephron Composition and Function in the Adult Zebrafish Kidney

The zebrafish model has emerged as a relevant system to study kidney development, regeneration and disease. Both the embryonic and adult zebrafish kidneys are composed of functional units known as nephrons, which are highly conserved with other vertebrates, including mammals. Research in zebrafish has recently demonstrated that two distinctive phenomena transpire after adult nephrons incur damage: first, there is robust regeneration within existing nephrons that replaces the destroyed tubule epithelial cells; second, entirely new nephrons are produced from renal progenitors in a process known as neonephrogenesis. In contrast, humans and other mammals seem to have only a limited ability for nephron epithelial regeneration. To date, the mechanisms responsible for these kidney regeneration phenomena remain poorly understood. Since adult zebrafish kidneys undergo both nephron epithelial regeneration and neonephrogenesis, they provide an outstanding experimental paradigm to study these events. Further, there is a wide range of genetic and pharmacological tools available in the zebrafish model that can be used to delineate the cellular and molecular mechanisms that regulate renal regeneration. One essential aspect of such research is the evaluation of nephron structure and function. This protocol describes a set of labeling techniques that can be used to gauge renal composition and test nephron functionality in the adult zebrafish kidney. Thus, these methods are widely applicable to the future phenotypic characterization of adult zebrafish kidney injury paradigms, which include but are not limited to, nephrotoxicant exposure regimes or genetic methods of targeted cell death such as the nitroreductase mediated cell ablation technique. Further, these methods could be used to study genetic perturbations in adult kidney formation and could also be applied to assess renal status during chronic disease modeling.

The zebrafish adult kidney is an excellent system for renal regeneration and disease studies. An essential aspect of such research is the assessment of nephron structure and function. This protocol describes several methodologies that can be implemented to assess nephron tubule composition and to evaluate renal reabsorption.

성인 Zebrafish의 신장에서 네프론의 구성 및 기능 분석

The zebrafish model has emerged as a relevant system to study kidney development, regeneration and disease. Both the embryonic and adult zebrafish kidneys ...

A Manual Small Molecule Screen Approaching High-throughput Using Zebrafish Embryos

Zebrafish have become a widely used model organism to investigate the mechanisms that underlie developmental biology and to study human disease pathology due to their considerable degree of genetic conservation with humans. Chemical genetics entails testing the effect that small molecules have on a biological process and is becoming a popular translational research method to identify therapeutic compounds. Zebrafish are specifically appealing to use for chemical genetics because of their ability to produce large clutches of transparent embryos, which are externally fertilized. Furthermore, zebrafish embryos can be easily drug treated by the simple addition of a compound to the embryo media. Using whole-mount in situ hybridization (WISH), mRNA expression can be clearly visualized within zebrafish embryos. Together, using chemical genetics and WISH, the zebrafish becomes a potent whole organism context in which to determine the cellular and physiological effects of small molecules. Innovative advances have been made in technologies that utilize machine-based screening procedures, however for many labs such options are not accessible or remain cost-prohibitive. The protocol described here explains how to execute a manual high-throughput chemical genetic screen that requires basic resources and can be accomplished by a single individual or small team in an efficient period of time. Thus, this protocol provides a feasible strategy that can be implemented by research groups to perform chemical genetics in zebrafish, which can be useful for gaining fundamental insights into developmental processes, disease mechanisms, and to identify novel compounds and signaling pathways that have medically relevant applications.

The zebrafish is an excellent experimental organism to study vertebrate developmental processes and model human disease. Here, we describe a protocol on how to perform a manual high-throughput chemical screen in zebrafish embryos with a whole-mount in situ hybridization (WISH) read-out.

Zebrafish의 배아를 사용하여 높은 처리량 접근 수동 작은 분자 화면

Zebrafish have become a widely used model organism to investigate the mechanisms that underlie developmental biology and to study human disease pathology ...

Acute Kidney Injury Model Induced by Cisplatin in Adult Zebrafish

Cisplatin is commonly used as chemotherapy. Although it has positive effects in cancer-treated individuals, cisplatin can easily accumulate in the kidney due to its low molecular weight. Such accumulation causes the death of tubular cells and can induce the development of Acute Kidney Injury (AKI), which is characterized by a quick decrease in kidney function, tissue damage, and immune cells infiltration. If administered in specific doses cisplatin can be a useful tool as an AKI inducer in animal models. The zebrafish has appeared as an interesting model to study renal function, kidney regeneration, and injury, as renal structures conserve functional similarities with mammals. Adult zebrafish injected with cisplatin shows decreased survival, kidney cell death, and increased inflammation markers after 24 h post-injection (hpi). In this model, immune cells infiltration and cell death can be assessed by flow cytometry and TUNEL assay. This protocol describes the procedures to induce AKI in adult zebrafish by intraperitoneal cisplatin injection and subsequently demonstrates how to collect the renal tissue for flow cytometry processing and cell death TUNEL assay. These techniques will be useful to understand the effects of cisplatin as a nephrotoxic agent and will contribute to the expansion of AKI models in adult zebrafish. This model can also be used to study kidney regeneration, in the search for compounds that treat or prevent kidney damage and to study inflammation in AKI. Moreover, the methods used in this protocol will improve the characterization of tissue damage and inflammation, which are therapeutic targets in kidney-associated comorbidities.

This protocol describes the procedures to induce Acute Kidney Injury (AKI) in adult zebrafish using cisplatin as a nephrotoxic agent. We detailed the steps to evaluate the reproducibility of the technique and two techniques to analyze inflammation and cell death in the renal tissue, flow cytometry and TUNEL, respectively.

성인 얼룩말 피시에 있는 Cisplatin에 의해 유도된 급성 신장 상해 모형

Cisplatin is commonly used as chemotherapy. Although it has positive effects in cancer-treated individuals, cisplatin can easily accumulate in the kidney ...