Name: studying dna looping by single-molecule fret
Uploaded: 2014-06-28T15:00:00.000+00:00
Duration: 11 min 27 s
Description: Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

우리는 비판적으로 원고를 읽는 제임스 워터스, 이블 워즈워스와 보 브로드 감사합니다. 우리는 또한 우리의 유용한 의견을 제공하는 네 개의 익명의 검토를 부탁드립니다. 우리는 조지아 공업 대학교, 과학 인터페이스에서 버로우즈 웰컴 기금 경력 상 및 리빙 시스템의 NSF 물리학에서 학생 연구 네트워크 지원 사업 재정 지원을 인정합니다.

1. dsDNA 샘플 준비 <ol><li> 10 메르 순서를 반복하여 전 세계적으로 곡선의 DNA를 디자인합니다. 예를 들어, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;는 186-BP 곡선 X는 임의의 추가 자료입니다 DNA와 반복 10 메르 순서를 측면에서는 순서가 어댑터 시퀀스입니다이다. 참고 :.이 예에서 카플란 등으로 대규모 뉴 클레오 점유율 조사 결과를 기반으로 뉴 클레오 솜 형성에 반대 환경과 2 개의 10-MERS 15이 선택되었다. dsDNA의 나선형 반복 10 BP 부근에 있기 때문에, 10 - 머의 나선 축의 순 편향은 원호 (그림 3A)와 같은 모양을 생산하기 위해 축적됩니다. 헬리컬 기간 10.5 BP에 접근하기 때문에, 여분의 염기는 가능한 한 평면으로 만곡 구조를 유지하기 위해 매 2 반복 후에 삽입된다. 200 BP보다 짧은이 시퀀스는 대기업에서 주문할 수 있습니다의 그 제안의 유전자 합성 서비스를 제공합니다. 그것은 다음 단계에 대한 일반적인 어댑터 시퀀스 이러한 시퀀스를 측면에 편리합니다. 절차는도 3b에 도식화한다. </li><li> 프라이머 1 (GTGCCAGCAACAGATAGC) 프라이머 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG)과 PCR을 수행합니다. 참고 : 프라이머 2는 5 &#39;말단의 FRET 기증자를 Cy3가 표시되어 있습니다. 전형적인 PCR 제조법 및 사이클링 프로토콜은 표 1 및 표 2에 나타낸다. </li><li> 프라이머 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) 프라이머 4 (CAACAACGAGCTCGAATG)과 PCR을 수행합니다. 참고 : 프라이머 3 5 &#39;말단의 백본과 비오틴 링커를 통해 FRET 수용체 Cy5에가 표시되어 있습니다. PCR 제조법 및 순환 프로토콜은 위와 같이되어 있습니다. </li><li> 정리 PCR 키트를 사용하여 PCR 제품을 정제. </li><li> 0.4 &amp;의 최종 농도로 가닥 교환을위한 버퍼 (100 ㎜의 NaCl, 10 MM 트리스 - 염산의 pH 7.0, 1 mM의 EDTA)의 Cy3로 표지 된 제품과 Cy5에 레테르를 붙인 제품을 혼합# 181; 각각 M과 0.1 μM,. NOTE : 과량를 Cy3-DNA 가닥은 과거의 결과를 Cy3 및 Cy5의 양을 운반하는 이중의 농도를 증가시킨다. </li><li> 2 분 동안 98.5 ° C에서 배양하여 Exchange 물가는 점차 5 냉각 ° C 0.1 ° C / 초 램프 속도로, 그리고 5에서 배양 &#160; 2 시간 동안 C를 °. </li></ol> 2. 젤 전기는 dsDNA 곡률을 감지하는 <ol><li> 29.2:0.8의 비율로 아크릴 아미드 및 비스 - 아크릴 아미드 솔루션을 혼합하여 폴리 아크릴 아마이드 젤 (16, 17)을 붓고, 5 % (W / V)의 pH 8.0에서 1X 트리스 / 붕산염 / EDTA (TBE) 버퍼. 주 : 겔 용액 10 ml를 포함 1.217 ml의 40 % 아크릴 아미드 0.667 ml의 2 % 비스 아크릴 아미드, 1 ㎖ TBE 10X를 100 L 황산 암모늄 (APS) 10 %, 10 L TEMED, 및 나머지 dH보다 2 O.이며 젤의 전체 응고 약 30 분 소요됩니다. </li><li> DNA 샘플 및 1X 로딩 버퍼의 DNA 사다리 (5 % 글리세롤, 0.03 % (w / v)의 브로 모 페놀의 BL로 폴리 아크릴 아마이드 젤을로드UE)과 5-8에서 젤을 실행하는 45 분 동안 4 ° C에서 또는 염료 앞까지 V / cm 겔의 끝을 접근한다. </li><li> 30 분 동안 0.5 g / ml의 에티 디움 브로마이드를 포함 1X TBE 버퍼를 사용하여 겔을 염색. UV 조명 아래의 DNA 밴드를 확인합니다. DNA 분자의 외관상의 크기를 계산하는 크기의 마커 (100 염기쌍의 DNA 사다리)와 밴드 위치를 비교. 참고 : 곡선의 DNA는 일반적으로 직선 DNA를보다 느리게 이동합니다. </li></ol> 3. 셀 준비 흐름 <ol><li> 드릴 프레스와 다이아몬드 드릴 비트를 사용하여 유리 슬라이드의 두 양 모서리 (3 &#39;&#39; × 1 &#39;&#39;)를 따라 구멍을 6 ~ 7 쌍을 뚫습니다. 훈련 후, 눈에 보이는 유리 분말을 제거하기 위해 흐르는 물에 슬라이드를 문질러. 참고 : 구멍은 관류 입구와 출구 역할을한다. 훈련하는 동안, 물 슬라이드를 냉각 균열을 방지하는 것이 중요합니다. </li><li> 유리 항아리에 수직 슬라이드를 놓고 물을 채운다. 15 분 동안 초음파 처리하고 다른 유리 항아리 데에 전송할아세톤 청소 dicated. 15 분 동안 아세톤 및 초음파 처리로 입력합니다. 다음 스프레이 용기와 물을 사용하여 에탄올로 슬라이드를 씻어. 폴리 프로필렌 용기에 배치, 5 M 수산화 칼륨으로 채우고, 초음파 처리 15 분. 마지막으로, 15 분 동안 물에 슬라이드를 초음파 처리. 동일한 프로토콜을 이용하여 커버 슬립 (1 번, 24 × 40 mm)를 청소한다. 참고 : 청소 슬라이드와 커버 슬립 장기 사용을 위해 dH보다 2 O에 저장 될 수 있습니다. </li><li> 0.1 M 중탄산 나트륨 용액 340 L로 실란 MPEG-80 MG (MW 2000)와 함께 비오틴-PEG-실란 한 MG (MW 3,400)를 혼합한다. 잘 섞어 거품을 제거하기 위해 잠시 동안 혼합물을 원심 분리기. 참고 : 폴리에틸렌 글리콜 (PEG)로 표면의 작용은 표면에 DNA의 비특이적 결합을 줄일 수 있습니다. </li><li> 각 슬라이드에 PEG 용액 80 L를 넣고 부드럽게 그 위에 커버 슬립을 낮 춥니 다. 45 분 동안 기다립니다. 족집게로 슬라이드에서 커버 슬립을 분리 dH보다 2 O의 풍부한 양을 씻어 보자 t야외에서 단 건조. </li><li> 채널을 형성하기 위해 슬라이드를 통해 양면 테이프의 얇은 스트립을 놓습니다. 그 위에 커버 슬립을 맞추고 단단히 액체 꽉 채널을 형성하기 위해 슬라이드에 커버 슬립을 누릅니다. 채널의 가장자리를 밀봉하기 위해 5 분 에폭시를 사용합니다. </li></ol> 트롤 솔루션 4. 준비 <ol><li> 플라스크에 ~ 30 mg의 트롤과 10 ㎖ dH보다 2 O를 넣고 18 시간 동안 야외에서 솔루션을 저어 자석 교반 막대를 사용합니다. </li><li> 0.2 μm의 필터를 사용하여 솔루션을 필터링하고 1 M 트리스베이스 (산도 11)의 ~ 6 μl를 첨가하여 pH를 7로 조정합니다. 참고 : 트롤은 일반적으로 18 연구 단일 분자에 사용되는 항 깜박 시약입니다. 트롤의 antifading 조치는 부분적으로 저하 트롤 솔루션 19에 존재하는 산화 된 파생 상품에서 비롯됩니다. 신속 메탄올 또는 높은 pH 트리스 용액에 트롤 록스를 용해하기 때문에 비효율적 산화 피해야한다. </li></ol> 5. 싱글 몰ecule 이미징 <ol><li> 채널로 뉴트라 비딘 용액 (0.5 ㎎ / ㎖)의 15 μl를 주입 및 T50 버퍼 100 μL (10 MM 트리스 - 염산, 50 mM의 염화나트륨, 산도 7.0)로 세척하기 전에 2 분 동안 기다립니다. </li><li> 채널에 DNA 샘플 (50 ~ 100 PM)의 50 μl를 주입한다. 5 분 동안 기다린 T50 버퍼 100 L 멀리 언 바운드 DNA를 씻어. NOTE : DNA 분자는 구체적 뉴트라 비딘 - 비오틴 상호 작용을 통해 표면에 결합 할 것이다. </li><li> 산소 소거 시스템 (20) (100 ㎜ PCD, 5 mM의 PCA, 1 mM의 트롤 록스, 및 500 mM의 염화나트륨)을 포함 촬상 완충액으로 채널을 채운다. </li><li> 초당 25 프레임 컴퓨터에 2 × 2 비닝 이미지 (256 X 256)를 스트리밍 프레임 전송 모드 EMCCD를 설정합니다. </li><li> 현미경 대물에 침지 기름을 넣어 시험편 클립을 사용하는 현미경 스테이지 상에 플로우 셀을 고정한다. 벽에 레이저 반사 패턴을 보면 초점을 거친 조정합니다. 형광 메신저의 라이브 뷰를 사용하여 초점을 미세 조정모니터의 나이. </li><li> 에 532 nm의 레이저로 데이터 수집을 시작합니다. 라이브 뷰를 확인하고 필요한 경우 초점을 조정합니다. 대부분의 분자가 photobleached 때 데이터 수집을 중지합니다. 참고 :이 시설에서 현미경을 제어하고이 하드 디스크에 저장 될 때 모니터에 실시간 영상을 표시 할 수있는 연구소가 작성한 C 프로그램에 사용됩니다. </li></ol> 6. 이미지 처리 및 데이터 분석 NOTE : 256 X 256 화상의 시계열를 Cy3 및 Cy5의 강도의 단일 분자 시간 트레이스를 생성하는 MATLAB 코드에 의해 처리된다. 기증자 채널 및 분할보기 이미지의 수용체 채널 사이의 픽셀 쌍을하려면를 Cy3와 Cy5에 반점이 6 ~ 7 쌍, 균등하게 시야에 분산 동일한 분자에서 각 쌍은, 수동으로 아핀 변환에게 포착하고있다 앵커 지점으로이 지점의 좌표를 사용하여 계산됩니다. <ol><li> MATLAB 스크립트를 사용하여 모든 단일 분자의 시간을 통해 봐 t을 추적낮은 높은 FRET 신호 사이의 모자 쇼 다수 전환. 루프와 unlooped 상태를 확인합니다. 참고 : FRET 신호가 Cy5에 강도로 정의된다 (나는)를 Cy3와 Cy5에 강도의 합 (내가 수비 I +)로 나눈. unlooped 상태가 낮은 FRET 값을 가지고있는 동안 루프 상태는 하이 FRET 값이 있습니다. 하나의 분자에서 FRET 신호의 히스토그램 bimodally 때문에 가역 루프와 unlooping으로 배포됩니다. </li><li> 두 개의 장착 가우스 곡선의 교차를 결정하여 두 배포판을 구분하는 임계 값을 찾을 수 있습니다. </li><li> FRET 효율 등을 계산 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> 높은 FRET 값과 낮은 FRET 값으로 unlooped 상태와 루프 상태를 할당합니다. </li><li> MATLAB 스크립트를 사용하여 분자 (N (t))의 누적 수를 분석 그 루프 (또는데이터 수집이 시작된 이후 서로 다른 시간의 경과에 높은 FRET 상태)에 도달. NOTE : dsDNA 분자는 데이터 수집의 시작 unlooped 상태 중 어느 형태로 시작할 수 있기 때문에, 루프 인구의 증가 속도는 평균 반복 속도는 초기 배좌 평균화 반영한다. 지수 함수와 N (t)를 피팅하여 반복 속도 K 루프를 추출 <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> biphasically 증가하면 두 지수 함수로 적합 할 수있다 : <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> 이 경우, K의 루프로부터 획득된다 : <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTE : 이론적 중합체는 시간 t에서 반복하지 않았다고 생존 확률은 단일 또는 이중 지수 함수 12 아니다. 지수 FITTING는 평균 반복 시간을 추출하는 실용적인 수단으로서 사용된다. </li></ol> 7. J 인자를 결정 NOTE : J 팩터는 dsDNA의 일단은 타단 주위 얼마나 농축 나타낸다. 그것은 측정 반복 속도로 타단 세그먼트와 동일한 반응 속도를 생산할 DNA의 일단 세그먼트의 농도 보간에 의해 결정될 수있다. 실험적으로, 일단 세그먼트는 표면에 고정되고, 타 단부 ​​세그먼트는 특정 농도 C에 도입된다. 양단 간의 측정 어닐 레이트 K 어닐링이면 J 인자 21에 의해 주어진다 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . 어닐링 속도 상수 (k = K 어닐링 어닐링 / C)는 프로브의 농도와 무관하다. <ol><li> 30 ~ 50 μM의 비오틴 - Cy5에 올리고 20 ㎕ (프라이머 3) 흐름 전뉴트라 비딘 코팅 채널 n을. 언 바운드 올리고 씻어 100 μL의 T50와 채널을 씻어. </li><li> 50 nM의 최종 농도를 Cy3 올리고 (프라이머 2)의 첨가 부 (5)에 설명 된대로 촬상 버퍼를 준비한다. 채널로이 촬상 버퍼를 흐른다. </li><li> 에 532 nm의 레이저를 유지하면서, 간단히 표면 바인딩 Cy5에 올리고 위치를 확인하기에 640 nm의 레이저를 켭니다. 640 nm의 레이저를 끄고 FRET 신호를 모니터링을 시작합니다. 참고 : 표면 바인딩 Cy5에 올리고에 Cy3에 올리고 하이브리드시, Cy5의 형광 FRET에서 발생합니다. </li><li> MATLAB 스크립트를 사용하여 결합되지 않은 상태 (낮은 Cy5의 강도)에서 시작하지만 나중에 Cy5의 강도 트레이스에서 시간의 함수로서 소둔 상태 (높은 Cy5의 강도)로 바꾸어 분자의 수를 분석한다. </li><li> 어닐링 분자 대 시간이 수를 그린다. 단일 지수 함수 (과이 곡선에 맞게 <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) 어닐 레이트 (k 어닐링)을 얻었다. </li><li> 어닐 레이트 및 반응물 농도의 선형성을 확인하기 위하여 다양한 Cy3에 올리고 농도 (60, 100 및 180 nm 정도)로 실험을 반복한다. 2 차 열처리 속도 상수 (K 어닐링의 압축을 풉니 다 ) 슬로프에서. </li><li> J 인자에서를 계산 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , k 개의 루프가 동일한 완충액 조건에서 측정 반복 속도이다. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

저자는 관심 없음 충돌 선언하지 않습니다.

FRET 기반으로 간단한 단일 분자 분석은 서로 다른 고유 한 모양의 DNA를 루프의 속도를 연구하는 데 사용되었다. 곡선 DNA를 10.5 BP의 헬리컬주기 위상이 10 - 머 서열을 반복함으로써 제조 할 수 있고, 그 곡률 PAGE를 이용하여 추정 될 수있다. 이 dsDNAs 과도 루프 안정화 할 수 있도록 스티커 끝으로 설계되어 있습니다. 우리는 시간이 지남에 따라 반복 분자의 수의 지수 상승에서 반복 속도를 추출. 끊어진 점착 말단 분절 사이 어닐링 속도 상수는 J 인자로 알려진 루핑 확률 밀도의 농도 당량을 결정하기 위해 사용된다. 리가 아제 기반 DNA 환화 검정법에서 DNA 마감 확률 측정 리가 제의 농도에 민감하고, 리가 아제는 9 과도한 경우 J 팩터는 과대 평가 될 수있다. DNA를 DNA 리가 아제의 비특이적 결합은 루프 (10)에 영향을 미칠 수있다. 또한, ligas전자 활동은 소금에 따라 시간이 지남에 붕괴. 그러므로 그것은 리가 활동에 대한 만족스럽지 못한 조건에서 DNA의 반복을 연구하기가 어렵습니다. 반면, FRET 기반 루프 분석은 이러한 모든 문제에서 자유 롭다. 우리의 실험 프로토콜은 논의의 가치가 두 가지 중요한 측면을 제외하고 Vafabakhsh과 하 (13)의 그것과 유사하다. Vafabakhsh과 하 (13)는 여러 가지 합성 올리고 결찰하여 dsDNA 분자를 구성. 올리고 합성 염기 당 오류 (삽입, 삭제, 또는 대체) 비율이 23 (0.181 % f)는 무시할 수 있지만, 의도하지 않은 DNA 서열의 비율은 올리고 길이에 따라 선형 적으로 증가한다. 따라서,이 프로토콜에 의해 제조 된 100 bp의 이중 샘플은 높은 반복 속도 (24)가 발생할 수 있습니다 ~ 최대 33 % 불완전한 이중 가닥을 포함 할 수 있습니다. 비교에서, 우리는 프로토콜 DNA의 최보다 훨씬 더 높은 충실도를 갖는 dsDNA 분자를 합성하는 중합 효소 연쇄 반응 (PCR)을 사용mosynthesis 25. 제조업체의 자료에 따르면, 우리가 사용하는 하이파이 중합 효소는 PCR 증폭의 30주기 후 99.8 %의 확률로 정확한 100 bp의 DNA 분자를 생성합니다. 두 연구의 또 다른 중요한 차이점은 표면 고정화 방식이다. Vafabakhsh 및 하행 (13)에 의해 프로토콜에서, 이들이 내부베이스를 통해 결합되는 반면 본 연구에서는, DNA 분자는, 그 단부를 통해 표면에 부착된다. 이것은 단독 가둠 효과에 기초하여, 내부적으로 고정 된 dsDNA 다섯 배까지 더 자주 무료 dsDNA보다 루프 내부 (26)은 피닝의 위치에 의존 할 것으로 예측 하였다. DNA 윤곽 길이의 함수로서 J 계수를 측정 할 때 따라서, 내부 피닝 예기치 않은 변화를 도입 할 수있다. 그것은 링커와 수정 된 자료가 더 높은 반복 속도 발생할 수 있습니다 약한 염기쌍 기능을 가지고하는 것도 가능하다. 그러나 desp이러한 명백한 차이를 ITE, 두 프로토콜은 100 BP (~ 3 nm의 대 ~ 2 NM)에 유사한 J 요인을 생산하고 있습니다. 이 FRET 기반의 반복 분석은 27 루핑 dsDNA에 불일치, 흠이나 틈의 효과, DNA는 dsDNA 루핑에 결합 단백질의 효과 및 dsDNA의 유연성의 온도 의존성을 포함하여 dsDNA의 루프와 관련된 현상의 넓은 범위를 공부에 대한 약속을 보유하고 있습니다. 이 항목에서는 기존 리가 기반의 고리 화 반응으로 해결하기 어렵다. FRET 기반 루핑 분석은 또한 중합체의 모델을 시험하는 표준 관계 형상 길이 대 J 계수를 측정 할 수있다. 그러나, 우리는 여기에 제시된 프로토콜은 100 BP보다 짧은 dsDNA의 반복을 공부에 잘 적합하지 않습니다. 이 길이 이하, dsDNA 루핑은 매우 느린, 따라서 측정 속도는 광표백 다른 의도하지 않은 프로세스에 의해 영향을 받게됩니다. 하나는 우리가 명백한 반복 반응 속도를 가속화 할 수 있습니다높은 소금 농도 ([나 +]&gt; 500 ㎜), 그러나 이러한 측정의 생리 학적 관련성을 보내고하는 의심이됩니다. 따라서, 100 bp의 아래 길이의 비늘 굽힘 dsDNA의 조사 고리 화 기반 분석에 접근 직교 도움이됩니다.

dsDNA의 기계적 특성을 이해하는 것은 기초 과학 및 공학 응용 프로그램에서 기본 중요하다. 연속적인 염기쌍 사이의 롤, 상하 이동 및 비틀림 각 시퀀스에 따라 달라질 수 있기 때문에 dsDNA의 구조는 직선 나선형 사다리보다 더 복잡합니다. 열 변동은 dsDNA는, 굽힘 비틀림과 스트레칭 등의 구조적 변동의 다양한 모드를 받아야하는 원인이 될 수 있습니다. 이러한 용융 및 꼬임으로 전환은 극단적 인 조건에서 발생할 수 있습니다. 이러한 움직임 가운데, dsDNA의 굴곡이 가장 눈에 띄는 생물에 미치는 영향 1 있습니다. dsDNA 구부리는 서로 가까운 두 먼 사이트를 가져와 유전자 억제 또는 활성화와 연결되어 있습니다. 또한 DNA를 세포 핵 내부의 포장 또는 바이러스 캡시드에 중요한 역할을한다. dsDNA의 굴곡 변형은 고해상도 현미경 (AFM 2 TEM 3), 및 thermodyn에 의해 실험적으로 시각화 할 수 있습니다amics과 반응 속도는 화학적으로 dsDNA의 병렬 사이트를 링크 반복 분석에 의해 연구 될 수있다. 하나의 분석은 리가에 의존하는 고리 화 4입니다. 이 분석에서 &#39;끈적 끈적한&#39;(응집력) 끝 dsDNA 분자 고리 화하거나 DNA 리가 아제에 의해 이량. 원형 및 이량 체의 비율을 비교하여, 하나는 J 인자로 알려져 타단 근방의 DNA의 일단의 효과적인 몰 농도를 얻을 수있다. 이 J 계수 타단으로부터 짧은 거리에서 DNA의 일단을 찾는 확률 밀도 치수와 동일하며, 따라서 DNA의 유연성을 반영한다. DNA 길이의 함수 J의 계수를 측정하는 것은 지속성 길이 4,5 포함한 DNA 기계에 대한 다양한 특성을 보여준다. 웜과 같은 체인 (WLC) 모델은 널리 expla에서의 성공을 기반으로 dsDNA 역학에 대한 정식 폴리머 모델로 여겨왔다DNA 실험 6 당기는 제대로 이상 200 bp의 7보다 dsDNAs의 J 요인을 예측에서 얻은 힘 - 신장 곡선 ining. 그러나, 100 bp의 짧게 dsDNA 분자의 고리 화 반응의 분석을 사용하여, Cloutier와 Widom는 WLC 모델 예측 8보다 몇 배의 크기로 J 요인을 측정했다. 년 후, 뒤 등. 리가 아제의 낮은 농도로 고리 화 분석법을 사용 WLC 모델과 일치 J 인자 생산 Widom 그룹에서 구를 사용한 높은 리가 아제 농도에 비정상적인 결과를 기인. 기존의 분석 9를 사용하는 경우이 논쟁은 고리 화 반응 속도에 DNA 리가 아제의 피할 수없는 영향을 예시한다. 또한, DNA 리가 아제는 비특이적 결합 10,11 통해 DNA 구조 및 강성에 영향을 미칠 수있다. 단백질에 의존하는 고리를 이루는 분석의 기술적 인 문제를 제거하기 위해, 우리는 최근 제자를 보여 주었다형광 공명 에너지 전달 (FRET) 12을 기준으로 EIN이없는 루프 분석. 이 방법에서, 루프 형 배좌는 DNA 분자의 끈끈한 단부 부근 부착 공여체와 수용체 사이의 FRET에 의해 감지된다. 대물 형 전반사 형광 현미경 (TIRFM)는 가역 루프와 오랜 기간 동안 표면에 고정화 한 DNA 분자로부터 unlooping 이벤트의 궤적을 기록하는 데 사용된다. 이 방법은 Vafabakhsh과 하 (13)에 의해 유사한 방법에 중요한 개선 불일치없는 DNA 분자를 생성하는 DNA 분자의 PCR 기반의 어셈블리를 제공합니다. 이 프로토콜의 단일 분자 측면은 FRET 측면이 하나라도 리가 활동에 악영향을 줄 수 조건에서, 같은 분자에서 반복 DNA 고리를 이루는 역학을 측정 할 수있는 동안뿐만 아니라 분포의 측정이 평균 앙상블 할 수 있습니다. TIRFM 설정은 그림 1에서 볼 수있다. 사용자 정의보기디자인 표본 단계는 올림푸스 IX61 현미경 몸에 배치됩니다. 532 nm 내지 640 nm의 레이저는 측면에서 도입 및 커버 슬립 - 물 계면에 입사 임계각을 달성하기 위해 높은 NA 대물 렌즈에 작은 타원형 미러 (14)에 의해 반사된다. 우리는 더 널리 이색 거울이나 프리즘 기반 TIR의 설정을 사용하여 관통 목적 TIR도이 FRET 응용 프로그램에 사용할 수 있습니다. 현미경에 의해 형성되는 형광 이미지는 다이크로 익 미러에 의해 기증자와 수용체의 이미지로 분할됩니다. 그런 다음 EMCCD의 두 반쪽에 이미지를 다시됩니다. 추가의 롱 패스 배출 필터는 배경 신호를 감소시키기 위해 사용된다. 온도 조절은 재현 운동 데이터를 획득하기위한 필수적입니다. 온도 제어를 위해, 대물가 온도 조절 칠러 / 히터에서 열 전달 및 물을 최소화 현미경 본체의 노즈 피스로부터 분리되어 단단히 끼워 황동 고리를 통해 순환된다목적 재킷 아래의 내부 금속의 주위에. 이 설정은 15 ~ 50 ° C 사이의 커버 슬립 표면 (그림 2)에서 강력한 온도 제어를 달성 할 수있다. 본 연구에서는 샘플 온도는 24 ° C를 유지 하였다 다음 프로토콜은 DNA의 구조, DNA 모양의 추정, 단일 분자 실험 및 J 인자 결정을위한 단계별 절차를 제공합니다.

<table><tbody><tr><td>Small DNA FRAG Extract Kit-100PR</td><td>VWR</td><td>97060-558</td><td></td></tr><tr><td>Acrylamide 40% solution 500 ml</td><td>VWR</td><td>97064-522</td><td></td></tr><tr><td>Bis-acrylamide 2% (w/v) solution 500 ml</td><td>VWR</td><td>97063-948</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder, 100-1,000 bp</td><td>Fermentas</td><td>SM0241</td><td></td></tr><tr><td>Mini Vertical PAGE System</td><td>VWR</td><td>89032-300</td><td></td></tr><tr><td>Syringe filter 0.2 &amp;mu;m CS50</td><td>VWR</td><td>A2666</td><td></td></tr><tr><td>Trolox</td><td>Sigma-Aldrich</td><td>238813-1G</td><td>triplet state quencher</td></tr><tr><td>Protocatechuic acid (PCA)</td><td>Sigma-Aldrich</td><td>08992-50MG</td><td>oxygen scavenging system</td></tr><tr><td>Protocatechuate 3,4-Dioxygenase (PCD)</td><td>Sigma-Aldrich</td><td>P8279-25UN</td><td>oxygen scavenging system</td></tr><tr><td>mPEG-silane, MW 2,000 1 g</td><td>Laysan Bio</td><td>MPEG-SIL-2000-1g</td><td></td></tr><tr><td>Biotin-PEG-Silane, MW 3,400</td><td>Laysan Bio</td><td>Biotin-PEG-SIL-3400-1g</td><td></td></tr><tr><td>Avidin, NeutrAvidin Biotin-binding Protein</td><td>Invitrogen</td><td>A2666</td><td></td></tr><tr><td>Phusion Hot Start High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>F-540L</td><td></td></tr><tr><td>Gel/PCR DNA Fragments Extraction Kit</td><td>IBI Scientific</td><td>IB47020</td><td></td></tr><tr><td>Premium plain glass microscope slides</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>VWR micro cover glass, rectangular, no. 1</td><td>VWR</td><td>48404-456</td><td></td></tr><tr><td>Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater</td><td>Fisher Scientific</td><td></td><td>temperature control</td></tr><tr><td>Objective Cooling Collar</td><td>Bioptechs</td><td>150303</td><td>temperature control</td></tr><tr><td>KMI53 Biological Micrometer Measuring Stage</td><td>Semprex</td><td>KMI53</td><td></td></tr><tr><td>High Performance DPSS Laser 532 nm 50 mW</td><td>Edmund optics</td><td>NT66-968</td><td>Cy3 excitation</td></tr><tr><td>CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector</td><td>Coherent</td><td>1139604</td><td>Cy5 excitation</td></tr><tr><td>650 nm BrightLine Dichroic Beamsplitter</td><td>Semrock</td><td>FF650-Di01-25x36</td><td>splitting dichroic</td></tr><tr><td>LaserMUX Beam Combiner, reflects 514.5, 532, &amp;amp; 543.5 nm lasers, 25 mm</td><td>Semrock</td><td>LM01-552-25</td><td>combining dichroic</td></tr><tr><td>Brightline Fluorescence Filter 593/40</td><td>Semrock</td><td>FF01-593/40-25</td><td>Cy3 emission filter</td></tr><tr><td>635 nm EdgeBasic LWP longpass Filter, 25 mm</td><td>Semrock</td><td>BLP01-635R-25</td><td>Cy5 emission filter</td></tr><tr><td>EMCCD iXon+</td><td>Andor Technology</td><td>DU-897E-CS0-#BV</td><td></td></tr><tr><td>IX51 inverted microscope frame</td><td>Olympus</td><td></td><td></td></tr><tr><td>Objective UApo N 100X/1.49 Oil TIRF</td><td>Olympus</td><td></td><td></td></tr><tr><td>Immersion oil type-F for fluorescence microscopy</td><td>Olympus</td><td>IMMOIL-F30CC</td><td></td></tr><tr><td>2 mm Diameter 45&amp;deg; Rod Lens Aluminum Coated&amp;nbsp;</td><td>Edmund optics</td><td>54-092</td><td>miniature mirror</td></tr><tr><td>1/4&quot; Travel Single-Axis Translation Stage</td><td>Thorlabs</td><td>MS-1</td><td>translation of miniature mirror</td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td><td>Thorlabs</td><td>AC254-200-A</td><td>focusing lens</td></tr><tr><td>Adjustable Mechanical Slit</td><td>Thorlabs</td><td>VA100</td><td></td></tr><tr><td>Dielectric Mirror</td><td>Thorlabs</td><td>BB1-E02</td><td></td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, f = 100 mm</td><td>Thorlabs</td><td>AC254-100-A</td><td>relay lens</td></tr><tr><td>Lens Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>LMR1</td><td></td></tr><tr><td>Dichroic Filter Mount</td><td>Thorlabs</td><td>FFM1</td><td></td></tr><tr><td>Fixed Cage Cube Platform</td><td>Thorlabs</td><td>B3C</td><td></td></tr><tr><td>Kinematic Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>KM100</td><td></td></tr><tr><td>N-BK7 Plano-Convex Lens, &amp;Oslash;1&quot;, f = 40 mm</td><td>Thorlabs</td><td>LA1422-A</td><td>collimating lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 15 mm</td><td>Thorlabs</td><td>LA1222-A</td><td>telescope lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 150 mm</td><td>Thorlabs</td><td>LA1433-A</td><td>telescope lens</td></tr></tbody></table>

studying dna looping by single-molecule fret

이중 가닥 DNA (dsDNA)의 굽힘은 DNA와 단백질의 인식과 뉴 클레오에 DNA 포장과 같은 많은 중요한 생물 학적 과정과 연관되어 있습니다. dsDNA 굽힘의 열역학은 공유 dsDNA의 짧은 끈적 끝을 가입 DNA 리가 아제에 의존하는 방법이라는 고리 화 반응에 의해 연구되고있다. 그러나, 결찰 효율 등의 DNA 결합 끈적 단부를 둘러싸는 구조, 및 연결 효소로 반복 dsDNA 관련되지 않은 많은 요인에 의해 영향을받을 수있다 또한 비특이적 결합과 같은 메커니즘을 통해 명백 반복 레이트에 영향을 미칠 수있다. 여기, 우리는 FRET (형광 공명 에너지 이동)에 의하여 과도 DNA 루프 형성을 감지하여 리가없는 dsDNA의 반복 반응 속도를 측정하는 방법을 보여줍니다. dsDNA 분자 FRET 쌍과 비오틴 링커 간단한 PCR 기반 프로토콜을 사용하여 구성됩니다. J 인자로 알려진 루핑 확률 밀도 두 disconnec 사이 반복 속도와 어닐 레이트로부터 추출테드 스티커 끝. 다른 고유 곡률 두 dsDNAs을 테스트함으로써, 우리는 J 계수가 dsDNA의 고유 형상에 민감하다는 것을 보여줍니다.

반복 연구에 사용되는 DNA 분자는 변수 순서와 길이와 서로 보완적인 단일 가닥 오버행의 이중 지역으로 구성되어 있습니다. 7 -베이스 긴 오버행은, 루프 형의 상태를 캡처하기 위해 서로에 어닐링 할 수있다. 각 오버행 아미 다이 화학을 통해 DNA 백본에 연결되어를 Cy3 또는 Cy5에 하나가 포함되어 있습니다. Cy5에 오버행은 표면 고정화 (그림 4A 참조) 비오틴 - TEG (15 원자 테트라 에틸렌 글리콜 스페이서)와 연결되어있다. 이러한 모든 수정은 PCR-기반 프로토콜 (프로토콜 1 및도 3b) 다음 dsDNA에 혼입 될 수있다. 오버행의 선택의 길이와 순서는 일반 실험 조건에서 검출 뒤집을 FRET 이벤트를 생산하기 위해 잘 작동합니다. 루핑 및 DNA 루프 unlooping 속도론은 주위 온도에 민감하기 때문에, 온도 제어기는 재현성이 필수적이다. 이러한 관제사뮬러 용이 현미경 (도 2)에 혼입 될 수있다. TIRFM을 사용하여 Cy3에 (기증자)와 Cy5의 표면 고정화 dsDNA 분자에서 (수용체) 신호를 관찰되었다 (그림 4B)의 변동을 방지 상관 관계. 루프 상태에서,이 색소 사이의 거리가 높아 FRET 효율 (도 4a 및도 4c)에 Cy5에 하이 신호 및 로우 신호를 Cy3 초래하는, 5 ㎚보다 작다. 몇개의 제어 실험은 높은 FRET 상태가 루프 상태를 나타낸다는 것을 증명하기 위해 수행되었다. 높은 FRET 상태의 수명은 높은 FRET 상태가 두 개의 돌출부 사이의 염기쌍에 의해 안정화되고 있음을 시사하는, 증가 오버행의 길이가 증가했다. FRET 높은 상태의 수명은 또한 루프로서 루프 자유 에너지 증가가 12 작아지기 때문에 예상되는 DNA의 길이를 감소하는 감소 하였다. 이 증거, 높고 낮은 FRET 역에 따라TES는 각각 루프와 unlooped 상태에 할당 할 수 있습니다. 루프에 dsDNA의 고유 곡률의 효과를 테스트하기 위해, 곡률이 다른 두 개의 186 염기쌍의 dsDNAs은 &#39;직선&#39;(S-DNA)라는 이름하는, 구성하고, 자신의 곡률에 따라 &#39;곡선&#39;(C-DNA). 반복 10 메르 시퀀스는 S-DNA의 C-DNA와 TGACAGCAAC에 대한 TTTATCATCC입니다. 이러한 dsDNAs 각각의 전체적인 곡률 PAGE dsDNA 곡률 16,22을 추정하기 위해 가장 널리 사용되는 방법이다 (폴리 아크릴 아미드 겔 전기 영동)에 의해 확인되었다.도 5 S-DNA가 동일한 크기의 DNA와 마찬가지로 실행되는지 보여준다 DNA의 사다리 (레인 1과 그림 5 레인 2를 비교). 한편, C-DNA는 DNA 사다리의 대응 부분에 비하여 큰 겉보기 크기를 나타낸다 (~ 그것의 실제 크기보다 큰 1.2, 레인 1과 레인 3). 이러한 관찰은 C-DNA가 더 큰 본질적인 CU를 가지고 있다는 의미S-DNA보다 rvature. 그림 6은 C-DNA (그림 6A)와 해당 FRET 추적 (그림 6B)의 대표 형광 시간의 흔적을 보여줍니다. S-DNA (도 4B 및 4C)에 비해 C-DNA는 동일한 시간의 기간 동안 더 높은 FRET 이벤트를 생성한다; C-DNA는 동일한 획득 시간 동안 S-DNA (도 12)보다 더 자주 4 회 반복. 이 결과는 DNA의 고유 곡률이 크게 역학을 루프에 영향을 줄 수 있음을 보여줍니다. 반복 속도에서 J 요소를 추출하려면, 하나는 두 개의 연결이 끊긴 오버행 사이의 하이브리드의 농도에 관계없이 2 차 속도 상수를 측정 할 필요가있다. 이러한 측정의 실현은도 8a에 표시됩니다. 고정 된 Cy5에 올리고에 Cy3에 올리고 하이브리드는 FRET에 의한 Cy5에 강도 버스트를 생성합니다. 여러 개의 MEA에서다른를 Cy3-올리고 농도 숏 (그림 (b) 참조), 하나는 통계적으로 강력한 방법으로 추출 할 수 있습니다. 우리의 실험에서는, 500 mM의 염화나트륨의 두 올리고 사이 어닐링 속도 상수는 0.45 ± 0.04 × 106 M -1 초 -1로 측정되었다. J 인자는 2 차 어닐링 속도 상수 (k &#39;어닐링)에 의해 반복 레이트 (k 루프)을 나누어 계산 하였다. 그것은 C-DNA의 S-DNA 및 265 ± 48 nm의 61 ± 3 nm였다. S-DNA (그림 9)의 J 계수는 비슷한 길이 7에서 이전의 측정과 공정 일치한다. <img alt="그림 1" src="/files/ftp_upload/51667/51667fig1highres.jpg" /> 그림 1. 목표 유형 TIRFM.) 흥분 광학. 532 nm의 640 nm의 레이저는 simil 별도로 평행된다아칸소의 직경은, 다이크로 익 미러에 의해 동일한 경로에 병합, 대물 다시 구멍 아래에 배치 된 작은 타원형 거울에 초점을 맞추었다. 그것은 색수차. B) 광학 현미경을 최소화 포커싱 무채색 렌즈를 사용하는 것이 중요하다. 소형 미러의 횡 방향 위치는 최소 형광 방출을 차단하면서 대물 통해 레이저 빔을 반사 할 수 있도록 미세하게 조정할 수있다. 따라서, 작은 이동 스테이지 상에 장착되어야한다. 반대측의 다른 거울 검출 광학계에 들어가는 것을 방지하기위한 출사 레이저를 반영한​​다. 현미경 체외 화상면에서, 조정 가능한 슬릿은 CCD의 검출 영역의 절반의 크기로 이미지를 잘라내 배치된다. 형광 방출은 두 개의 채널로 다이크로 익 미러에 의해 분할하고, 중계 렌즈는 1:1의 배율과 CCD에 제 화상을 형성한다. 반사 거울 중 하나는 약간 기증자를 상쇄하기 위해 회전및 수용체 이미지. 밴드 패스와 롱 패스 필터는 각각 기증자와 수용체 채널에서 배경을 줄이기 위해 사용됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig1highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/51667/51667fig2highres.jpg" /> 단일 분자 실험 그림 2. 온도 제어 할 수 있습니다. 설정 온도 (T s)가 물 냉각 / 히터에서 읽고 있습니다. 실제 온도 (T A는) 현미경 커버 슬립의 상면과 접촉 열전대에 의해 측정된다. 실제 온도 대 여섯 가지 설정 온도 (검은 색 사각형)의 줄거리는 우수한 선형성 (녹색 점선)를 보여줍니다. 컨트롤러의 견고성은 나중에 배 (레드 다이아몬드)에서 만든 임의의 측정에 의해 표시됩니다. 삽입 된 페이지는 온도 공동의 사진입니다최종 어셈블리 장치와 목적을 ntrolling. 빨간색 선은 화합의 기울기를 나타냅니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig2highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/51667/51667fig3highres.jpg" /> 그림 3. DNA 디자인.) dsDNA를 곡선. 10 메르 dsDNA는 곡선 튜브 세그먼트 및 점선으로 두 개의 단일 가닥으로 표시됩니다. 모든 10 메르 DNA의 나선 축이 바로 완벽하지 않고, 따라서 이러한 10 - 메르의 각 연결은 같은 방향으로 나선형 축 증가 기울기로 이어질 것입니다. 이 효과는 평면, superhelical 분자. B) dsDNA의 PCR 기반의 준비를 생성하는 데 이용 될 수있다. 단일 가닥 DNA를 수평 라인으로 표시됩니다. 실제 곡률이 여기에 묘사되지 않는다. 블랙의 중심 세그먼트 나타내는<html> DNA 단편의 유일한 부분입니다. 본 연구에 사용 된 모든 DNA를 공통 어댑터 서열 밝은 회색에 도시. 표리 어​​댑터 프라이머 1 및 4 어닐링였다. 프라이머 (2) 5&#39;-말단에 Cy3에가 표시되어 있습니다. 프라이머 3은 5&#39;-말단에 비오틴 태그와 내부적으로 연결 Cy5에 있습니다. 프라이머 2와 3의 밝은 파란색 영역은 스티커 끝을 기능을 보완 시퀀스가​​ 포함되어 있습니다. 그 서열을 포함하는 플라스미드 또는 게놈 DNA 중 하나는 두 개의 별도의 PCR 반응에서 주형으로 사용된다. Cy3가 표지 된 dsDNA는 프라이머 1와 2를 사용하여 제조되고, Cy5에 비오틴 - 표지 된 DNA는 프라이머 3 및 4를 사용하여 제조된다. PCR이 두 제품은 가열 및 스트랜드 교환을 함께 냉각시켰다. 네 가지 dsDNAs은 Cy3에, Cy5에, 그리고 비오틴을 포함 하나만으로 형성되어있다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig3highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> 항상 &quot;&gt; <img alt="그림 4" src="/files/ftp_upload/51667/51667fig4highres.jpg" /> 그림 4. 실험 계획.) 단일 분자 FRET 실험. 다른 한 측면과 Cy5에 (빨간색)를 Cy3 (녹색)으로 표시 dsDNA 분자는 PEG (폴리에틸렌 글리콜) 코팅 표면에 고정되어있다. dsDNAs의 뒤집을 수있는 루프와 unlooping 높은 FRET (루프)와 낮은 FRET (unlooped) 상태였다. B) 기증자 (녹색의 전형적인 단일 분자 시간 추적)와 수용체 (적색) 형광 강도를 초래한다. 높고 낮은 FRET 상태는 각각 루프와 unlooped 상태로 식별됩니다. 또한 루프 속도를 계산하는 데 사용되는 제 반복 시간이다 나타냈다. (삽입) 줌 - 인 그림. C) 기증자와 수용체의 강도 계산 FRET 효율의 시간 추적 B에 트레이스를 Cy3와 Cy5에 강도의 항 상관 관계를 보여줍니다. 그림 (b)와 <s<html> 본문에 설명 된대로 trong&gt; 4C는 직선 DNA (S-DNA)에서 촬영했다. 0.2의 낮은 FRET는 532 nm의 레이저로 Cy5에 직접 여기에 기인하고, 형광 활성 Cy5에의 존재를 확인합니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig4highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/51667/51667fig5highres.jpg" /> 그림 5. 폴리 아크릴 아미드 겔 전기 영동 (29.2:0.8 아크릴 아미드 / 비스 - 아크릴 아미드, TBE 버퍼, 산도 8.0의 5 %) 합성 DNA를. 왼쪽에서 오른쪽으로, 차선 1 킬로바이트 마커, 186 bp의 스트레이트 DNA와 186 BP를 포함 곡선 DNA. 이 수치는 부분적으로 권한이 이전 출판 (12)로부터 구성된다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig5highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> &quot;FO : 유지 - together.within 페이지 =&quot;_content 항상 &quot;&gt; <img alt="그림 6" src="/files/ftp_upload/51667/51667fig6highres.jpg" /> 그림 6. 곡선 DNA (C-DNA) (A) 및 해당 FRET 추적 (B) 대표 흔적. 강도의 비교 및 S-DNA (그림 4B 및 4C) 및 C-DNA (그림 6A 사이에 흔적을 FRET 및 6B) 깨끗이 만곡 DNA가 더 자주 동일한 완충액 조건에서 직선 DNA보다 루프 것을 보여준다. (삽입)는 줌 - 인 그림를 Cy3와 Cy5에 강도의 항 상관 관계를 보여줍니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig6highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 7" src="/files/ftp_upload/51667/51667fig7highres.jpg" /> 그림 7. 직선과 곡선의 DNA의 평균 첫 번째 루프의 시간. 각 tIME는 5 가지 분야에서 ~ 500 분자로부터 추출 하였다. 오차 막대가 3 독립적 인 실험에서 계산 된 평균 (SEM)의 표준 오차를 표현하는 것은. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig7highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 8" src="/files/ftp_upload/51667/51667fig8highres.jpg" /> 그림 8. 올리고 하이브리드의 어닐링 속도 상수를 결정. 어닐링 속도 측정 A) 개략도. Cy5에 프라이머 표면에 고정화하고, Cy3에 프라이머 50-180 ㎚에서 존재한다. 50 nm에서 바인딩 및 Cy3에 프라이머의 바인딩을 해제하면 가역적으로 발생하고 어닐링 속도가 무료로 올리고의 농도에 선형 적으로 의존 삽입. B)에 도시 감지 수용체의 파열을 초래할. 라인의 기울기는 2 차 어닐링 속도 상수 (k &#39;를 의미 annea<html> L). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig8highres.jpg" target="_blank">더 큰 이미지를 보려면 여기를 클릭하십시오.</a> <img alt="그림 9" src="/files/ftp_upload/51667/51667fig9highres.jpg" /> 그림 9 nm의에서 계산 된 직선과 곡선의 DNA의 J 요인이 J 인자가 두 measurables에 따라 결정 하였다... dsDNA 루프와 무료 보완 오버행의 어닐링 속도 상수의 반복 속도 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51667/51667fig9highres.jpg" target="_blank">큰 이미지를 보려면 여기를 클릭하십시오 .</a> <table border="0" cellpadding="0" cellspacing="0" width="594"><tbody><tr height="50"><td height="50" style="height:50px;width:351px;"> 구성 요소 </td><td style="width:123px;"> Volume/50 μL 반응 </td><td style="width:121px;"> 최종 농도 </td></tr><tr height="25">여덟 : 25px; 폭 : 351px; &quot;&gt; 물 </td><td style="width:123px;"> 36 μL </td><td style="width:121px;"></td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> 5 배 phusion 버퍼 </td><td style="width:123px;"> 10 μL </td><td style="width:121px;"> 1X </td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> 10 밀리미터의 dNTPs </td><td style="width:123px;"> 1 μL </td><td style="width:121px;"> 200 μM 각 </td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> 앞으로 프라이머 (25 μM) </td><td style="width:123px;"> 1 μL </td><td style="width:121px;"> 0.5 μM </td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> 역방향 프라이머 (25 μM) </td><td style="width:123px;"> 1 μL </td><td style="width:121px;"> 0.5 μM </td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> Phusion 뜨거운 시작의 DNA 중합 효소 (2<html> U / μL) </td><td style="width:123px;"> 0.5 ㎕의 </td><td style="width:121px;"> 0.02 U / μL </td></tr><tr height="25"><td height="25" style="height:25px;width:351px;"> 템플릿 DNA </td><td style="width:123px;"> 0.5 ㎕의 </td><td style="width:121px;"> 1 ~ 겨 </td></tr></tbody></table> 표 1. PCR 반응 혼합물. 프로토콜 Phusion DNA 중합 효소에 대해 최적화된다. 항목이 순서로 추가해야합니다. <table border="0" cellpadding="0" cellspacing="0" width="525"><colgroup><col /><col /><col /><col /></colgroup><tbody><tr height="25"><td height="25" style="height:25px;width:159px;"> 사이클 단계 </td><td style="width:123px;"> 온도 </td><td style="width:91px;"> 시간 </td><td style="width:153px;"> 사이클의 수 </td></tr><tr height="28"><td height="28" style="height:28px;width:159px;"> 초기 변성 </td>&quot;&gt; 95 ° C </td><td style="width:91px;"> 30 초 </td><td style="width:153px;"> 1 </td></tr><tr height="28"><td height="28" style="height:28px;width:159px;"> 변성 </td><td style="width:123px;"> 95 ° C </td><td style="width:91px;"> 5 초 </td><td rowspan="3" style="width:153px;"> (30) </td></tr><tr height="28"><td height="28" style="height:28px;width:159px;"> 가열 냉각 </td><td style="width:123px;"> 60 ° C </td><td style="width:91px;"> 10 초 </td></tr><tr height="28"><td height="28" style="height:28px;width:159px;"> 신장 </td><td style="width:123px;"> 72 ° C </td><td style="width:91px;"> 15 초 / KB </td></tr><tr height="28"><td height="56" rowspan="2" style="height:56px;width:159px;"> 최종 연장 </td><td style="width:123px;"> 72 ° C </td><td style="width:91px;"> 5 분 </td><td rowspan="2" style="width:153px;"> 1 </td></tr><tr height="28"><td height="28" style="height:28px;width:123px;"> 4 &amp; #176; C </td><td style="width:91px;"> 보유 </td></tr></tbody></table> 표 2. PCR 사이클링 지침. 어닐링 온도는 프라이머의 녹는 점에 기초하여 결정된다. 연장 시간은 Phusion DNA 중합 효소에 최적화되어 있습니다.

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

이 연구 결과는 단일 분자 형광 공명 에너지 전달 (FRET)를 사용하여 이중 가닥 DNA의 반복 역학을 측정하는 상세한 실험 절차를 제공합니다. 이 프로토콜은 또한 J 인자라는 반복 확률 밀도를 추출하는 방법에 대해 설명합니다.

단일 분자 FRET에 의해 DNA 루핑을 공부

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Universidad San Sebastian

Research

JoVE Journal

Biology

15.3K 조회수.  Georgia Institute of Technology.  이 연구 결과는 단일 분자 형광 공명 에너지 전달 (FRET)를 사용하여 이중 가닥 DNA의 반복 역학을 측정하는 상세한 실험 절차를 제공합니다. 이 프로토콜은 또한 J 인자라는 반복 확률 밀도를 추출하는 방법에 대해 설명합니다. 

비디오: Studying DNA Looping by Single-Molecule FRET

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, glass coverslips are functionalized in a one-step reaction with silane-PEG-biotin. Flow cells are constructed by sandwiching an adhesive tape with pre-cut channels between a functionalized coverslip and a PDMS slab containing inlet and outlet holes. Multiple channels are integrated into one flow cell and the flow of reagents into each channel can be fully automated, which significantly increases the assay throughput and reduces hands-on time per assay. Inside each channel, biotin-&#955;-DNAs are immobilized on the surface and a laminar flow is applied to flow-stretch the DNAs. The DNA molecules are stretched to &#62;80% of their contour length and serve as spatially extended templates for studying the binding and transport activity of fluorescently labeled molecules. The trajectories of single molecules are tracked by time-lapse Total Internal Reflection Fluorescence (TIRF) imaging. Raw images are analyzed using streamlined custom single particle tracking software to automatically identify trajectories of single molecules diffusing along DNA and estimate their 1D diffusion constants.

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

간단 하 고 강력한, 높은 처리량 단일 분자 DNA에 따라 분자의 수송을 공부에 대 한 스트레칭 분석 결과 구현 흐름

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, ...

연구

생화학

Probing The Structure And Dynamics Of Nucleosomes Using Atomic Force Microscopy Imaging

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription to take place in eukaryotic cells. The dynamics of nucleosomes provides access to the DNA by replication and transcription machineries, and critically contributes to the molecular mechanisms underlying chromatin functions. Single-molecule studies such as atomic force microscopy (AFM) imaging have contributed significantly to our current understanding of the role of nucleosome structure and dynamics. The current protocol describes the steps enabling high-resolution AFM imaging techniques to study the structural and dynamic properties of nucleosomes. The protocol is illustrated by AFM data obtained for the centromere nucleosomes in which H3 histone is replaced with its counterpart centromere protein A (CENP-A). The protocol starts with the assembly of mono-nucleosomes using a continuous dilution method. The preparation of the mica substrate functionalized with aminopropyl silatrane (APS-mica) that is used for the nucleosome imaging is critical for the AFM visualization of nucleosomes described and the procedure to prepare the substrate is provided. Nucleosomes deposited on the APS-mica surface are first imaged using static AFM, which captures a snapshot of the nucleosome population. From analyses of these images, such parameters as the size of DNA wrapped around the nucleosomes can be measured and this process is also detailed. The time-lapse AFM imaging procedure in the liquid is described for the high-speed time-lapse AFM that can capture several frames of nucleosome dynamics per second. Finally, the analysis of nucleosome dynamics enabling the quantitative characterization of the dynamic processes is described and illustrated.

Here, we present a protocol to characterize nucleosome particles at the single-molecule level using static and time-lapse atomic force microscopy (AFM) imaging techniques. The surface functionalization method described allows for the capture of the structure and dynamics of nucleosomes in high-resolution at the nanoscale.

구조와 원자 힘 현미경 이미징 사용 하 여 Nucleosomes의 역학 조사

Chromatin, which is a long chain of nucleosome subunits, is a dynamic system that allows for such critical processes as DNA replication and transcription ...

Magnetic Tweezers for the Measurement of Twist and Torque

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques include so-called force spectroscopy approaches such as atomic force microscopy, optical tweezers, flow stretching, and magnetic tweezers. Amongst these approaches, magnetic tweezers have distinguished themselves by their ability to apply torque while maintaining a constant stretching force. Here, it is illustrated how such a &#8220;conventional&#8221; magnetic tweezers experimental configuration can, through a straightforward modification of its field configuration to minimize the magnitude of the transverse field, be adapted to measure the degree of twist in a biological molecule. The resulting configuration is termed the freely-orbiting magnetic tweezers. Additionally, it is shown how further modification of the field configuration can yield a transverse field with a magnitude intermediate between that of the &#8220;conventional&#8221; magnetic tweezers and the freely-orbiting magnetic tweezers, which makes it possible to directly measure the torque stored in a biological molecule. This configuration is termed the magnetic torque tweezers. The accompanying video explains in detail how the conversion of conventional magnetic tweezers into freely-orbiting magnetic tweezers and magnetic torque tweezers can be accomplished, and demonstrates the use of these techniques. These adaptations maintain all the strengths of conventional magnetic tweezers while greatly expanding the versatility of this powerful instrument.

Magnetic tweezers, a powerful single-molecule manipulation technique, can be adapted for the direct measurements of the twist (using a configuration called freely-orbiting magnetic tweezers) and torque (using a configuration termed magnetic torque tweezers) in biological macromolecules. Guidelines for performing such measurements are given, including applications to the study of DNA and associated nucleo-protein filaments.

트위스트와 토크의 측정을위한 자석 집게

Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques ...

생체공학

Nanomanipulation of Single RNA Molecules by Optical Tweezers

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed.

Optical tweezers have been used to study RNA folding by stretching individual molecules from their 5&#8217; and 3&#8217; ends. Here common procedures are described to synthesize RNA molecules for tweezing, calibration of the instrument, and methods to manipulate single molecules.

광 핀셋으로 단일 RNA 분자의 Nanomanipulation

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be ...

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

단일 뉴클레오티드 해상도로 리보솜 전좌의 메커니즘을 연구하는 이중 DNA 통치자

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

R-Loop Analysis by Dot-Blot

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the by-products of transcription; but recent findings of fewer R-loops in diseased cells made it clear that R-loops have functional roles in a variety of human cells. Next, it is critical to understand the roles of R-loops and how cells balance their abundance. A challenge in the field is the quantitation of R-loops since much of the work relies on the S9.6 monoclonal antibody whose specificity for RNA-DNA hybrids has been questioned. Here, we use dot-blots with the S9.6 antibody to quantify R-loops and show the sensitivity and specificity of this assay with RNase H, RNase T1, and RNase III that cleave RNA-DNA hybrids, single-stranded RNA, and double-stranded RNA, respectively. This method is highly reproducible, uses general laboratory equipment and reagents, and provides results within two days. This assay can be used in research and clinical settings to quantify R-loops and assess the effect of mutations in genes such as senataxin on R-loop abundance.

This protocol details a simple method that quantifies R-loop, a three-stranded nucleic acid structure that comprises of an RNA-DNA hybrid and a displaced DNA strand.

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the ...

유전학

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

번역 조절에서 RNA 단백질 상호 작용을 연구하는 광학 핀셋

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

DNA에 조립되는 EWS-FLI1 응축수의 단일 분자 이미징

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

<meta charset="utf8"></head><body>단일 분자 연구를 위한 현장 뉴클레오솜 재구성

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>저자 스포트라이트: Efficient Nucleosome Reconstitution for Single-Molecule Techniques

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

단일 분자 FRET에 의해 DNA 루핑을 공부

요약

더 많은 비디오 탐색

이 비디오의 챕터

간단 하 고 강력한, 높은 처리량 단일 분자 DNA에 따라 분자의 수송을 공부에 대 한 스트레칭 분석 결과 구현 흐름

구조와 원자 힘 현미경 이미징 사용 하 여 Nucleosomes의 역학 조사

트위스트와 토크의 측정을위한 자석 집게

광 핀셋으로 단일 RNA 분자의 Nanomanipulation

단일 뉴클레오티드 해상도로 리보솜 전좌의 메커니즘을 연구하는 이중 DNA 통치자

R-Loop Analysis by Dot-Blot

번역 조절에서 RNA 단백질 상호 작용을 연구하는 광학 핀셋

DNA에 조립되는 EWS-FLI1 응축수의 단일 분자 이미징

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy