Name: using synthetic biology to engineer living cells that interface with programmable materials
Uploaded: 2017-03-09T15:00:00.000+00:00
Duration: 10 min 28 s
Description: Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Gli autori ringraziano il sostegno di premio FA9550-13-1-0108 dall&#39;Ufficio Air Force di ricerca scientifica degli Stati Uniti. Gli autori inoltre riconoscono il sostegno di premio N00014-15-1-2502 dal Office of Naval Research degli Stati Uniti, il finanziamento dell&#39;Istituto per Critical Tecnologia e Scienza Applicata presso Virginia Polytechnic Institute e State University, e dal National Science Foundation Graduate Research Fellowship Program, il numero di riconoscimento 1.607.310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Gli autori non hanno nulla da rivelare.

Abbiamo presentato una nuova strategia per l&#39;interfacciamento cellule ingegnerizzate vive con una superficie del materiale funzionalizzato. Ciò è stato realizzato attraverso lo sviluppo di una linea cellulare in grado di sintetizzare livelli elevati di biotina quando indotta con IPTG. Gli elevati livelli di biotina possono poi essere utilizzati per modificare la superficie funzionalizzata. I protocolli dettagliati come ingegnere alla linea di cellule di E. coli e come creare due superfici funzionalizzate differenti. Passaggi critici in questo protocollo si presentano durante la costruzione della linea cellulare ingegnerizzata. Per evitare problemi a valle, che caratterizzano i ceppi cellulari ingegnerizzate con entrambe le curve di crescita (figura 2) e di risposta fluorescente (Figura 3) è incoraggiata. Dovrebbero sorgere questioni procedurali, altre strategie di clonazione molecolare, come l&#39;estrazione PCR e Gibson assemblaggio 14, possono essere sostituiti per i passi, se del caso. Per ottimizzare il Yie biotinald della linea cellulare ingegnerizzata, è fondamentale per garantire che una quantità sufficiente di DTB viene fornito alle cellule. Nei nostri studi, abbiamo scoperto che 200 ng / mL DTB suscitato un sostanziale e statisticamente significativo aumento della produzione di biotina quando le cellule sono state indotte con IPTG. Inoltre, il successo coniugazione di BSA-biotina, SA-HRP, e biotina-HRP è di fondamentale importanza per l&#39;esecuzione e il monitoraggio dei sistemi di controllo indiretti e diretti in modo efficace. Fare attenzione per evitare l&#39;esposizione inutile alla luce e consentire ai coniugati di incubare una notte a 4 ° C al fine di garantire un efficace coniugato è formato. Il nostro protocollo offre vantaggi rispetto ai metodi alternativi 15 grazie alla sua capacità di rilevare piccole quantità di biotina che sono biologicamente rilevanti (pg scala / mL) rispetto al kit di rilevazione biotina disponibili in commercio, come quelli a base di acido 4&#39;-hydroxyazobenzene-2-carbossilico strategie di legame competitivo. Sebbene l&#39;utilizzo della streptavidina-bioSistema di stagno è comune nel settore delle biotecnologie 16, 17, la capacità del nostro sistema di rispondere a piccole quantità di biotina ci permette di collegare direttamente la nostra linea di cellule geneticamente modificato con la superficie funzionalizzata. Una potenziale limitazione del nostro protocollo è la gamma dinamica risultante di rilevamento biotina. Negli schemi di controllo indiretti e diretti, siamo in grado di rilevare la biotina tra i 10 -10 2 3 4 e 10 -10 6 pg / mL, rispettivamente (Figura 4). Fortunatamente, la gamma bassa dello schema di controllo indiretto permette di rilevare facilmente la produzione di biotina da cellule ingegnerizzate. Tuttavia, la stretta fascia della gamma dinamica controllo indiretto limita la sua capacità di percepire grandi variazioni (100 volte) in concentrazioni di biotina. Alterare la gamma dinamica per entrambi gli schemi di controllo diretti e indiretti richiederebbe engineering addizionale. Tuttavia, se il rilevamento di cellule produconod biotina è un problema, preparare diluizioni del surnatante biotina al punto 4.6 dovrebbe consentire al ricercatore di indirizzare la gamma dinamica del sistema di controllo indiretto (Figura 5). Abbiamo scoperto che una diluizione 1: 5 del surnatante ci ha permesso di raggiungere in modo efficace la gamma dinamica del sistema di controllo indiretto. Questa strategia diluizione deve alleviare la necessità di modificare direttamente la gamma dinamica. Le due parti, sistema cellulare materiale qui presentato permette ingegnerizzato cellule di modificare la composizione di una superficie funzionalizzata. , le cellule viventi dinamici in grado di interpretare l&#39;ambiente circostante chimici per produrre una risposta genetica. Mediante ingegneria genetica questa risposta per aumentare la produzione di biotina, possiamo dotare cellule viventi ingegnerizzate con la capacità di controllare e manipolare una superficie funzionalizzata. Seguendo i protocolli presentati, cellule ingegnerizzate sono in grado di agire sensori dinamici, capaci di lettura, elaborazione e registrazione delle condizioni intorno them tramite interfacce funzionalizzate. Questa tecnologia potrebbe avere un impatto campi che vanno dalla medicina molecolare per il rilevamento analiti per la bonifica ambientale.

Qui, si riportano le procedure per sviluppare un substrato programmabile capace di rispondere ad un segnale chimico da una linea cellulare ingegnerizzata. 1 Facciamo questo con la creazione di una interfaccia biotina-streptavidina che risponde alla biotina prodotta da coli sinteticamente ingegnerizzato Escherichia (E. coli) cellule. In precedenza, le superfici programmabili sono stati progettati per una vasta gamma di applicazioni, dalla rilevazione della tossina 2 e point-of-care diagnosi 3 di difesa e sicurezza. 4 Mentre superfici programmabili possono essere utili come sensori e attuatori, possono essere fatti &quot;intelligenti&quot; di dotandoli la capacità di adattarsi a differenti sfide ambientali. Al contrario, anche microrganismi semplici, come E. coli, hanno adattabilità intrinseca e sono in grado di rispondere alle sfide con soluzioni sofisticate e spesso inaspettati. Questa capacità di adattamento ha permesso E.popolazioni coli, controllate dai loro reti geniche complesse, a costi contenuti cercare risorse, 5 creare prodotti a valore aggiunto, 6 e perfino la robotica micro-scala di potenza. 7 Accoppiando i vantaggi adattivi di cellule viventi con l&#39;uso di superfici programmabili, possiamo creare un substrato intelligente in grado di rispondere alle diverse condizioni ambientali. Biologia sintetica ha dato ricercatori nuove capacità di programmare il comportamento degli organismi viventi. Da Engineering cellule di contenere reti di regolazione nuovo gene, i ricercatori possono progettare le cellule che presentano una serie di comportamenti programmati. 8, 9 Al di là della ricerca di base, questi comportamenti possono essere utilizzati per applicazioni come il controllo assemblaggio materiale e biologicamente la produzione di prodotti a valore aggiunto. 10 Qui, abbiamo dettaglio come abbiamo utilizzato gli strumenti della biologia sintetica per itgineer un ceppo di E. coli che sintetizza biotina su di induzione. Questo ceppo è stato sviluppato utilizzando metodi enzima di restrizione di clonazione per assemblare un plasmide, pKE1-lacI-bioB. Questo plasmide, quando trasformato in ceppo di E. coli K-12 MG1655, conferisce cellule con la capacità di esprimere livelli elevati di bioB, un enzima essenziale per la sintesi biotina. Quando le cellule trasformate sono state indotte con isopropil β-D-1-thiogalactopyranoside (IPTG) e provvisto di un precursore biotina, desthiobiotin (DTB), sono stati prodotti livelli elevati di biotina. interazione Legame di biotina con streptavidina è uno dei più forti legami non covalenti presenti in natura. Come tale, l&#39;interazione biotina-streptavidina è sia ben caratterizzati e altamente impiegati in biotecnologia. 11 All&#39;interno di questo manoscritto, presentiamo due strategie che impiegano l&#39;interazione biotina-streptavidina per rilevare e rilevare biotina cellule-prodotto con una superficie funzionalizzata. Noifare riferimento a queste superfici contrastanti come schemi di controllo &quot;diretto&quot; &quot;indiretti&quot; e. Nello schema controllo indiretto, biotina cellule prodotte compete con biotina che è stato coniugato e immobilizzato su una superficie polistirolo da streptavidina siti di legame. Inoltre, la streptavidina è coniugato con perossidasi di rafano (HRP). HRP modifica 3, 3 &#39;, 5, 5&#39;-tetrametilbenzidina (TMB), per produrre un segnale ottico, 12 che possono essere monitorato quantificando l&#39;assorbanza spettrale (cioè, densità ottica) a 450 nm (OD 450). Così, il sistema di controllo indiretto consente ai ricercatori di misurare biotina cellule-prodotto dal monitoraggio del attentuation del segnale OD 450. Lo schema di controllo diretto sfrutta l&#39;evento streptavidina-biotina immobilizzando streptavidina direttamente ad una superficie del materiale e consentendo biotina cellule prodotte e HRP biotinilato a competere per streptavidina siti di legame. Ancora una volta, lalivelli relativi di biotina cellule prodotte sono monitorati misurando un segnale OD 450. Nel loro insieme, le cellule ingegnerizzate e le superfici funzionalizzate ci permettono di controllare le proprietà di una superficie programmabili inducendo reti nelle cellule viventi. In altre parole, abbiamo creato un sistema che sfrutta l&#39;adattabilità degli organismi viventi e l&#39;affidabilità e la specificazione di un&#39;interfaccia materiale ingegnerizzato collegando questi sistemi.

<table><tbody><tr><td>LB Broth, Miller&amp;nbsp;</td><td>Fisher Scientific</td><td>12-795-027</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP9744500</td><td></td></tr><tr><td>Carbenicillin&amp;nbsp;</td><td>Fisher Scientific</td><td>BP26481</td><td></td></tr><tr><td>M9, Minimimal Salts, 5x</td><td>Sigma-Aldrich</td><td>M6030</td><td></td></tr><tr><td>Casamino Acids&amp;nbsp;</td><td>Fisher Scientific</td><td>BP1424-100</td><td></td></tr><tr><td>Magnesium Sulfate, Anhydrous</td><td>Fisher Scientific</td><td>M65-500</td><td></td></tr><tr><td>Calcium Chloride, Dihydrate</td><td>Fisher Scientific</td><td>C79-500</td><td></td></tr><tr><td>Dextrose (D-Glucose), Anhydrous</td><td>Fisher Scientific</td><td>D16-1</td><td></td></tr><tr><td>NEB Turbo Cell Line</td><td>New England Biolabs</td><td>C2984l</td><td></td></tr><tr><td>Oligonucleotide Primers</td><td>Thermo Fisher Scientific</td><td>N/A</td><td>25N synthesis, DSL purification</td></tr><tr><td>Q5 High-Fidelity Polymerase</td><td>New England Biolabs</td><td>M0491S</td><td></td></tr><tr><td>Q5 Reaction Buffer</td><td>New England Biolabs</td><td>B9027S</td><td></td></tr><tr><td>dNTP Solution Mix</td><td>New England Biolabs</td><td>N0447S</td><td></td></tr><tr><td>Agarose</td><td>Bioexpress</td><td>E-3120-125</td><td></td></tr><tr><td>Ethidium Bromide, 1%</td><td>Fisher Scientific</td><td>BP1302-10</td><td></td></tr><tr><td>Gel Extraction Kits</td><td>Epoch Biolabs</td><td>2260250</td><td></td></tr><tr><td>GenCatch Plasmid DNA Miniprep Kit</td><td>Epoch Biolabs</td><td>2160250</td><td></td></tr><tr><td>AatII</td><td>New England Biolabs</td><td>R0117S</td><td></td></tr><tr><td>SacII</td><td>New England Biolabs</td><td>R0157S</td><td></td></tr><tr><td>HindIII-HF</td><td>New England Biolabs</td><td>R3104S</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England Biolabs</td><td>R3101S</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T4 DNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0202S</td><td></td></tr><tr><td>ColiRolle Glass Plating Beads&amp;nbsp;</td><td>EMD Millipore</td><td>7101-3</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-1</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher Scientific</td><td>BP1755-10</td><td></td></tr><tr><td>NHS-Desthiobiotin (DTB)</td><td>Thermo Fisher Scientific</td><td>16129</td><td></td></tr><tr><td>Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1534</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)&amp;nbsp;</td><td>Fisher Scientific</td><td>BP231-100</td><td></td></tr><tr><td>Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1531</td><td></td></tr><tr><td>NHS-LC-LC-biotin</td><td>Thermo Fisher Scientific</td><td>21343</td><td></td></tr><tr><td>Horseradish Peroxidase (HRP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>31490</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 10x Solution</td><td>Fisher Scientific</td><td>BP399500</td><td></td></tr><tr><td>Streptavidin (SA)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>21145</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-100</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher Scientific</td><td>BP172-5</td><td></td></tr><tr><td>Ethylenediaminetetaacetic acid (EDTA)&amp;nbsp;</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Tween 80&amp;nbsp;</td><td>Fisher Scientific</td><td>T164-500</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Fisher Scientific</td><td>H325-4</td><td></td></tr><tr><td>3, 3&#039;, 5, 5&#039;-tetramethylbenzidine (TMB)</td><td>Fisher Scientific</td><td>AC229280050</td><td></td></tr><tr><td>Vivaspin 500 Centrifugal Concentrators&amp;nbsp;</td><td>Viva Products</td><td>VS0192</td><td></td></tr><tr><td>Sodium Acetate, Anhydrous</td><td>Fisher Scientific</td><td>BP333-500</td><td></td></tr><tr><td>96-Well Polystyrene Plates</td><td>Thermo Fisher Scientific</td><td>266120</td><td></td></tr></tbody></table>

using synthetic biology to engineer living cells that interface with programmable materials

Abbiamo sviluppato un&#39;interfaccia abiotico-biotici che permette alle cellule ingegnerizzate per controllare le proprietà del materiale di una superficie funzionalizzata. Questo sistema è composto creando due moduli: un ceppo sinteticamente stratificato di cellule di E. coli e un&#39;interfaccia materiale funzionalizzato. All&#39;interno di questo documento, i dettagli di un protocollo per l&#39;ingegneria genetica comportamenti selezionati all&#39;interno di un ceppo di E. coli che utilizzano strategie di clonazione molecolare. Una volta sviluppato, questo ceppo produce livelli elevati di biotina quando esposti ad un induttore chimico. Inoltre, noi dettaglio protocolli per creare due superfici funzionalizzate differenti, ognuno dei quali è in grado di rispondere alla biotina cellule sintetizzato. Nel loro insieme, presentiamo una metodologia per la creazione di un sistema collegato, abiotici-biotici che permette progettato cellule per controllare la composizione dei materiali e il montaggio su substrati non viventi.

Risultati rappresentativi sono presentati nelle cinque figure allegate. In primo luogo, vi presentiamo il processo di clonazione verrà visualizzata graficamente (figura 1), in modo che il lettore possa seguire visivamente i passaggi critici per la creazione del sinteticamente ingegnerizzato ceppo di E. coli. Per caratterizzare la dinamica di popolazione delle cellule, forniamo una curva di crescita (figura 2) generato misurando la densità ottica a 600 nm (OD 600) della popolazione. Poi, si mostra come la rete gene regolatore è verificato, utilizzando mCherry come proxy per bioB (Figura 3), che permette di misurare otticamente la quantità relativa di bioB che sarebbe prodotta dalla cellula su induzione con IPTG. In seguito, presentiamo dati di risposta per l&#39;indiretto di controllo e le superfici funzionalizzate-controllo diretto. Questi grafici dei dati (Figura 4) sono stati sviluppati utilizzando soluzioni misurati del liberobiotina per caratterizzare i profili di risposta delle superfici funzionalizzate. Infine, presentiamo dati caratteristici che mostrano come le cellule ingegnerizzate sono indotte a produrre biotina (Figura 5), modificando così le superfici funzionalizzate. <img alt="Figura 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Figura 1: Progettazione e Costruzione di inducibili, cellule ingegnerizzate. (A) I primer sono stati progettati per isolare il gene bioB dal genoma di E. coli, che codifica un enzima cruciale nella via di sintesi biotina. (B) Il P L, teto-1 e P -lacI sequenze TRC-2 può essere isolato da un plasmide contenente un interruttore genetico con primer corrispondenti. (C) Il gene bioB estratto e due frammenti del commutatore possono essere utilizzati per creare il circuito gene. L&#39;aggiunta di IPTG possono poi indUCE l&#39;espressione di bioB e sintesi così biotina quando viene aggiunto DTB come substrato per bioB. (D) Il plasmide assemblata è stata trasformata in K-12 MG1655 E. coli. Questo ha causato la presenza di IPTG per indurre l&#39;espressione di bioB e sintesi così biotina dalla linea cellulare ingegnerizzata quando DTB è stato fornito come substrato. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="figura 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Figura 2: curve di crescita per cellule ingegnerizzate. I, inducibili MG1655 cellule wild-type ingegnerizzati sono state coltivate e monitorate nei media minima (cioè, senza biotina M9 media), così come i media minime integrato con DTB (200 ng / mL) e / o di IPTG (0,5 mm). I grafici mostrano la lettura OD 600, misurata ogni 5 mi<html> n per 24 h. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> Figura 3: Test del Gene Network Engineered. La proteina fluorescente mCherry stato utilizzato al posto del bioB gene in modo da poter otticamente misurare il profilo di induzione quando le cellule ingegnerizzate sono state indotte con IPTG. Ci confrontiamo le cellule indotte con IPTG (diamanti rossi) con le cellule non indotte con IPTG (diamanti blu). Questi risultati dimostrano l&#39;efficacia della rete gene inducibile. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> /55300/55300fig4.jpg &quot;/&gt; Figura 4: Verifica della funzionalizzato materiale di interfaccia. Esponendo nostra superficie funzionalizzata a concentrazioni variabili di biotina, siamo in grado di misurare la risposta ottica misurando OD 450 assorbanza. Questi risultati ci permettono di generare una curva di calibrazione, che collega la concentrazione di biotina all&#39;intensità ottica della risposta. Qui, vi presentiamo la biotina contro le curve dei segnali ottici per entrambi i regimi di superficie indiretta (a sinistra) e diretta (a destra) funzionalizzati. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> Figura 5: Engineered cellule di controllo di interfaccia materiale. Utilizzando sezioni di protocollo 5 o 6, siamo in grado di utilizzare i prodotti di indotto, ingegnerizzato cells di modificare chimicamente la superficie funzionalizzata. Siamo in grado di monitorare queste risposte otticamente misurando OD 450. Inoltre, utilizzando la curva di taratura sviluppata nella figura 4, possiamo collegare l&#39;intensità ottica della risposta alla biotina all&#39;interno della concentrazione. Presentiamo qui le diverse concentrazioni di biotina, misurate dal nostro schema funzionalizzata superficie di controllo indiretto, per le cellule wild-type (bianco), cellule non indotte contenenti il ​​plasmide pKE1-lacI-bioB (arancione), e le cellule indotte contenenti il ​​pKE1-lacI-bioB plasmide (grigio). <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> chimico </td><td> Concentrazione finale </td><td> Quantità </td></tr><tr><td> sali 5x M9 </td><td> 1x </td><td> 20 mL </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 mm </td><td> 200 ml </td></tr><tr><td> 1 M CaCl 2 </td><td> 0,1 mm </td><td> 10 microlitri </td></tr><tr><td> 20% di glucosio </td><td> 0,40% </td><td> 2 ml </td></tr><tr><td> L&#39;acido Casamino senza biotina 2% </td><td> 0,02% </td><td> 1 mL </td></tr><tr><td> DI acqua </td><td> N / A </td><td> 76,8 mL </td></tr></tbody></table> Tabella 1: M9 media ricetta. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td colspan="2"> Sequenza Primer </td><td> uso </td></tr><tr><td> 1-F </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> Estrazione cassetta lacI </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> Estrazione cassetta lacI </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P TRC-2 di estrazione </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P TRC-2 di estrazione </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> estrazione bioB </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> estrazione bioB </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Inoltre RBS sintetico </td></tr></tbody></table> Tabella 2: Elenco di primer. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Fase 1 </td><td> Passo 2 </td><td> fase 3 </td><td> fase 4 </td><td> fase 5 </td><td> passo 6 </td><td> passo 7 </td><td> step 8 </td><td> passo 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> Ripetere 12 volte </td><td colspan="3" rowspan="2"> Ripetere 25 volte </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / ciclo </td></tr></tbody></table>Tabella 3: programma PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> Lisato (template) </td><td> 10 microlitri </td></tr><tr><td> Primer (ciascuno) </td><td> 0,625 ml (ciascuno) </td></tr><tr><td> tampone Q5 5x </td><td> 5 ml </td></tr><tr><td> Q5 polimerasi </td><td> 0,25 ml </td></tr><tr><td> dNTP Mix </td><td> 0,5 ml </td></tr><tr><td> DI acqua </td><td> 6.75 ml </td></tr></tbody></table> Tabella 4: Tutta la cella PCR Reazione (25 mL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> 10x tampone di reazione </td><td> 5 ml </td></tr><tr><td> Enzyme 1 </td><td> 1 ml </td></tr><tr><td> Enzyme 2 </td><td> 1 ml </td></tr><tr><td> DNA template </td><td> 1 mcg </td></tr><tr><td> DI acqua </td><td> 43 ml - volume di DNA </td></tr></tbody></table> Tabella 5: enzimi di restrizione di reazione (50 mL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> DNA </td><td> 50 mcg vettore + X mcg inserto </td></tr><tr><td> 10x Ligase Buffer </td><td> 1 ml </td></tr><tr><td> T4 ligasi </td><td> 1 ml </td></tr><tr><td> DI acqua </td><td> 8 ml - volume di DNA </td></tr></tbody></table>Tabella 6: legatura di reazione (10 ml). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Concentrazione </td><td> Gli appunti </td></tr><tr><td> CaCl 2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / ml (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 mg / ml </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> SPDP </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> LC-LC-biotina </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> HRP </td><td> 10 mg / ml </td><td> in PBS </td></tr><tr><td> SA (indiretto) </td><td> 10 mg / ml </td><td> in PBS </td></tr><tr><td> SA (diretta) </td><td> 0,17 mg / mL </td><td> in PBS </td></tr><tr><td> BSA </td><td> 20 mg / ml </td><td> in PBS </td></tr><tr><td> digitale terrestre </td><td> 100mM </td><td> In DI Acqua </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 18,6 mg in 10 ml di PBS </td></tr><tr><td> Caseina </td><td> 0,50% </td><td> in PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> In DI Acqua </td></tr><tr><td> Tween 80 in PBS </td><td> 0,05% </td><td></td></tr><tr><td> Acetato di sodio </td><td> 50 mm </td><td> In DI Acqua, Regolare al 5,1 pH con 3 M HCl </td></tr><tr><td> TMB </td><td> 1% </td><td> In DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> In DI Acqua </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> In DI Acqua </td></tr></tbody></table>Tabella 7: Elenco dei reagenti Solutions.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Questo documento presenta una serie di protocolli per lo sviluppo di cellule ingegnerizzate e superfici funzionalizzate che consentono sinteticamente progettati E. coli di controllare e manipolare superfici materiche programmabili.

Utilizzando biologia sintetica per Ingegnere cellule viventi che si interfacciano con materiali programmabili

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University.  Questo documento presenta una serie di protocolli per lo sviluppo di cellule ingegnerizzate e superfici funzionalizzate che consentono sinteticamente progettati E. coli di controllare e manipolare superfici materiche programmabili. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Colmare il Bio-Electronic Interface con Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Ricerca

Bioingegneria

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the importance of 3-dimensional (3D) cellular assemblies in these fields. Artificial scaffolds have often been used to construct 3D cellular assemblies. However, the scaffolds used to construct cellular assemblies are sometimes toxic and may change the properties of the cells. Thus, it would be beneficial to establish a non-toxic method for facilitating cell-cell contact. In this paper, we introduce a novel method for constructing stable cellular assemblies by using optical tweezers with dextran. One of the advantages of this method is that it establishes stable cell-to-cell contact within a few minutes. This new method allows the construction of 3D cellular assemblies in a natural hydrophilic polymer and is expected to be useful for constructing next-generation 3D single-cell assemblies in the fields of regenerative medicine and tissue engineering.

We demonstrate a novel method for constructing a single-cell-based 3-dimensional (3D) assembly without an artificial scaffold.

Manipolazione delle cellule viventi per costruire assieme cellulare 3D stabile senza impalcatura artificiale

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the ...

Biochimica

Engineering Intracellular Protein Sensors in Mammalian Cells

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells to sense and respond to these biomarkers may help the understanding of molecular mechanisms underlying pathologies, as well as to develop new cell-based therapies. While several systems that detect extracellular proteins have been developed, a modular framework that can be easily re-engineered to sense different intracellular proteins was missing.
Here, we describe a protocol to implement a modular genetic platform that senses intracellular proteins and activates a specific cellular response. The device operates on intracellular antibodies or small peptides to sense with high specificity the protein of interest, triggering the transcriptional activation of output genes, through a TEV protease (TEVp)-based actuation module. TEVp is a viral protease that selectively cleaves short cognate peptides and is widely used in biotechnology and synthetic biology for its high orthogonality to the cleavage site. Specifically, we engineered devices that recognize and respond to protein-biomarkers of viral infections and genetic diseases, including mutated huntingtin, NS3 serine-protease, Tat and Nef proteins to detect Huntington&#8217;s disease, hepatitis C virus (HCV) and human immunodeficiency virus (HIV) infections, respectively. Importantly, the system can be hand tailored for the desired input-output functional outcome, such as fluorescent readouts for biosensors, stimulation of antigen presentation for immune response, or initiation of apoptosis to eliminate unhealthy cells.

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general architecture.

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells ...

Genetica

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Automatizzato robot Liquid Handling Assembly di dispositivi modulari del DNA

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

Superficie-immobilizzazione funzionale dei geni usando Multistep Strand Displacement Litografia

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

Una piattaforma microfluidica multistrato per la conduzione di un'espressione genica prolungata senza cellule

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

Preparazione di proteine che producono cellule sintetiche utilizzando estratti batterici cell free, liposomi e trasferimento di emulsione

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

Simple, Affordable, and Modular Patterning of Cells using DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells of the same or different type, micropatterning techniques have proved useful. DNA Programmed Assembly of Cells (DPAC) is a micropatterning technique that targets the adhesion of cells to a substrate or other cells using DNA hybridization. The most basic operations in DPAC begin with decorating cell membranes with lipid-modified oligonucleotides, then flowing them over a substrate that has been patterned with complementary DNA sequences. Cells adhere selectively to the substrate only where they find a complementary DNA sequence. Non-adherent cells are washed away, revealing a pattern of adherent cells. Additional operations include further rounds of cell-substrate or cell-cell adhesion, as well as transferring the patterns formed by DPAC to an embedding hydrogel for long-term culture. Previously, methods for patterning oligonucleotides on surfaces and decorating cells with DNA sequences required specialized equipment and custom DNA synthesis, respectively. We report an updated version of the protocol, utilizing an inexpensive benchtop photolithography setup and commercially available cholesterol modified oligonucleotides (CMOs) deployed using a modular format. CMO-labeled cells adhere with high efficiency to DNA-patterned substrates. This approach can be used to pattern multiple cell types at once with high precision and to create arrays of microtissues embedded within an extracellular matrix. Advantages of this method include its high resolution, ability to embed cells into a three-dimensional microenvironment without disrupting the micropattern, and flexibility in patterning any cell type.

Here we present a protocol to micropattern cells at single-cell resolution using DNA-programmed adhesion. This protocol uses a benchtop photolithography platform to create patterns of DNA oligonucleotides on a glass slide and then labels cell membranes with commercially available complementary oligonucleotides. Hybridization of the oligos results in programmed cell adhesion.

Modellazione semplice, economica e modulare delle cellule utilizzando il DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells ...

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Caratterizzazione rapida di parti genetiche con sistemi cell-free

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Protocolli per l&#39;implementazione di un<em&gt; Escherichia coli</em&gt; Sulla base TX-TL cellulare-Free Expression System per la biologia sintetica

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...