Name: using synthetic biology to engineer living cells that interface with programmable materials
Uploaded: 2017-03-09T15:00:00.000+00:00
Duration: 10 min 28 s
Description: Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

המחברים בתודה להכיר תמיכה בפרס FA9550-13-1-0108 מלשכת חיל האוויר של המחקר המדעי של ארה&quot;ב. המחברים גם מכירים תמיכה מן הפרס N00014-15-1-2502 מן משרד המחקר של הצי של ארה&quot;ב, מימון מהמכון לטכנולוגיה קריטית ומדע יישומי במכון הפוליטכני וירג&#39;יניה סטייט, ומן מחקר לתארים מתקדמים הקרן הלאומית למדע אחוות תוכנית, מספר הפרסים 1,607,310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

החוקרים אין לי מה לחשוף.

הצגנו אסטרטגיה חדשה עבור התממשקות תאים מהונדסים חיים עם משטח חומר פונקציונלי. הדבר זה הושג על ידי פיתוח קו תא מסוגל לסנתז רמות גבוהות של ביוטין כאשר מושרה עם IPTG. הרמות הגבוהות של ביוטין יכולות לשמש כדי לשנות את פני השטח הפונקציונליים. הפרוטוקולים המפורטים כיצד להנדס את שורת תאי E. coli וכיצד ליצור שני משטחים פונקציונליים שונים. צעדים קריטיים בפרוטוקול זה להתרחש לאורך כל הבנייה של הקו הסלולרי המהונדס. כדי למנוע בעיות במורד הזרם, המאפיינת את זני תאים מהונדסים עם שתי עקומות גדילה (איור 2) ותגובה ניאון (איור 3) מומלץ. האם בעיות פרוצדורליות להתעורר, אסטרטגיות שיבוט מולקולרי אחרות, כגון מיצוי PCR וגיבסון הרכבת 14, עשויות להיות תחליף צעדים במידת צורך. עבור אופטימיזציה של ביוטין Yield של הקו הסלולרי המהונדס, זה חיוני כדי להבטיח כי כמות מספקת של DTB מסופקת על התאים. במחקרים שלנו, מצאנו כי 200 ng / mL DTB שהושר גידול משמעותי סטטיסטית משמעותי בייצור ביוטין כאשר תאים היו מושרים עם IPTG. בנוסף, נטייה מוצלחת של BSA-ביוטין, SA-HRP, ו ביוטין-HRP היא חיונית לביצוע ביעילות וניטור תוכניות שליטה העקיפה וישירות. תשמור על עצמך כדי להימנע מחשיפה מיותרת לאור ולאפשר conjugates כדי לדגור לילה ב 4 ° C כדי להבטיח המצומד יעיל נוצר. הפרוטוקול שלנו מציע יתרונות על פני שיטות חלופיות 15 בשל יכולתה לזהות כמויות קטנות של ביוטין שרלוונטיים ביולוגי (בסולם pg / mL) לעומת ערכות זיהוי ביוטין זמינות מסחרי, כגון אלו המבוססים על 4&#39;-hydroxyazobenzene-2-קרבוקסיליות חומצה אסטרטגיות מחייב תחרותיות. למרות באמצעות ביו-streptavidinמערכת פח נפוצה בביוטכנולוגיה 16, 17, היכולת של המערכת שלנו להגיב כמויות קטנות של ביוטין מאפשרת לנו לקשר שורת התאים שלנו ישירות המהונדסת הגנטי עם המשטח הפונקציונלי. הגבלת פוטנציאל אחד הפרוטוקול שלנו היא הטווח דינמי כתוצאה של זיהוי ביוטין. ב תוכניות שליטה עקיפה וישירה, אנו מסוגלים לזהות ביוטין בין 10 2 -10 3 ו -10 4 -10 6 pg / mL, בהתאמה (איור 4). למרבה המזל, בטווח הנמוך של ערכת השליטה העקיפה מאפשר לנו לזהות בקלות ייצור ביוטין מתאי מהונדסים. עם זאת, הלהקה החזקה של הטווח הדינמי שליטה העקיפה מגבילה את יכולתו לחוש שינויים גדולים (פי 100) בריכוזים ביוטין. לשנות את הטווח הדינמי הוא תוכניות שליטה העקיפות וישירות ידרוש הנדסה נוספת. עם זאת, אם זיהוי של תאים לייצרד ביוטין הינה סוגיה, הכנת דילולים של supernatant ביוטין בשלב 4.6 צריך לאפשר לחוקר למקד את הטווח הדינמי של ערכת שליטה עקיפה (איור 5). מצאנו כי דילול 1: 5 של supernatant אפשר לנו למקד את הטווח הדינמי של ערכת השליטה העקיפה ביעילות. אסטרטגית דילול זה אמורה להקל על הצורך לשנות את הטווח הדינמי ישירות. מערכת הבת שני חלקים, תא-חומר המובא כאן מאפשרת מהונדסת תאים כדי לשנות את ההרכב של משטח פונקציונלי. תאים דינמיים, חיים יכולים לפרש הסביבה הכימית שלהם כדי לייצר תגובה גנטית. באמצעות הנדסה גנטית בתגובה זו כדי להגדיל את הייצור ביוטין, נוכל להעניק תאי חיים מהונדסים עם היכולת לשלוט ולתפעל משטח פונקציונלי. על ידי ביצוע הפרוטוקולים שהוצגו, תאים מהונדסים מסוגלים לפעול חיישנים דינמיים כמו, יכולת לקרוא, עיבוד, הקלטת התנאים סביב הem דרך ממשקים פונקציונליים. טכנולוגיה זו יכולה להשפיע בתחומים הנעים בין רפואה מולקולרית לגילוי אנליטי עבור תיקון הסביבה.

כאן אנו מדווחים בנהלי פיתוח מצע לתכנות מסוגל להגיב אות כימית מן קו תא מהונדס. 1 אנו עושים זאת על ידי יצירת ממשק streptavidin ביוטין שמגיב ביוטין מיוצר על ידי coli Escherichia המהונדס סינטטי (E. coli) תאים. בעבר, משטחים לתכנות כבר מהונדסים עבור מגוון רחב של יישומים מ זיהוי הרעלן 2 ונקודה של טיפול אבחון 3 עד הגנה וביטחון. 4 בעוד משטחים לתכנות יכולים להיות שימושיים כמו חיישנים ומפעיל, הם יכולים להיעשות &quot;חכמים&quot; על ידי להנחיל להם את היכולת להסתגל לאתגרים סביבתיים שונים. לעומת זאת, אפילו מיקרואורגניזמים פשוטים, כגון E. coli, יש הסתגלות טמונה ומסוגלים להגיב לאתגרים עם פתרונות מתוחכמים ולעתים קרובות בלתי צפויים. הסתגלות זו אפשרה E.אוכלוסיות coli, בשליטת רשתות גנים המורכבים שלהן, חסכונית לחפש משאבים, 5 ליצור מוצרים בעלי ערך מוסף, 6 ואפילו רובוטיקה כוח בקנה מידה מיקרו. 7 על ידי צימוד היתרונות אדפטיבית של תאי חיים עם שימוש משטחים לתכנות, נוכל ליצור מצע חכם מסוגל להגיב לתנאי סביבה שונים. ביולוגיה סינתטית נתן החוקרים יכולות חדשות כדי לתכנת את ההתנהגות של היצורים החיים. באמצעות הנדסה לתאים להכיל רשתות רגולטוריות גן חדש, חוקרים יכולים לעצב תאים כי תערוכה מגוונת של התנהגויות מתוכנות. 8, 9 מעבר מחקר בסיסי, התנהגויות אלו עשויות לשמש ליישומים כגון שליטת הרכבת חומר ביולוגי לייצר מוצרים בעלי ערך מוסף. 10 בזאת, אנו בפירוט כיצד השתמשנו בכלים של ביולוגיה סינתטית כדי engineer זן החיידק כי מסנתז ביוטין על אינדוקציה. זן זה פותח באמצעות שיטות שיבוט אנזים הגבלה להרכיב פלסמיד, pKE1-לאצי-bioB. פלסמיד זה, כאשר הפך K-12 זן E. coli MG1655, מעניק לתאים עם יכולת להביע רמות גבוהות של bioB, אנזים חיוני לסינתזת ביוטין. כאשר תאים שהשתנו היו מושרים עם איזופרופיל β-D-1-thiogalactopyranoside (IPTG) ובתנאי עם מבשר ביוטין, desthiobiotin (DTB), רמות גבוהות של ביוטין יוצרו. האינטראקציה המחייבת של ביוטין עם streptavidin היא אחת איגרות החוב הלא-קוולנטיים החזקים המצויים בטבע. ככזה, האינטראקציה streptavidin ביוטין הוא גם היטב מאופיין והעסיק מאוד בביוטכנולוגיה. 11 בתוך כתב היד הזה, אנו מציגים שתי אסטרטגיות העסקת אינטראקצית streptavidin ביוטין לחוש ולזהות ביוטין בייצור תאים עם משטח פונקציונלי. אָנוּמתייחסים משטחים מנוגדים אלה תוכניות שליטה &quot;עקיפה&quot; ו &quot;ישירה&quot;. בתכנית השליטה העקיפה, ביוטין-מיוצר תא מתחרה עם ביוטין כי כבר מצומדות ו משותק על משטח קלקר streptavidin אתרי קישור. בנוסף, streptavidin הוא מצומדות עם peroxidase חזרת (HRP). HRP משנה 3, 3 &#39;, 5, 5&#39;-tetramethylbenzidine (TMB), להפקת אותות אופטיים, 12 אשר עשוי להיות במעקב על ידי לכימות ספיגת ספקטרלי (כלומר, צפיפות אופטית) ב -450 ננומטר (OD 450). לפיכך, את ערכת השליטה העקיפה מאפשרת לחוקרים למדוד ביוטין בייצור תאים על ידי ניטור attentuation של אות OD 450. ערכת השליטה הישירה מנצלת את האירוע ביוטין-streptavidin על ידי streptavidin משתק ישירות משטח חומר ומאפשר ביוטין תא-פיק biotinylated HRP להתחרות על streptavidin אתרי קישור. שוב,רמות יחסיות של ביוטין בייצור התאים מנוטר על ידי מדידת אות OD 450. יחדיו, התאים המהונדסים משטחים פונקציונליים מאפשרים לנו לשלוט על התכונות של משטח לתכנות על ידי גרימת רשתות בתאים חיים. במילים אחרות, יצרנו מערכת שמנצלת את יכולת ההתאמה של היצורים החיים ואת אמינות מפרט של ממשק חומר מהונדס ידי קישור המערכות הללו יחד.

<table><tbody><tr><td>LB Broth, Miller&amp;nbsp;</td><td>Fisher Scientific</td><td>12-795-027</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP9744500</td><td></td></tr><tr><td>Carbenicillin&amp;nbsp;</td><td>Fisher Scientific</td><td>BP26481</td><td></td></tr><tr><td>M9, Minimimal Salts, 5x</td><td>Sigma-Aldrich</td><td>M6030</td><td></td></tr><tr><td>Casamino Acids&amp;nbsp;</td><td>Fisher Scientific</td><td>BP1424-100</td><td></td></tr><tr><td>Magnesium Sulfate, Anhydrous</td><td>Fisher Scientific</td><td>M65-500</td><td></td></tr><tr><td>Calcium Chloride, Dihydrate</td><td>Fisher Scientific</td><td>C79-500</td><td></td></tr><tr><td>Dextrose (D-Glucose), Anhydrous</td><td>Fisher Scientific</td><td>D16-1</td><td></td></tr><tr><td>NEB Turbo Cell Line</td><td>New England Biolabs</td><td>C2984l</td><td></td></tr><tr><td>Oligonucleotide Primers</td><td>Thermo Fisher Scientific</td><td>N/A</td><td>25N synthesis, DSL purification</td></tr><tr><td>Q5 High-Fidelity Polymerase</td><td>New England Biolabs</td><td>M0491S</td><td></td></tr><tr><td>Q5 Reaction Buffer</td><td>New England Biolabs</td><td>B9027S</td><td></td></tr><tr><td>dNTP Solution Mix</td><td>New England Biolabs</td><td>N0447S</td><td></td></tr><tr><td>Agarose</td><td>Bioexpress</td><td>E-3120-125</td><td></td></tr><tr><td>Ethidium Bromide, 1%</td><td>Fisher Scientific</td><td>BP1302-10</td><td></td></tr><tr><td>Gel Extraction Kits</td><td>Epoch Biolabs</td><td>2260250</td><td></td></tr><tr><td>GenCatch Plasmid DNA Miniprep Kit</td><td>Epoch Biolabs</td><td>2160250</td><td></td></tr><tr><td>AatII</td><td>New England Biolabs</td><td>R0117S</td><td></td></tr><tr><td>SacII</td><td>New England Biolabs</td><td>R0157S</td><td></td></tr><tr><td>HindIII-HF</td><td>New England Biolabs</td><td>R3104S</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England Biolabs</td><td>R3101S</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T4 DNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0202S</td><td></td></tr><tr><td>ColiRolle Glass Plating Beads&amp;nbsp;</td><td>EMD Millipore</td><td>7101-3</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-1</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher Scientific</td><td>BP1755-10</td><td></td></tr><tr><td>NHS-Desthiobiotin (DTB)</td><td>Thermo Fisher Scientific</td><td>16129</td><td></td></tr><tr><td>Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1534</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)&amp;nbsp;</td><td>Fisher Scientific</td><td>BP231-100</td><td></td></tr><tr><td>Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1531</td><td></td></tr><tr><td>NHS-LC-LC-biotin</td><td>Thermo Fisher Scientific</td><td>21343</td><td></td></tr><tr><td>Horseradish Peroxidase (HRP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>31490</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 10x Solution</td><td>Fisher Scientific</td><td>BP399500</td><td></td></tr><tr><td>Streptavidin (SA)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>21145</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-100</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher Scientific</td><td>BP172-5</td><td></td></tr><tr><td>Ethylenediaminetetaacetic acid (EDTA)&amp;nbsp;</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Tween 80&amp;nbsp;</td><td>Fisher Scientific</td><td>T164-500</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Fisher Scientific</td><td>H325-4</td><td></td></tr><tr><td>3, 3&#039;, 5, 5&#039;-tetramethylbenzidine (TMB)</td><td>Fisher Scientific</td><td>AC229280050</td><td></td></tr><tr><td>Vivaspin 500 Centrifugal Concentrators&amp;nbsp;</td><td>Viva Products</td><td>VS0192</td><td></td></tr><tr><td>Sodium Acetate, Anhydrous</td><td>Fisher Scientific</td><td>BP333-500</td><td></td></tr><tr><td>96-Well Polystyrene Plates</td><td>Thermo Fisher Scientific</td><td>266120</td><td></td></tr></tbody></table>

using synthetic biology to engineer living cells that interface with programmable materials

פתחנו ממשק אביוטי-ביוטיים המאפשר תאים מהונדסים לשלוט בתכונות החומר של משטח פונקציונלי. מערכת זו נעשית על ידי יצירת שני מודולים: זן מהונדס סינטטי של תאי חיידק וממשק חומר פונקציונלי. בתוך נייר זה, אנו פרטנו פרוטוקול עבור גנטית הנדסת התנהגויות נבחרות בתוך זן של חיידק באמצעות אסטרטגיות שיבוט מולקולריות. לאחר שפותח, זן זה מייצר רמות גבוהות של ביוטין כאשר הם נחשפים inducer כימי. בנוסף, אנו פרוטוקולי פרט ליצירת שני משטחים פונקציונליים שונים, שכל אחת מהן מסוגלת להגיב ביוטין תא-מסונתז. יחדיו, אנו מציגים מתודולוגיה ליצירה צמודה, מערכת אביוטי-ביוטיים המאפשר מהונדסת תאים לשלוט רכב חומר והרכבה על מצעים דוממים.

תוצאות נציגים מוצגות חמש דמויות המצורפות. ראשית, אנו מציגים את תהליך השיבוט גרפי (איור 1), כך שהקורא יכול חזותי בצע את השלבים הקריטיים ליצירת זן החיידק המהונדס הסינטטי. על מנת לאפיין את הדינמיקה באוכלוסייה של התאים, אנו מספקים עקומת צמיחה (איור 2) שנוצרה על ידי מדידת הצפיפות האופטית ב 600 ננומטר (OD 600) של האוכלוסייה. לאחר מכן, אנו מראים כיצד לרשת גן בקרה מאומתת, באמצעות mCherry כמדד bioB (איור 3), מה שמאפשר לנו למדוד אופטית לכמות היחסית של bioB הצריכה להיווצר על ידי התא על אינדוקציה עם IPTG. בשלב בא, אנו מציגים נתונים בתגובה על הבקרה-העקיפה משטחים פונקציונליים ישירה שליטים. מגרשי נתונים אלה (איור 4) שפותחו באמצעות פתרונות נמדדים של חינםביוטין לאפיין את הפרופילים לתשובת המשטחים הפונקציונליים. לבסוף, אנו מציגים נתונים מאפיינים מראים כיצד התאים המהונדסים הם המושרה לייצר ביוטין (איור 5), ובכך שינוי המשטחים הפונקציונליים. <img alt="איור 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> איור 1: עיצוב ובנייה של מושרת, תאים מהונדסים. Primers (א) נועד לבודד את גן bioB מן הגנום E. coli, אשר מקודד אנזים חיוני במסלול הסינתזה ביוטין. (ב) L P, TETO-1 ו -lacI P רצפי TRC-2 יכולים להיות מבודדים פלסמיד המכיל מתג למתג גנטי עם פריימרים מקבילים. (C) גן bioB החילוץ ושני הקטעים מתוך במתג לאחר מכן ניתן להשתמש כדי ליצור את מעגל הגן. התוספת של IPTG אז יכול indתחיקת הבעת bioB וסינתזה ביוטין ובכך כאשר DTB מתווסף כמו מצע עבור bioB. (ד) הפלסמיד התאספו הפך K-12 MG1655 E. coli. זה גרם בנוכחות IPTG להשרות את הביטוי של bioB וסינתזה ביוטין ובכך ידי שורת תאים מהונדסים כאשר DTB סופק כמצע. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> איור 2: עקומות גדילה עבור תאים מהונדסים. המהונדס, מושרת MG1655 wild-type התאים בגרו פיקוח תקשורת מינימאלית (כלומר, ביוטין ללא מדיה M9), כמו גם תקשורת מינימאלית השלימה עם DTB (200 ng / mL) ו / או IPTG (0.5 מ&quot;מ). המגרשים להראות קריאה OD 600, נמדד כל 5 ק&quot;מ<html> n במשך 24 שעות. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> איור 3: בדיקת רשת Engineered ג&#39;ין. חלבון פלואורסצנטי mCherry שימש במקום bioB גן כדי שנוכל אופטי יכול למדוד את פרופיל האינדוקציה כאשר תאים מהונדסים היו מושרים עם IPTG. אנו בניגוד לתאים מושרים עם IPTG (יהלומים אדומים) עם התאים לא מושרה עם IPTG (יהלומים כחולים). תוצאות אלו מראות את היעילות של רשת הגנים המושרית. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> /55300/55300fig4.jpg &quot;/&gt; איור 4: אימות של ממשק החומר הפונקציונלי. על ידי חשיפת המשטח הפונקציונלי שלנו ריכוזים שונים של ביוטין, אנו מסוגלים למדוד את התגובה האופטית על ידי מדידת OD 450 ספיגים. תוצאות אלו מאפשרות לנו ליצור עקומת כיול, המקשרות את הריכוז של ביוטין לעוצמת האופטית של התגובה. כאן, אנו מציגים ביוטין לעומת עקומות אות אופטיות היא עקיף (משמאל) וישיר (מימין) תוכניות המשטח פונקציונליים. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> איור 5: תאים מהונדסים שליטה ממשק חומר. על ידי ניצול סעיפי פרוטוקול 5 או 6, אנו מסוגלים להשתמש במוצרים של מושרה, ג מהונדסאמות כדי לשנות את פני השטח הפונקציונליים כימיות. אנחנו יכולים לעקוב אחרי התגובות האלה אופטיות ידי מדידת OD 450. יתר על כן, באמצעות עקומת הכיול שפותחה באיור 4, אנו יכולים לקשר את העוצמת האופטית של התגובה ביוטין בתוך הריכוז. אנו מציגים כאן את הריכוזים ביוטין השונים, שהיא נמדדות על ידי המשטח פונקציונלי ערכת השליטה העקיפה שלנו, עבור wild-type תאים (לבן), תאי uninduced המכילים את הפלסמיד pKE1-לאצים-bioB (כתום), ותאי מושרה המכילים את pKE1-לאצים-bioB פלסמיד (אפור). <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> כִּימִי </td><td> ריכוז סופי </td><td> כמות </td></tr><tr><td> מלחי 5x M9 </td><td> 1x </td><td> 20 מ&quot;ל </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 מ&quot;מ </td><td> 200 μL </td></tr><tr><td> 1 M CaCl 2 </td><td> 0.1 מ&quot;מ </td><td> 10 μL </td></tr><tr><td> גלוקוז 20% </td><td> 0.40% </td><td> 2 מ&quot;ל </td></tr><tr><td> 2% חומצה Casamino ללא ביוטין </td><td> 0.02% </td><td> 1 מ&quot;ל </td></tr><tr><td> מי DI </td><td> N / A </td><td> 76.8 מ&quot;ל </td></tr></tbody></table> טבלה 1: מתכון מדיה M9. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td colspan="2"> רצף פריימר </td><td> נוֹהָג </td></tr><tr><td> 1-f </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> מיצוי קלטת לאצים </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> מיצוי קלטת לאצים </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> מיצוי P TRC-2 </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> מיצוי P TRC-2 </td></tr><tr><td> nBioB2-F1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> מיצוי bioB </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> מיצוי bioB </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> בנוסף RBS סינתטי </td></tr></tbody></table> טבלה 2: רשימת פריימרים. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td<html> &gt; שלב 1 </td><td> שלב 2 </td><td> שלב 3 </td><td> שלב 4 </td><td> שלב 5 </td><td> שלב 6 </td><td> שלב 7 </td><td> שלב 8 </td><td> שלב 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> חזור 12 פעמים </td><td colspan="3" rowspan="2"> חזור 25 פעמים </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / מחזור </td></tr></tbody></table>er.within-page = &quot;1&quot;&gt; טבלה 3: תוכנית ה- PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> Cell Lysate (תבנית) </td><td> 10 μL </td></tr><tr><td> פריימר (ליחידה) </td><td> 0.625 μL (ליחידה) </td></tr><tr><td> חיץ Q5 5x </td><td> 5 μL </td></tr><tr><td> פולימראז Q5 </td><td> 0.25 μL </td></tr><tr><td> dNTP Mix </td><td> 0.5 μL </td></tr><tr><td> מי DI </td><td> 6.75 μL </td></tr></tbody></table> לוח 4: שלמות תא תגובת PCR (25 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> 10<html> x חיץ תגובה </td><td> 5 μL </td></tr><tr><td> אנזים 1 </td><td> 1 μL </td></tr><tr><td> אנזים 2 </td><td> 1 μL </td></tr><tr><td> DNA תבנית </td><td> 1 מיקרוגרם </td></tr><tr><td> מי DI </td><td> 43 μL - נפח של ה- DNA </td></tr></tbody></table> לוח 5: הגבלת תגובת עיכול האנזים (50 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> DNA </td><td> 50 מיקרוגרם וקטור + X מיקרוגרם הכנס </td></tr><tr><td> 10x אנזים הצפה </td><td> 1 μL </td></tr><tr><td> T4 אנזים </td><td> 1 μL </td></tr><tr><td> מי DI </td><td> 8 μL - נפח של ה- DNA </td></tr></tbody></table>יפ-together.within-page = &quot;1&quot;&gt; לוח 6: תגובת קשירה (10 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> ריכוז </td><td> הערות </td></tr><tr><td> CaCl 2 </td><td> 100 מ&quot;מ </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 מ&quot;ג / מ&quot;ל ​​(1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 מיקרוגרם / מ&quot;ל </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> SPDP </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> LC-LC-ביוטין </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> HRP </td><td> 10 מ&quot;ג / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> SA (בעקיפין) </td><td> 10 מ&quot;ג / מ&quot;ל </td><html><td> ב PBS </td></tr><tr><td> SA (ישיר) </td><td> 0.17 מיקרוגרם / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> BSA </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> DTT </td><td> 100mm </td><td> ב DI מים </td></tr><tr><td> EDTA </td><td> 5 מ&quot;מ </td><td> 18.6 מ&quot;ג ל -10 מ&quot;ל PBS </td></tr><tr><td> קזאין </td><td> 0.50% </td><td> ב PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> ב DI מים </td></tr><tr><td> Tween 80 ב PBS </td><td> 0.05% </td><td></td></tr><tr><td> אצטט נתרן </td><td> 50 מ&quot;מ </td><td> במים DI, התאם ל -5.1 pH באמצעות 3 M HCl </td></tr><tr><td> TMB </td><td> 1% </td><td> ב DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> ב DI מים </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> ב DI מים </td></tr></tbody></table>page = &quot;1&quot;&gt; לוח 7: רשימת פתרונות המגיבים.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

מאמר זה מציג סדרה של פרוטוקולים לפיתוח תאים מהונדסים ומשטחים פונקציונליים המאפשרים מהונדס חיידק סינטטי לשלוט ולטפל משטחי חומר לתכנות.

באמצעות ביולוגיה סינתטית מהנדס תאים חיים המתממשקות חומרים לתכנות

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University.  מאמר זה מציג סדרה של פרוטוקולים לפיתוח תאים מהונדסים ומשטחים פונקציונליים המאפשרים מהונדס חיידק סינטטי לשלוט ולטפל משטחי חומר לתכנות. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

גישור ממשק ביו אלקטרונית עם Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the importance of 3-dimensional (3D) cellular assemblies in these fields. Artificial scaffolds have often been used to construct 3D cellular assemblies. However, the scaffolds used to construct cellular assemblies are sometimes toxic and may change the properties of the cells. Thus, it would be beneficial to establish a non-toxic method for facilitating cell-cell contact. In this paper, we introduce a novel method for constructing stable cellular assemblies by using optical tweezers with dextran. One of the advantages of this method is that it establishes stable cell-to-cell contact within a few minutes. This new method allows the construction of 3D cellular assemblies in a natural hydrophilic polymer and is expected to be useful for constructing next-generation 3D single-cell assemblies in the fields of regenerative medicine and tissue engineering.

We demonstrate a novel method for constructing a single-cell-based 3-dimensional (3D) assembly without an artificial scaffold.

מניפולציה מתאים חיים לבנות יציב הרכבה הסלולר 3D ללא לגרדום מלאכותי

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the ...

Biochemistry

Engineering Intracellular Protein Sensors in Mammalian Cells

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells to sense and respond to these biomarkers may help the understanding of molecular mechanisms underlying pathologies, as well as to develop new cell-based therapies. While several systems that detect extracellular proteins have been developed, a modular framework that can be easily re-engineered to sense different intracellular proteins was missing.
Here, we describe a protocol to implement a modular genetic platform that senses intracellular proteins and activates a specific cellular response. The device operates on intracellular antibodies or small peptides to sense with high specificity the protein of interest, triggering the transcriptional activation of output genes, through a TEV protease (TEVp)-based actuation module. TEVp is a viral protease that selectively cleaves short cognate peptides and is widely used in biotechnology and synthetic biology for its high orthogonality to the cleavage site. Specifically, we engineered devices that recognize and respond to protein-biomarkers of viral infections and genetic diseases, including mutated huntingtin, NS3 serine-protease, Tat and Nef proteins to detect Huntington&#8217;s disease, hepatitis C virus (HCV) and human immunodeficiency virus (HIV) infections, respectively. Importantly, the system can be hand tailored for the desired input-output functional outcome, such as fluorescent readouts for biosensors, stimulation of antigen presentation for immune response, or initiation of apoptosis to eliminate unhealthy cells.

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general architecture.

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells ...

Genetics

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

אוטומטית רובוטית טיפול בנוזלים הרכבה של התקנים DNA מודולרי

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

משטח פונקציונלי-הנייח של גנים באמצעות גדיל שקודמים הזחה ליתוגרפיה

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

פלטפורמת מיקרופלואידיג רב שכבתית לצורך הובלה של ביטוי גנים ממושך ללא תא

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

הכנת חלבון הפקת תאים סינתטיים באמצעות שולפת תא חינם בקטריאלי, ליפוזומים והעברת אמולסיה

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

Simple, Affordable, and Modular Patterning of Cells using DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells of the same or different type, micropatterning techniques have proved useful. DNA Programmed Assembly of Cells (DPAC) is a micropatterning technique that targets the adhesion of cells to a substrate or other cells using DNA hybridization. The most basic operations in DPAC begin with decorating cell membranes with lipid-modified oligonucleotides, then flowing them over a substrate that has been patterned with complementary DNA sequences. Cells adhere selectively to the substrate only where they find a complementary DNA sequence. Non-adherent cells are washed away, revealing a pattern of adherent cells. Additional operations include further rounds of cell-substrate or cell-cell adhesion, as well as transferring the patterns formed by DPAC to an embedding hydrogel for long-term culture. Previously, methods for patterning oligonucleotides on surfaces and decorating cells with DNA sequences required specialized equipment and custom DNA synthesis, respectively. We report an updated version of the protocol, utilizing an inexpensive benchtop photolithography setup and commercially available cholesterol modified oligonucleotides (CMOs) deployed using a modular format. CMO-labeled cells adhere with high efficiency to DNA-patterned substrates. This approach can be used to pattern multiple cell types at once with high precision and to create arrays of microtissues embedded within an extracellular matrix. Advantages of this method include its high resolution, ability to embed cells into a three-dimensional microenvironment without disrupting the micropattern, and flexibility in patterning any cell type.

Here we present a protocol to micropattern cells at single-cell resolution using DNA-programmed adhesion. This protocol uses a benchtop photolithography platform to create patterns of DNA oligonucleotides on a glass slide and then labels cell membranes with commercially available complementary oligonucleotides. Hybridization of the oligos results in programmed cell adhesion.

דפוס פשוט, זול ומודולרי של תאים המשתמשים ב- DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells ...

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

אפיון מהיר של חלקים גנטיים עם מערכות נטולות תאים

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

פרוטוקולים ליישום<em&gt; חיידקי Escherichia</emמערכת&gt; בהתבסס TX-TL סלולרי ללא ביטוי של ביולוגיה סינתטית

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...