Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00.000+00:00
Duration: 10 min 20 s
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

עבודה זו נתמכה על ידי NIH AI099854 ו- AI126742 למפתח.

1. חישול של vDNA
<ol><li>שלב 1 X 10 מאגר (10 X 10 מניות: 100 מ"מ טריס-HCl, pH 8.0, 1 M NaCl, EDTA 10 מ מ), 10 מיקרומטר Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 מניות מיקרומטר) ו- 10 מיקרומטר Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 מניות מיקרומטר באמצעי אחסון הסופי של 1.5 מ ל) . µL 25 aliquot לתוך צינורות תגובת שרשרת (PCR) 0.2-mL פולימראז שישים. הערה: בהתאם ליישום, oligomers עשוי להיות שונה עם fluorophores או תגיות בקצה 5'-Oligo 2 או כמו של פנימי אמינו-טי בגיל 13 הבסיס מקצה 5'-Oligo 1. Oligomers ששונה לטהרו על ידי ביצועים גבוהים כרומטוגרפיה נוזלית (HPLC) לפני חישול. מצאנו כי 5'-סוף Cy3 או Cy5 fluorophore תיוג של Oligo 2 מפחית את היעילות הרכבה intasome 10-fold. תיוג fluorophore פנימי אינו מקטין את יעילות הייצור.</li>
	<li>Anneal באמצעות thermocycler התקופה הבאה על טמפרטורות: 1 מחזור ב 94.0 הלעפה תרוטרפמט 3 דקות, 99 מחזורי ב (94.0 הלעפה תרוטרפמט 1 דקות, הלעפה תרוטרפמט 93.6 1 דקות) יורד הטמפרטורות הן על-ידי הלעפה תרוטרפמט 0.8 לכל מחזור (המחזור האחרון הוא 14.8 הלעפה תרוטרפמט 1 דקות, הלעפה תרוטרפמט 14.4 1 דקות) , ולאחסן ב הלעפה תרוטרפמט 4.0.</li>
	<li>לשלב את התגובות מחזק משפופרות שישים כל. לטעון µL 500 שני 0.5-mL 3 kDa משקל מולקולרי הקיצוץ (MWCO) ultracentrifugal מסנן ריכוז היחידות. לרכז את vDNA annealed על ידי צנטריפוגה ב microcentrifuge ב 14,000 g x 10 דקות בטמפרטורת החדר (RT). הערה: אמצעי האחסון retentate צריך להיות µL ~ 50 בכל יחידת ריכוז.</li>
	<li>למחוק את הזרימה. להוסיף 250 µL של vDNA annealed הנותרים כל יחידת מסנן. חזור על הספין וזורקים את הזרימה. מאגר exchange לתוך מאגר TE (10 מ מ טריס-HCl, pH 8.0, 1 מ"מ EDTA) ע י שטיפת שלוש פעמים עם טה µL 450.</li>
	<li>היפוך של יחידת מסנן ומסתובב ב 1,000 x g למשך 2 דקות ב- RT. האחסון retentate הסופי עבור כל יחידת מסנן צריך להיות µL ~ 50. לשלב את retentates ואת העברת צינור פקקי בורג 1.5 mL.</li>
	<li>למדוד את ספיגת 260 ננומטר אולטרה סגול (UV) של vDNA. השתמש בערך זה כדי לחשב את ריכוז הדנ א מולרי סופית. מקדם הכחדה (חדוה260) vDNA הזה הוא 622,803 ס מ-1 מ'-1 והוא משקל מולקולרי שלה חנות המחוזי 23,972 ב-20 הלעפה תרוטרפמט.</li>
</ol>2. Intasome הרכבה
<ol><li>במידת האפשר, בצע את מכלול intasome בחדר קטן עם תרמוסטט משתנה. לכוון את התרמוסטט כדי כ 18-22 הלעפה תרוטרפמט. הערה: מניסיוננו, intasome assembly הלעפה תרוטרפמט 4 זה לא יעיל.</li>
	<li>להכנת 1 ליטר של מאגר דיאליזה (20 מ מ Bis-טריס פרופאן, pH 7.5, 200 מ"מ NaCl, 2 מ מ dithiothreitol (DTT), מיקרומטר 25 ZnCl2) בתוך 2 ל' עם בר מערבבים בצלחת מערבבים. Equilibrate המאגר בחדר הלעפה תרוטרפמט 18-22 לפחות 6 שעות.</li>
	<li>להרכיב את intasomes, לשלב 50 מ"מ Bis-טריס פרופאן, pH 7.5, 500 מ מ NaCl, 120 מיקרומטר ב PFV ו- vDNA 50 מיקרומטר, הנפח הכולל של 150 µL. הערה: PFV IN צריך להיות חופשי של מזהם נוקלאז פעילות7,8. אם הריכוז של PFV הוא גם לדלל כדי להכיל 120 ב מיקרומטר בכרך µL 150, אז זה אפשרי להגביר את עוצמת הסופי כדי 200 µL. הגורמים הקריטיים של שלב זה הן כדי לשמור על יחס טוחנת של IN כדי vDNA (2.4:1) יש מספיק מתחם להמחיש במהלך כרומטוגרפיה.</li>
	<li>נקה פיסה מוארכת ~ 10-ס מ 10-מ מ 6-8 kDa MWCO דיאליזה אבובים, קליפים עם מים מזוקקים כפול (ddH2O), או המים טוהר הגבוהה ביותר הזמינים. קליפ קצה אחד של הצנרת. הערה: דיאליזה אבובים שצריך לנהוג בזהירות כדי למנוע כל זיהום אפשרי מן המרחב מעבדה.</li>
	<li>להפוך 15 מ"ל דיאליזה מאגר של שטיפה אבובים (50 מ מ Bis-טריס פרופאן, pH 7.5, 500 מ מ NaCl). לשטוף את החלק הפנימי של הצנרת דיאליזה שלוש פעמים עם 1-2 מ ל שטיפה מאגר. להסיר כמה המאגר שטיפה ככל האפשר עם פיפטה, ג'ל דק טעינת עצה.</li>
	<li>אם יש צורך, להשתמש גילוח נקי או אזמל לחתוך את הדיאליזה, אבובים כך טיפ הטעינה ג'ל דק עשוי להגיע לסוף של הצנרת.</li>
	<li>העבר את מכלול intasome מהשלב 2.3 הצנרת דיאליזה פיפטה, ג'ל דק טעינת עצה. קליפ את הקצה הפתוח של הצנרת דיאליזה, למזער את כמות האוויר הציג בתוך הצנרת. מקם את הצנרור למאגר דיאליזה.</li>
	<li>Dialyze לילה (16-20 h) עם ערבוב עדין כך הצנרת מסתובב אך לא נמצא מערבולת. ודא כי הצנרת דיאליזה המשוקע, ניידים. לאחר כשעה, להתבונן על התמיסה גלוי בתוך הצנרת. הערה: Cy3 או Cy5 fluorescently הנקרא vDNA, התמיסה הוא יותר ברור. זה נכון עבור סוף הנקרא והן vDNA פלורסנט פנימי עם תוויות.</li>
</ol>3. Intasome Solubilization
<ol><li>להכין שני רחב נשא פיפטה טיפים על-ידי הסרת 2-4 מ מ מהקצה של טיפ 200 µL עם סכין גילוח או אזמל חדש על משטח נקי. הערה: הטיפים ישמש בשלב 3.3 ו- 3.5.</li>
	<li>הסר את הצנרור דיאליזה המאגר דיאליזה. על מנת למנוע דילול מדגם intasome עם מאגר דיאליזה שעלולים להישאר בסוף הצנרור ליד הפריט, להשתמש micropipette עם טיפ קטן פיפטה כדי להסיר כל מאגר עודף דיאליזה. להסיר את הסרטון מקצה אחד של הצנרת דיאליזה.</li>
	<li>שימוש רחב נשא פיפטה עצה מהשלב 3.1 להעביר את הדגימה כולל את התמיסה בתוך הצנרת דיאליזה כדי צינור 1.5-mL על קרח. הערה הנפח הכולל של החומר המשוחזר; לנפח הכללי הוא בדרך כלל ~ 140 µL.</li>
	<li>המדגם עם התמיסה הוא 200 מ"מ NaCl; להגדיל את המלח כדי ריכוז סופי של 320 מ מ NaCl על-ידי הוספת נפח מתאים של פתרון NaCl 5 מ' מניות. לדוגמה, עבור מדגם של 150 µL, להוסיף µL 3.9 5 מ' NaCl ו- 1.1 µL ddH2O עבור אמצעי אחסון הסופי של 155 µL. העברת קרח בדלי עם לטעום לתוך חדר קר הלעפה תרוטרפמט 4.</li>
	<li>שימוש רחב נשא פיפטה עצה מהשלב 3.1 אל resuspend ואל solubilize את התמיסה על-ידי pipetting. חזור על כל 20 דקות לפחות 1 ח' להתבונן כי רוב התמיסה. כדאי שנלך לשם פתרון. הערה: Pipetting כדי resuspend את המשקע ניתן לעצור כאשר ניכר כי התמיסה מצטמצם עוד ניכר בין נקודות זמן. כאשר vDNA אינו מסומן או תוצמד באופן פנימי, התמיסה הוא מופחת על ידי ~ 90% בהתבסס על בדיקה ויזואלית. במקרה של סיום Cy5 הנקרא vDNA, התמיסה הוא מופחת על ידי ~ 20% בלבד; רוב התמיסה עם סוף fluorophore הנקרא vDNA לא solubilize. הכמות של התמיסה זה ביעילות solubilized משתנה והיא צריכה להיות נחוש מדעית.</li>
</ol>4. Intasome טיהור
<ol><li>להכין 250 מ של גודל אי-הכללה של כרומטוגרפיה (שניות) הפעלת מאגר (20 מ מ Bis-טריס פרופאן, pH 7.5, 320 מ מ NaCl, 10% גליצרול). מסנן סטרילי המאגר עם 0.2-מיקרומטר לסנן יחידת ולאחסן ב 4 הלעפה תרוטרפמט. הערה: כל השלבים טיהור מבוצעות בחדר קר הלעפה תרוטרפמט 4.</li>
	<li>Equilibrate עמודה agarose צולבים שניה (קוטר = 10 מ"מ; אורך = 300 מ"מ; מיטה נפח = 24 mL; לדגום נפח = 25-500 µL; לחץ מרבי = 1.5 מגפ ס; אי-הכללה של מגבלת = 4 x 107 Da; מפריד מולקולרית משקולות בין 5 ל 5,000 kDa, לראות את טבלה של מחצלת erials) עם מאגר הפעלה שניה בספיקה של 0.4 mL/min. הערה: טיהור זה שעשוי להיות מותאם גודל שונה אי-הכללה של עמודות אם הם מסוגלים ביעילות להפריד 300 kDa kDa 44, כגון Superose 12 10/300 GL או להגדיל את Superose 6. Superose 12 10/300 GL יש ברזולוציה נמוכה יותר, שמוביל יותר החפיפה של פסגות. לעומת זאת, Superose 6 להגדיל יש רזולוציה גבוהה יותר והוא מציע הפרדה טובה יותר.</li>
	<li>Centrifuge הדגימה intasome ב microfuge ב 14,000 x g 10 דקות ב 4 הלעפה תרוטרפמט כדי הצניפה כל המשקע הנותרים. הסר בזהירות את תגובת שיקוע. לטעון את תגובת שיקוע ללולאה הזרקת 200 µL (צינורות שיכול להכיל ~ 200 μL). להחיל את הדגימה לעמודה שניה. הערה: כרכים עומס קטן יותר לאפשר רזולוציה גדולה יותר לפי סעיף</li>
	<li>Elute 25 מ ל שניה מפעיל מאגר ולאסוף 95 שברי µL 270. לבחון chromatogram שניה מציג שלוש א280/A260 פסגות (איור 1). הערה: הראשון צריך להיות צבירה (~9.0 - • תנאי 11.5 מ ל), ואחריו את שיא intasome tetramer PFV (~12.0 - 14.75 מ"ל • תנאי) ואת מונומר ב PFV עם שיא vDNA חינם (~15.0 - 18.0 מ ל).</li>
</ol>5. שילוב סטרנד העברה Assay, ובחירת שבר, אחסון
<ol><li>לשלב 2 µL של כל שבר שיא של intasome ו- 50 ng 3 kb supercoiled פלסמיד ה-DNA (ריכוז מניות הוא 50 ng/µL) במאגר התגובה (10 מ מ Bis-טריס פרופאן, pH 7.5, 110 מ מ NaCl, 5 מ מ MgSO4, ZnCl 4 מיקרומטר2, 10 מ מ DTT) באמצעי אחסון התגובה האחרונה של 15 µL. דגירה-37 הלעפה תרוטרפמט במשך 5 דקות.</li>
	<li>כוללות פקד שלילי עם לא intasome PFV נוספת. לעצור את התגובה עם µL 0.75 proteinase K (פתרון מניות 20 מ"ג/מ"ל) ו- 0.75 µL מרחביות (פתרון 10% מניות). דגירה-55 הלעפה תרוטרפמט לדוגמאות החנות ה 1 כנדרש ב-20 הלעפה תרוטרפמט עבור בהמשך מנתח. הערה: זה וזמינותו היא הערכה איכותית של פעילות האינטגרציה. ריכוז מולרי intasome של כל שבר לא נקבע לפני זה וזמינותו. שברים כלול שילוב סטרנד העברה וזמינותו ניתן לאחסן על קרח (כולל אחסון לילה) עד שילוב פעילות הוא אישר, שברים הנבחרים aliquoted. כאן אנו משתמשים pMP2, נגזרות pUC199. אנו משתמשים גם בהצלחה את pcDNA פלסמיד 5.4 kb 3.1. כל פלסמיד שעשויים להיות נחוש בדעתך בהרפיה מעגל, לינארית, טפסים supercoiled עשוי לשמש כמטרה לשילוב.</li>
	<li>להכין משקולת 1% 120 מ לכל אמצעי אחסון (w/v) ג'ל agarose במאגר טה X 1 (40 מ"מ טריס-אצטט, 1 מ"מ EDTA) עם 0.1 μg/mL אתידיום ברומיד (EtBr, פתרון מניות 10 מ"ג/מ"ל)10. להמיס את הפתרון agarose ויוצקים אותו לתוך מגש הליהוק של ג'ל 15 ס"מ, 10 ס"מ. הכנס מסרק 15-ובכן עם 5 מ מ רחב, 0.75 מ מ עבה וולס. הערה: בארות צר יותר תשואה רזולוציה להקה טובה יותר בהשוואה ולס בעובי 1.5 מ מ.</li>
	<li>לאפשר את הג'ל שבמהלכו בטמפרטורת החדר. לטבול את ג'ל טה X 1 עם 0.1 μg/mL EtBr.</li>
	<li>להוסיף 3 גליצרול 50% µL כל התגובה אינטגרציה מהשלב 5.2. לטעון את אמצעי האחסון כולו התגובה הג'ל. לטעון µL 1 של 10 kb DNA גודל סמן (150 ריכוז מניות ng/µL) על הנתיבים משני צדי הדגימות; במילים אחרות, דה מרקר גודל דנ א צריך לאגף המסלולים לדוגמה.</li>
	<li>. בנתיב החיצוני לטעון µL 6 כתום G צבען (0.25% כתום G, 30% גליצרול). הפעל את הג'ל עם מתח קבוע, 10 V/ס מ (100 וולט) בטמפרטורת החדר למשך 1 h, או עד לחזית צבע כתום G מגיע לסוף הג'ל.</li>
	<li>תמונה מיד את הג'ל agarose עם סורק פלורסנט מוגדר לזהות EtBr (532 ננומטר עירור, 610 ננומטר מסנן פליטה). אם נעשה שימוש fluorophore הנקרא vDNAs, גם תמונה עם הגדרות fluorophore המתאים. הערה: לדוגמה, כדי לזהות Cy5 בתווית ה-DNA, התמונה באמצעות עירור nm 633 ומסננים פליטה 670 ננומטר. מוצרים אינטגרציה מתואמת (CI, DNA ליניארי) צריך להפעיל נכון גודל ב ~ 3 kb, פלסמיד supercoiled unreacted (SC) צריך לרוץ מהר יותר (~ 2 kb) ולאחר חצי-אתרים שילוב מוצרים (מצב HSI, רגועה מעגל ה-DNA) לפעול לאט יותר (~3.5 kb). Unreacted vDNA כדאי נכון להפעיל גודל ~ 40 bp.</li>
	<li>לכמת הלהקות בנתיב כל עם תוכנת הדמיה7. לחשב את השבר של ה-DNA בנתיב כל זה CI, מצב HSI או SC; חישוב זה אינו כולל vDNA. הערה: יעילות שילוב, או את חלק SC להמיר מוצר ליניארי, מחושב על ידי חלוקת כמות פיקסלים מתואמת שילוב מוצרים (CI) על ידי כמות הפיקסלים הכולל שלוש להקות (מצב HSI + CI + SC). אם intasomes fluorophore שכותרתו, ייתכן מצב HSI את המוצרים CI גם quantitated על-ידי קרינה פלואורסצנטית.</li>
	<li>בחר בשברים עם פעילות האינטגרציה ביותר מתואמת. הערה: מניסיוננו, פעילות האינטגרציה שיא ופעולה מתואמים עולה בקנה אחד עם הפסגה חלבון המזוהה tetrameric PFV intasomes. למדוד את A280 של כל אלו שברים ולחשב את הריכוז intasome הסופי. חדוה280 עבור tetramer מסוג בר ב PFV עם שני vDNAs המתוארים כאן הוא 908,339 ס מ-1מ'-1 והוא משקל מולקולרי 225.5 kDa. הריכוזים פעל על פי אותו דפוס כמו הפסגה chromatogram שניה ו ב- strand העברה וזמינותו.</li>
	<li>להפיץ כל השבר 5 µL aliquots והכנס להקפיא במצב חנקן נוזלי. חנות aliquots ב-80 הלעפה תרוטרפמט. שברים שנבחר עבור אחסון הם בדרך כלל בין 200-600 ננומטר.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

המחברים אין לחשוף.

תוספות retroviral טופס של multimeric מורכבים עם ה-DNA גנומי הנגיפי לבצע אינטגרציה ולהמשיך את מחזור החיים ויראלי. המספר של מונומרים לכל intasome ייתכן tetramers, octamers או אולי גבוה יותר סדר multimers11,12,13,14. PFV intasomes הם tetramer של רקומביננטי עם כפול גדילי DNA oligomers המחקים נגיפי DNA גנומי מסתיים3. Intasomes אלה שימשו מחקרים דינמיים מבניים3,5,13,14.
ההרכבה של PFV intasomes מתרחשת במהלך דיאליזה מתוך מאגר ריכוז המלח גבוה יחסית כדי ריכוז מלח נמוך יותר. התוצאה היא היווצרות התמיסה הכולל את intasomes PFV. Intasomes הם solubilized על ידי הגדלת ריכוז מלח. ב PFV הוכח להיות monomeric בריכוזים עד מיקרומטר 2255. מתחמי הם מבודד monomeric ב ואז חינם vDNA לפי סעיף אנחנו ששינית את הטיהור של PFV intasomes כדי לכלול גליצרול ב מאגר שניה6. התוספת של גליצרול מאפשר את intasomes PFV יוקפא לשימוש עתידי ללא הפסד של פעילות (איור 4).
ישנן כמה תכונות מפתח של פרוטוקול זה. למרות חלבון טיהור מבוצע לעתים קרובות בטמפרטורות נמוכות, מצאנו מדעית כי מכלול intasome PFV הוא לא יעיל-הלעפה תרוטרפמט 4. במקום זאת, ניקויי הרכבה צריך להתרחש בטווח של 18-22 הלעפה תרוטרפמט. חשוב גם להשתמש רקומביננטי IN PFV ללא תשלום של זיהום חיידקי נוקלאז7,8. לבסוף, היחס של IN vDNA היא גורם מפתח של ההרכבה. אם ההתחלה בריכוז חלבון נמוך יותר מומלץ כאן ריכוז vDNA חייב להיות באופן פרופורציונלי ירד. אמנם זה ניתן להרכיב PFV intasomes בריכוזים נמוכים, מתחמי להיות גבוהה מספיק ריכוז לגילוי במהלך ההפרדה שניה.
שיטה זו עשויה לשמש PFV intasomes עם vDNA ללא תווית או תוויות. מצאנו כי vDNA עשוי להיות יעיל מסומן באמצעות fluorophore או ביוטין6. שאר התוויות מולקולה קטנה גם ייתכן. במקרה של Cy5 fluorophore, אנו מוצאים את הקצה הזה הנקרא vDNA מפחית את התשואה של intasomes התאספו עם ריכוז שיא מופחת 10-fold. ואולם, באופן פנימי Cy5 הנקרא vDNA יש על התשואה שוות ערך ל vDNA ללא תווית. שיטה זו הרכבה עשוי לשמש גם עם מוטציות נקודה או לחיתוך מוטציות של PFV ב4. מאז PFV IN מעוכבת על ידי IN הרלוונטית קלינית לנטישה של העברת מעכב (INSTI) שהתרופות המתוות ב HIV-1, ניתן להשתמש intasomes PFV אלה כדי לחקור את המנגנון של INSTIs3. בנוסף, כמה מוטציות INSTI עמיד של HIV-1 ב להתרחש בבית שאריות שנשמרת ב PFV, המאפשר לימודים של עמידות לתרופות עם intasomes PFV מהונדסים.

שילוב של הגנום הנגיפי לתוך הגנום המארח הוא צעד הכרחי במחזור החיים של רטרווירוסים כל1. Integrase אנזים ויראלי (ב) מזרז בהצטרפות קוולנטיות בסוף כל הגנום DNA נגיפי למחשב המארח הדנ א. במהלך זיהום הסלולר, הוא חלק ממתחם אינטגרציה קדם המעביר אינטגרציה. ב רקומביננטי ומורכבת עם כפול oligomers DNA נטושים מחקה את הקצוות DNA נגיפי ניתן גם לבצע אינטגרציה לתוך ה-DNA היעד במבחנה2. יישום נפוץ השילוב assay במבחנה מנצל של פלסמיד supercoiled כיעד הדנ א. שילוב של שני oligomers DNA נגיפי (vDNA) כדי פלסמיד התוצאה היא מוצר ליניארי, הנקרא מתואמת אינטגרציה (איור 2 א). שילוב assay במבחנה גם תניב מוצרים עם אחד בלבד vDNA covalently לצרף את פלסמיד המטרה וכתוצאה מכך עיגול רגוע. מוצר זה שילוב חצי-אתר שנראה חפץ של assay בתוך חוץ גופית.
ב רקומביננטי, vDNA ניתן לבצע אינטגרציה במבחנה, אבל הם לא ריאגנטים אידיאלי עבור חקר הדינמיקות או מבנה של אינטגרציה מתחמי כאשר ב monomeric יטשטש ויזואליזציה הרלוונטיים. מתחמי אינטגרציה מטוהרים, או "intasomes", נדרשים ללימודי ניתוח או מבנה דינמי מולקולה בודדת. ב PFV ו- vDNAs עשוי להיות התאספו על-ידי דיאליזה מתוך מאגר ריכוז המלח גבוה יחסית ל-3,ריכוז מלח נמוך4. במהלך דיאליזה, התמיסה טפסים. המשקע הזה יוסר דיאליזה, ריכוזי המלח הוא גדל. ריכוז המלח גבוה יותר solubilizes את intasomes PFV המכיל precipitate. Intasomes כבר אז טהור לפי גודל אי-הכללה של כרומטוגרפיה (שניות). אב טיפוס רקומביננטי קצפית וירוס (PFV) ב הוכח קיימים מונומר בפתרון בריכוזים עד מיקרומטר 2255. Fractionation שניה מפריד ביעילות את intasomes PFV (225.5 kDa), הכוללת של tetramer PFV IN, שני vDNAs, PFV monomeric ב (44.4 kDa), חינם vDNA (24.0 kDa). Intasomes PFV יתכן מוקפאות ולשמר את פעילות האינטגרציה במשך לפחות שישה חודשים של אחסון ב-80 הלעפה תרוטרפמט.
Intasomes PFV רקומביננטי ניתן לשינוי כדי לכלול החלפות חומצת אמינו או לחיתוך מוטציות או vDNAs עם4,fluorophores או ביוטין6תוויות. Intasomes PFV מטוהרים בקלות לבצע אינטגרציה לתוך פלסמיד supercoiled יעד ה-DNA במבחנה. תפזורת מבחני הביוכימי אינטגרציה עם intasomes עשוי לבחון את ההשפעות של מוטציות, מעכבי, או תוספים כימיים אחרים. Biotinylated intasomes יכול לשמש כדי לחקור זיקה עם חומצות גרעין או חלבונים. PFV intasomes פונקציונליים בטמפרטורת הסביבה ומאפשר לבדיקה מיקרוסקופית מולקולה בודדת על-ידי פינצטה מגנטי כדי למדוד את הזמן בין הצטרפות של שני הקצוות vDNA או קרינה פלואורסצנטית גמורה להמחיש את החיפוש intasome על המטרה דנ א6. בנוסף, PFV intasomes היו הראשונים להיות מבנית מאופיין להשפיע באופן משמעותי בתחום של שילוב retroviral3.

<table><tbody><tr><td>DNA Oligomers</td><td>IDT</td><td>N/A</td><td>Custom DNA Oligos</td></tr><tr><td>Tris Ultra Pure</td><td>Gojira Fine Chemicals</td><td>UTS1003</td><td></td></tr><tr><td>NaCl</td><td>P212121</td><td>RP-S23020</td><td></td></tr><tr><td>UltraPure EDTA</td><td>Invitrogen/Gibco</td><td>15575</td><td></td></tr><tr><td>Amicon Ultra 0.5 mL centrifugal filters</td><td>Sigma-Aldrich</td><td>Z677094-24EA</td><td>3 kDa MWCO</td></tr><tr><td>DTT</td><td>P212121</td><td>SV-DTT</td><td></td></tr><tr><td>BIS-TRIS propane,&gt;=99.0% (titration)</td><td>Sigma-Aldrich</td><td>B6755-500G</td><td></td></tr><tr><td>ZnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>208086</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Amresco</td><td>0662</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>G37-20</td><td></td></tr><tr><td>Gel-loading tips, 1 - 200 &amp;mu;L</td><td>Corning</td><td>CLS4853-400EA</td><td></td></tr><tr><td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td><td>Fisher Scientific</td><td>12-640</td><td></td></tr><tr><td>Sterile Disposable Filter Units with PES Membrane &gt; 250mL</td><td>Thermo Fisher Scientific</td><td>568-0020</td><td></td></tr><tr><td>Dialysis tubing clips</td><td>Spectrum Labs</td><td>132734</td><td></td></tr><tr><td>6-8 kDa 10 mm Dialysis Tubing</td><td>Spectrum Medical</td><td>132645</td><td></td></tr><tr><td>Superose 6 10/300 GL</td><td>GE Healthcare Life Sciences</td><td>17517201</td><td></td></tr><tr><td>Hi-Res Standard Agarose</td><td>AGTC Bioproducts</td><td>AG500D1</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>BP1302</td><td></td></tr><tr><td>Orange G</td><td>Fisher Scientific</td><td>0-267</td><td></td></tr><tr><td>Hyladder 10kb, 500 lanes</td><td>Denville Scientific</td><td>CB4225-4</td><td></td></tr></tbody></table>

assembly and purification of prototype foamy virus intasomes

א הגדרת תכונה, צעד הכרחי של מחזור חיי הרטרווירוס הוא השילוב של הגנום הנגיפי לתוך הגנום המארח. כל רטרווירוסים לקודד אנזים integrase (ב) אשר מזרז קוולנטיות בהצטרפות של נגיפי למארח ה-DNA, הידוע בשם strand העברה. שילוב יכול להיות מעוצבת במבחנה עם IN retroviral רקומביננטי ו- DNA oligomers מחקה את הקצוות של הגנום הנגיפי. על מנת לסכם באופן הדוק יותר התגובה אינטגרציה המתרחשת ויוו, אינטגרציה מתחמי are התכנסו from IN רקומביננטי, oligomers סינתטי על-ידי דיאליזה במאגר מלח בריכוז. מורכבות, השילוב של intasome, שנקרא יכולים להיטהר על-ידי גודל אי-הכללה של כרומטוגרפיה. במקרה של אב-טיפוס קצפית וירוס (PFV), intasome של tetramer של oligomers דנ א שני והוא מופרד ברצון monomeric IN, אוליגומר חינם הדנ א. יעילות שילוב PFV intasomes ייתכן לבדיקה תחת מגוון תנאים ניסיוני כדי להבין טוב יותר את הדינמיקה, מכניקה של retroviral אינטגרציה.

PFV intasomes are התכנסו from רקומביננטי IN ו- vDNA. לאחר ההרכבה, intasomes כבר טהור על ידי שניה (איור 1). שילוב פעילות של כל שבר לבדיקה עם supercoiled DNA היעד ואת agarose בג'ל (איור 2). הג'ל הזה הוא עם תמונה עם סורק פלורסנט מוגדר לזהות EtBr (וגם fluorophore, אם התווית על-ידי fluorophore vDNA משמש). באמצעות תוכנת ניתוח תמונה, להקה פיקסל כרכים ניתן לחשב את יעילות שילוב (איור 3). שברים עם יעילות שילוב הגבוהה ביותר הם הצמד קפוא לשימוש מאוחר יותר. שברים קפוא שומרים על פעילות האינטגרציה (איור 4), המאפשר אחסון לטווח ארוך של intasomes מורכבים. כל מולקולה תווית ואת מיקומו בתוך vDNA עלול להשפיע על יעילות הייצור intasome (איור 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57453/57453fig1.jpg"> איור 1: גודל הדרה chromatogram. אסיפה intasome PFV הופרד עם טור שניה agarose. עמודה זו מאפשרת הפרדת הצבירה (1), intasome PFV המורכב tetramer PFV IN, שני vDNA (2), ואת monomeric ב PFV vDNA (3). דוגמה זו כללה vDNA עם תווית fluorophore Cy5 פנימי זוהה על ידי עירור 650 ננומטר. ציר ה-y מציין צפיפות אופטית (OD) ביחידות מילי-ספיגת (מאו). <a href="//ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57453/57453fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57453/57453fig2.jpg"> איור 2: שילוב וזמינותו של שברים שניה. תיאור סכמטי של אינטגרציה סטרנד העברה התגובה (A). . שמאלה, קריקטורה של intasome PFV כולל את tetramer של (עיגולים כחולים) שני vDNA (קווים שחורים עבים), ואת של פלסמיד היעד (קווים שחורים דקים). Supercoils (SC) של פלסמיד היעד לא נמשכים. מרכז, קריקטורה של מוצר חצי-אתרים אינטגרציה (מצב HSI) כאשר אחד vDNA יש כבר הצטרפו covalently כדי פלסמיד היעד. התגובה מצטרף מציג חתך, מרגיע את supercoils. . כן, קריקטורה של מוצר אינטגרציה מתואמת (CI) שבו שני vDNAs כבר הצטרפו אל המטרה ה-DNA. מוצר זה שילוב תוצאות DNA ליניארי עם vDNAs בקצוות. דנ א פלסמיד Supercoiled (B) נוספה כל שבר שניה #49-55. בעקבות דגירה, שילוב התגובות היו deproteinated, מופרדים על-ידי 1% agarose בג'ל שמכיל EtBr. בקרה שלילית היה הדנ א פלסמיד עם אין חלבונים (T). סמני גודל ה-DNA מוצגים ב- kb. פלסמיד supercoiled (SC), ופעולה מתואמים שילוב מוצרים (CI), חצי-אתרים שילוב מוצרים (מצב HSI) ו- vDNA מצוינים. (ג) agarose ג'ל שנסרק לאיתור הנוכחות של Cy5. רק vDNA, המודיע, ועל מצב HSI מוצרים גלויים. <a href="//ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57453/57453fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57453/57453fig3v2.jpg"> איור 3: כימות של אינטגרציה assay. הג'ל agarose איור 2 סריקה, לכמת לנוכחות של EtBr (א) והן Cy5 (B). (א) לחישוב EtBr, מצב HSI, CI ו- SC הלהקה פיקסל כרכים התקבלו באמצעות ג'ל ניתוח תוכנה. יעילות שילוב מחושב על ידי חלוקת כמות פיקסלים מתואמת שילוב מוצרים (CI) על ידי נפח פיקסל הכוללת של כל שלוש להקות (מצב HSI + CI + SC). לדוגמה, ערכי הפיקסלים ב EtBr ערוץ עבור הלהקות של שבר #49 הם: 110565.2 SC, 25152.56 CI, מצב HSI 6313.04. הערך הכולל של פיקסל הדנ א של שבר #49 הוא הסכום של ערכים אלה, 142030.8. יעילות השילוב הוא אמצעי פיקסל CI של 25152.56 מחולק לפי הערך הכולל DNA 142030.8 שווה 0.18. (B) Cy5 CI הלהקה פיקסל הכרכים מוצגים בגרף היחידות שרירותי. שברים עם פעילות האינטגרציה שיא הן בנפרד aliquoted וקפואים. בדוגמה זו, נבחרו שברים #50-53. Aliquots הם הצמד קפוא עם חנקן נוזלי ומאוחסנים ב-80 הלעפה תרוטרפמט לשימוש עתידי.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57453/57453fig4.jpg"> איור 4: ההשפעה של הקפאה בפעילות intasome. מחצית שניה השבר היה פלאש קפוא עם חנקן נוזלי, המאוחסנים ב-80 הלעפה תרוטרפמט לשעה, ואז לאט לאט הקרת על קרח. החצי הנותר של השבר שניה נשמר על קרח בחדר קר, בעוד המחצית הראשונה היה קפוא, הקרת. Intasomes נבדקו עבור פעילות ללא (-) ועם (+) להקפיא \ הפשרה. שילוב היעילות נמדדה כמתואר לעיל. EtBr (א) צבעונית agarose ג'ל של אינטגרציה התגובה מוצרים. פלסמיד supercoiled (SC), ופעולה מתואמים שילוב מוצרים (CI), חצי-אתרים שילוב מוצרים (מצב HSI) ו- unreacted vDNA מצוינים. סמני גודל ה-DNA מוצגים ב- kb. (B) כימות של יעילות שילוב מהתמונה EtBr. חישובים מתוארים במקרא איור 3 . יש אין אובדן פעילות האינטגרציה לאחר הקפאה והפשרה. היעילות הממוצע אינטגרציה מוצג לניסויים עצמאית 5 עם 2 הכנות intasome. קווי שגיאה מציינות סטיית התקן. ניתוחים-t-test מזווג הניב P דו-זנבי = 0.011, רומז כי ההקפאה/ההפשרה אולי מעט פופולארים פעילות האינטגרציה. <a href="//ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57453/57453fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57453/57453fig5.jpg"> איור 5: תווית השפעות מולקולה והמיקום הרכבה intasome. הרכבות intasome PFV כלל vDNAs שהיו ללא תווית (אדום), סיום עם התווית על 2 Oligo עם Cy5 (כחול), באופן פנימי הנקרא Oligo 1 עם Cy5 (שחור), או סוף המסומנת ב- Oligo 2 ביוטין (כתום). כל ההרכבות הופרדו עם עמודת agarose שניה. ציר ה-y מציין OD של מאו. Chromatograms הם נציג של פחות 2 מכלולים עצמאית של כל סוג intasome. סוף תיוג מפחית את התשואה של נייר PFV intasomes עם Cy5 10-fold, ביוטין 1.8-fold. סוף Cy5, ביוטין להרכבות יש יותר באופן ניכר התמיסה שנותרו לאחר resolubilization מלח גבוהה (שלב 3.5), וכתוצאה מכך איבוד לכאורה של חומר על העמודה אי-הכללה של גודל. תיוג פנימי של vDNA עם fluorophore Cy5 מוביל התשואה שוות של intasomes כמו vDNA ללא תווית. <a href="//ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57453/57453fig5large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrase retroviral רקומביננטי oligomers DNA מחקה מסתיים DNA נגיפי יכול יוצרים קומפלקס פעיל enzymatically המכונה של intasome. Intasomes עשוי לשמש ללימודי הביוכימי, מבניים קינטי. פרוטוקול זה מפרט כיצד להרכיב ולטהר intasomes וירוס קצפית אב-טיפוס.

הרכבה ולטיהור Intasomes וירוס קצפית אב-טיפוס

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

5.4K Views.  The Ohio State University College of Medicine. Integrase retroviral רקומביננטי oligomers DNA מחקה מסתיים DNA נגיפי יכול יוצרים קומפלקס פעיל enzymatically המכונה של intasome. Intasomes עשוי לשמש ללימודי הביוכימי, מבניים קינטי. פרוטוקול זה מפרט כיצד להרכיב ולטהר intasomes וירוס קצפית אב-טיפוס.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

פשוט וחזק In vivo ו במבחנה גישה ללימוד הרכבה וירוס

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

גישת עיבוד מקביל רב היעד לקביעת גנטי למבנה של פולימראז שפעת PB2 מקטע

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum (ER) resident proteins implicated in homotypic fusion of the ER. We detail here a method for purifying a glutathione S-transferase (GST) and poly-histidine tagged Drosophila atlastin by two rounds of affinity chromatography. Studying fusion reactions in vitro requires purified fusion proteins to be inserted into a lipid bilayer. Liposomes are ideal model membranes, as lipid composition and size may be adjusted. To this end, we describe a reconstitution method by detergent removal for Drosophila atlastin into preformed liposomes. While several reconstitution methods are available, reconstitution by detergent removal has several advantages that make it suitable for atlastins and other similar proteins. The advantage of this method includes a high reconstitution yield and correct orientation of the reconstituted protein. This method can be extended to other membrane proteins and for other applications that require proteoliposomes. Additionally, we describe a FRET based lipid mixing assay of proteoliposomes used as a measurement of membrane fusion.

Detergent-assisted Reconstitution of Recombinant Drosophila Atlastin into Liposomes for Lipid-mixing Assays

Biological membrane fusion is catalyzed by specialized fusion proteins. Measuring the fusogenic properties of proteins can be achieved by lipid mixing assays. We present a method for purifying recombinant Drosophila atlastin, a protein that mediates homotypic fusion of the ER, reconstituting it to preformed liposomes, and testing for fusion capacity.

כביסה-החוקה בסיוע מחדש של רקומביננטי דרוזולה אטלסטין ליפוזומים בשביל השומנים

Membrane fusion is a crucial process in the eukaryotic cell. Specialized proteins are necessary to catalyze fusion. Atlastins are endoplasmic reticulum ...

Biochemistry

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

יצירה והרכבה של נוקלאוקפסידים ספציפיים לווירוסים של הנגיף הסינכרוני הנשימתי

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

במבחנה פירוק של וירוס שפעת capsids ידי צנטריפוגה שיפוע

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Advancing High-Resolution Imaging of Virus Assemblies in Liquid and Ice

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It is extremely desirable to pair high-resolution cryo-EM information with dynamic observations as many events occur at rapid timescales - in the millisecond range or faster. Improved knowledge of flexible structures can also assist in the design of novel reagents to combat emerging pathogens, such as SARS-CoV-2. More importantly, viewing biological materials in a fluid environment provides a unique glimpse of their performance in the human body. Presented here are newly developed methods to investigate the nanoscale properties of virus assemblies in liquid and vitreous ice. To accomplish this goal, well-defined samples were used as model systems. Side-by-side comparisons of sample preparation methods and representative structural information are presented. Sub-nanometer features are shown for structures resolved in the range of ~3.5-&#197;-10 &#197;. Other recent results that support this complementary framework include dynamic insights of vaccine candidates and antibody-based therapies imaged in liquid. Overall, these correlative applications advance our ability to visualize molecular dynamics, providing a unique context for their use in human health and disease.

Here protocols are described to prepare virus assemblies suitable for liquid-EM and cryo-EM analysis at the nanoscale using transmission electron microscopy.

קידום הדמיה ברזולוציה גבוהה של מכלולי וירוסים בנוזלים ובקרח

Interest in liquid-electron microscopy (liquid-EM) has skyrocketed in recent years as scientists can now observe real-time processes at the nanoscale. It ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

האיתור וההסרה של נוקלאז זיהום במהלך טיהור של אב טיפוס רקומביננטי קצפית וירוס Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell deformation, division, migration, and adhesion. However, studying the dynamics and structure of the actin network in vivo is complicated by the biochemical and genetic regulation within live cells. To build a minimal model devoid of intracellular biochemical regulation, actin is encapsulated inside giant unilamellar vesicles (GUVs, also called liposomes). The biomimetic liposomes are cell-sized and facilitate a quantitative insight into the mechanical and dynamical properties of the cytoskeleton network, opening a viable route for bottom-up synthetic biology. To generate liposomes for encapsulation, the inverted emulsion method (also referred to as the emulsion transfer method) is utilized, which is one of the most successful techniques for encapsulating complex solutions into liposomes to prepare various cell-mimicking systems. With this method, a mixture of proteins of interest is added to the inner buffer, which is later emulsified in a phospholipid-containing mineral oil solution to form monolayer lipid droplets. The desired liposomes are generated from monolayer lipid droplets crossing a lipid/oil-water interface. This method enables the encapsulation of concentrated actin polymers into the liposomes with desired lipid components, paving the way for in vitro reconstitution of a biomimicking cytoskeleton network.

In Vitro Reconstitution of the Actin Cytoskeleton Inside Giant Unilamellar Vesicles

In this manuscript, we demonstrate the experimental techniques to encapsulate the F-actin cytoskeleton into giant unilamellar lipid vesicles (also called liposomes), and the method to form a cortex-biomimicking F-actin layer at the inner leaflet of the liposome membrane.

במבחנה שחזור של שלד אקטין ציטוסקלטון בתוך שלפוחית אונילמלרית ענקית

The actin cytoskeleton, the principal mechanical machinery in the cell, mediates numerous essential physical cellular activities, including cell ...

Bioengineering

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

הכנה לדוגמה למיקרוסקופיה של כוח אטומי של Virion יחיד והדמיית פלואורסצנטיות ברזולוציה גבוהה במיוחד

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Biology

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

ביטוי וטיהור של חלקיקים דמויי וירוס עבור חיסון

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...