Die Autoren danken Unterstützung von preis FA9550-13-1-0108 von der Air Force Office of Scientific Research der USA. Die Autoren erkennen zusätzlich Unterstützung von preis N00014-15-1-2502 vom Office of Naval Research der USA, aus dem Institut die Finanzierung für kritische Technik und angewandte Wissenschaft an der Virginia Polytechnic Institute und State University und der National Science Foundation Graduierten Fellowship-Programm, Verleihungsnummer 1607310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Die Autoren haben nichts zu offenbaren.

Wir haben für die Anbindung entwickelt lebenden Zellen mit einem funktionalisierten Materialoberfläche eine neue Strategie vorgestellt. Dies wurde durch die Entwicklung einer Zelllinie erreicht der Lage, erhöhte Konzentrationen von Biotin zu synthetisieren, wenn sie mit IPTG induziert. Die erhöhten Mengen an Biotin kann dann verwendet werden, um die funktionalisierte Oberfläche zu modifizieren. Die Protokolle detailliert , wie die E. coli - Zelllinie zu entwickeln und , wie zwei verschiedene funktionalisierte Oberflächen zu schaffen. Kritische Schritte in diesem Protokoll kommen überall in der Konstruktion der konstruierten Zelllinie. Um Downstream - Probleme zu vermeiden, die gentechnisch veränderten Zellstämme mit beiden Wachstumskurven zu charakterisieren (Abbildung 2) und Fluoreszenzantwort (Abbildung 3) gefördert wird . Sollte Verfahrensfragen entstehen, andere molekulare Klonierstrategien, wie PCR Extraktion und Gibson Anordnung 14 kann für die Schritte ersetzt werden gegebenenfalls. Für die Biotin yie Optimierungld der Zelllinie entwickelt, ist es entscheidend, dass eine ausreichende Menge von DTB zu gewährleisten wird den Zellen zur Verfügung gestellt. In unseren Untersuchungen haben wir festgestellt, dass 200 ng / mL DTB eine wesentliche und statistisch signifikante Erhöhung der Biotinproduktion hervorgerufen, wenn die Zellen mit IPTG induziert wurden. Darüber hinaus erfolgreiche Konjugation von BSA-Biotin, SA-HRP und Biotin-HRP ist von entscheidender Bedeutung für die wirksame Durchführung und Überwachung der indirekten und direkten Steuerungsschemata. Achten Sie darauf, unnötige Lichteinwirkung vermieden werden und die Konjugate über Nacht bei 4 ° C inkubiert ein wirksames Konjugat, um sicherzustellen, gebildet wird. Unser Protokoll bietet Vorteile gegenüber alternativen Methoden 15 aufgrund seiner Fähigkeit , kleine Mengen von Biotin zu detektieren , die biologisch von Bedeutung sind (pg / ml - Maßstab) im Vergleich zu handelsüblichen Biotin Nachweiskits, wie solche auf Basis von 4&#39;-Hydroxyazobenzol-2-carbonsäure kompetitiver Bindungsstrategien. Obwohl die Verwendung der Streptavidin-bioZinn - System ist in der Biotechnologie 16, 17, unser System in der Lage ist zu reagieren , um geringe Mengen an Biotin ermöglicht es uns , unsere gemeinsamen direkt gentechnisch veränderten Zelllinie mit der funktionalisierten Oberfläche zu verbinden. Eine mögliche Einschränkung unseres Protokolls ist die resultierende Dynamikbereich von Biotin-Erkennung. Bei den indirekten und direkten Steuerungsschemata, sind wir in der Lage Biotin zwischen 10 2 bis 10 3 und 10 4 -10 6 pg / ml, bzw. (Abbildung 4) zu erkennen. Glücklicherweise erlaubt die geringe Reichweite der indirekten Steuerschema uns leicht Biotin Produktion von gentechnisch veränderten Zellen zu erkennen. Jedoch begrenzt die enge Band der indirekten Kontrolle Dynamikbereich seine Fähigkeit, große Veränderungen (100-fach) in Biotinkonzentrationen zu messen. Die Veränderung der Dynamikbereich sowohl für die indirekte und direkte Steuerungsschemata würden zusätzliche Engineering erfordern. Wenn jedoch Nachweis von zell produzierend Biotin ist ein Problem, Verdünnungen des Biotin Überstand in Schritt Vorbereitung 4.6 sollte der Forscher ermöglichen den dynamischen Bereich der indirekten Steuerschema zu zielen (Abbildung 5). Wir fanden, dass eine 1: 5-Verdünnung des Überstandes erlaubt uns effektiv die indirekten Steuerschema der dynamischen Bereich zu zielen. Diese Verdünnung Strategie sollte die Notwendigkeit, zu lindern, den Dynamikbereich direkt zu ändern. Die zweiteilige, Zellstoffsystem hier vorgestellten ermöglicht Zellen entwickelt, um die Zusammensetzung einer funktionalisierten Oberfläche zu modifizieren. Dynamische, lebende Zellen können ihre chemische Umgebung interpretieren eine genetische Reaktion zu erzeugen. Von Engineering diese genetische Reaktion Biotinproduktion zu erhöhen, können wir engineered lebenden Zellen mit der Fähigkeit auszustatten, eine funktionalisierte Oberfläche zu steuern und zu manipulieren. Indem Sie die Protokolle vorgestellt, sind gentechnisch veränderten Zellen können als dynamische Sensoren, in der Lage zu lesen, die Verarbeitung zu handeln, und die Aufzeichnung der Bedingungen rund um them über funktionalisierte Schnittstellen. Diese Technologie könnte Felder aus der molekularen Medizin Analytennachweisregion für Umweltsanierung im Bereich auswirken.

Hier berichten wir über die Verfahren für eine programmierbare Substrat zu entwickeln, das von einer konstruierten Zelllinie ein chemisches Signal reagiert. 1 Wir tun dies durch eine Biotin-Streptavidin - Schnittstelle zu schaffen, die von synthetisch engineered Escherichia coli (E. coli) Zellen erzeugt an Biotin reagiert. Zuvor programmierbare Oberflächen wurden für eine Vielzahl von Anwendungen von Toxinnachweis 2 und Point-of-Care - Diagnostik 3 Verteidigung und Sicherheit entwickelt. 4 Während programmierbare Oberflächen können nützlich als Sensoren und Aktoren sein, können sie gemacht &quot;intelligenter&quot; werden , indem sie mit der Fähigkeit zur Anpassung an verschiedene Umweltprobleme ausstatten. Im Gegensatz dazu sogar einfache Mikroorganismen, wie E. coli, weisen inhärente Anpassungsfähigkeit und sind in der Lage Challenges mit ausgeklügelter und oft unerwartete Lösungen reagieren. Diese Anpassungsfähigkeit ermöglicht hat E.coli - Populationen durch ihre komplexe Gen - Netzwerke gesteuert, kosteneffektiv Ressourcen suchen, 5 Mehrwert-Produkte erstellen, 6 und sogar Strommikromaßstab Robotik. 7 Durch die Kopplung der adaptive Vorteile von Zellen mit der Verwendung von programmierbaren Oberflächen leben, können wir ein Smart Substrat fähig der Reaktion auf unterschiedliche Umweltbedingungen zu schaffen. Synthetische Biologie hat sich die Forscher neue Fähigkeiten gegeben, das Verhalten von Lebewesen zu programmieren. Durch Zellen Engineering neue Gen regulatorische Netzwerke enthalten, können die Forscher Zellen entwickeln, die eine Reihe von programmierten Verhalten zeigen. 8, 9 Jenseits der Grundlagenforschung, diese Verhaltensweisen für Anwendungen wie Material Montage Steuern und biologisch produzierenden Mehrwert-Produkte werden können. 10 Hierin wir ausführlich , wie wir die Werkzeuge der synthetischen Biologie verwendet , um eningenieur ein E. coli - Stamm, der Biotin bei Induktion synthetisiert. Dieser Stamm wurde unter Verwendung von Restriktionsenzym-Klonierungsverfahren entwickelt ein Plasmid, pKE1-lacI-bioB zu montieren. Dieses Plasmid, wenn es in E. coli - Stamm K-12 MG1655 transformiert, ausstattet Zellen mit der Fähigkeit , erhöhte Mengen an bioB, ein essentielles Enzym für die Biotin - Synthese zu exprimieren. Wenn transformierte Zellen mit Isopropyl-β-D-1-thiogalactopyranosid (IPTG) und mit einem Biotin-Vorläufer Desthiobiotin (DTB) induziert wurden, wurden erhöhte Spiegel an Biotin hergestellt. Biotin der Bindungs-Wechselwirkung mit Streptavidin ist einer der stärksten nicht-kovalenten Bindungen in der Natur gefunden. Als solches ist das Biotin-Streptavidin-Wechselwirkung sowohl gut charakterisiertes und hoch in der Biotechnologie eingesetzt. 11 In diesem Manuskript, stellen wir zwei Strategien , um die Biotin-Streptavidin - Wechselwirkung unter Verwendung von zell hergestellt Biotin mit einer funktionalisierten Oberfläche zu erfassen und zu erkennen. Wirbeziehen sich auf diese kontrastierenden Oberflächen als &quot;indirekte&quot; und &quot;direkt&quot; Steuerungsschemata. Bei der indirekten Steuerschema, Zelle produzierte Biotin konkurriert mit Biotin, die für Streptavidin-Bindungsstellen auf einer Polystyroloberfläche konjugiert und immobilisiert wurde. Zusätzlich wird das Streptavidin mit Meerrettich-Peroxidase (HRP) konjugiert. HRP modifiziert 3, 3 &#39;, 5, 5&#39;-Tetramethylbenzidin (TMB), ein optisches Signal 12 zu erzeugen , die durch Quantifizierung der spektralen Extinktion (dh, optische Dichte) bei 450 nm (OD 450) überwacht werden kann. Somit erlaubt die indirekte Steuerschema Forscher durch die Überwachung der Abschwächung des OD 450 Signalzelle produzierten Biotin zu messen. Die direkte Steuerungsschema nutzt die Streptavidin-Biotin-Ereignis durch Streptavidin direkt auf eine Materialoberfläche zu immobilisieren und ermöglicht Zelle produzierten Biotin und biotinylierte HRP für Streptavidin-Bindungsstellen zu konkurrieren. Wiederum ist dasrelativen Mengen an zell erzeugt Biotin sind durch Messen einer OD 450 - Signal überwacht. Zusammengenommen sind die gentechnisch veränderten Zellen und funktionalisierten Oberflächen erlauben, die Eigenschaften eines programmierbaren Oberfläche zu steuern, indem Netzwerke in lebenden Zellen zu induzieren. Mit anderen Worten, haben wir ein System geschaffen, das gemeinsam durch die Verknüpfung dieser Systeme Vorteil der Anpassungsfähigkeit von lebenden Organismen und die Zuverlässigkeit und die Spezifikation einer engineered Materialgrenzfläche stattfindet.

<table><tbody><tr><td>LB Broth, Miller&amp;nbsp;</td><td>Fisher Scientific</td><td>12-795-027</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP9744500</td><td></td></tr><tr><td>Carbenicillin&amp;nbsp;</td><td>Fisher Scientific</td><td>BP26481</td><td></td></tr><tr><td>M9, Minimimal Salts, 5x</td><td>Sigma-Aldrich</td><td>M6030</td><td></td></tr><tr><td>Casamino Acids&amp;nbsp;</td><td>Fisher Scientific</td><td>BP1424-100</td><td></td></tr><tr><td>Magnesium Sulfate, Anhydrous</td><td>Fisher Scientific</td><td>M65-500</td><td></td></tr><tr><td>Calcium Chloride, Dihydrate</td><td>Fisher Scientific</td><td>C79-500</td><td></td></tr><tr><td>Dextrose (D-Glucose), Anhydrous</td><td>Fisher Scientific</td><td>D16-1</td><td></td></tr><tr><td>NEB Turbo Cell Line</td><td>New England Biolabs</td><td>C2984l</td><td></td></tr><tr><td>Oligonucleotide Primers</td><td>Thermo Fisher Scientific</td><td>N/A</td><td>25N synthesis, DSL purification</td></tr><tr><td>Q5 High-Fidelity Polymerase</td><td>New England Biolabs</td><td>M0491S</td><td></td></tr><tr><td>Q5 Reaction Buffer</td><td>New England Biolabs</td><td>B9027S</td><td></td></tr><tr><td>dNTP Solution Mix</td><td>New England Biolabs</td><td>N0447S</td><td></td></tr><tr><td>Agarose</td><td>Bioexpress</td><td>E-3120-125</td><td></td></tr><tr><td>Ethidium Bromide, 1%</td><td>Fisher Scientific</td><td>BP1302-10</td><td></td></tr><tr><td>Gel Extraction Kits</td><td>Epoch Biolabs</td><td>2260250</td><td></td></tr><tr><td>GenCatch Plasmid DNA Miniprep Kit</td><td>Epoch Biolabs</td><td>2160250</td><td></td></tr><tr><td>AatII</td><td>New England Biolabs</td><td>R0117S</td><td></td></tr><tr><td>SacII</td><td>New England Biolabs</td><td>R0157S</td><td></td></tr><tr><td>HindIII-HF</td><td>New England Biolabs</td><td>R3104S</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England Biolabs</td><td>R3101S</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T4 DNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0202S</td><td></td></tr><tr><td>ColiRolle Glass Plating Beads&amp;nbsp;</td><td>EMD Millipore</td><td>7101-3</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-1</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher Scientific</td><td>BP1755-10</td><td></td></tr><tr><td>NHS-Desthiobiotin (DTB)</td><td>Thermo Fisher Scientific</td><td>16129</td><td></td></tr><tr><td>Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1534</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)&amp;nbsp;</td><td>Fisher Scientific</td><td>BP231-100</td><td></td></tr><tr><td>Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1531</td><td></td></tr><tr><td>NHS-LC-LC-biotin</td><td>Thermo Fisher Scientific</td><td>21343</td><td></td></tr><tr><td>Horseradish Peroxidase (HRP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>31490</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 10x Solution</td><td>Fisher Scientific</td><td>BP399500</td><td></td></tr><tr><td>Streptavidin (SA)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>21145</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-100</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher Scientific</td><td>BP172-5</td><td></td></tr><tr><td>Ethylenediaminetetaacetic acid (EDTA)&amp;nbsp;</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Tween 80&amp;nbsp;</td><td>Fisher Scientific</td><td>T164-500</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Fisher Scientific</td><td>H325-4</td><td></td></tr><tr><td>3, 3&#039;, 5, 5&#039;-tetramethylbenzidine (TMB)</td><td>Fisher Scientific</td><td>AC229280050</td><td></td></tr><tr><td>Vivaspin 500 Centrifugal Concentrators&amp;nbsp;</td><td>Viva Products</td><td>VS0192</td><td></td></tr><tr><td>Sodium Acetate, Anhydrous</td><td>Fisher Scientific</td><td>BP333-500</td><td></td></tr><tr><td>96-Well Polystyrene Plates</td><td>Thermo Fisher Scientific</td><td>266120</td><td></td></tr></tbody></table>

using synthetic biology to engineer living cells that interface with programmable materials

Wir haben einen abiotischen-biotischen Schnittstelle entwickelt, die gentechnisch veränderten Zellen erlaubt es, die Materialeigenschaften eines funktionalisierten Oberfläche zu steuern. Eine synthetisch konstruierte Stamm von E. coli Zellen und eine funktionalisierte Materialoberfläche: Dieses System wird durch die Schaffung von zwei Modulen. Innerhalb dieses Papier wir detailliert ein Protokoll für die gentechnische Veränderung von ausgewählten Verhalten in einem Stamm von E. coli unter Verwendung von molekularem Klonierungsstrategien. Einmal entwickelt, produziert dieser Stamm erhöhte Mengen an Biotin, wenn sie einer chemischen Induktors ausgesetzt. Zusätzlich wir detaillierter Protokolle zur Schaffung von zwei unterschiedlichen funktionalisierten Oberflächen, von denen jede Lage zu Zelle synthetisierte Biotin zu reagieren. Zusammengenommen stellen wir eine Methodik ein verknüpftes, abiotische-biotische System für die Erstellung, die Zellen zu steuern, Materialzusammensetzung und die Montage auf nicht lebenden Substraten entwickelt, ermöglicht.

Repräsentative Ergebnisse sind in den beigefügten fünf Figuren dargestellt. Zunächst stellen wir die Klonprozess grafisch (Abbildung 1) , so dass der Leser visuell die entscheidenden Schritte für die Erstellung der synthetisch konstruierte E. coli - Stamm folgen kann. Um die Populationsdynamik der Zellen zu kennzeichnen, stellen wir eine Wachstumskurve (Figur 2) erzeugt , indem die optische Dichte bei 600 nm (OD 600) der Population zu messen. Dann zeigen wir , wie das regulatorische Gen - Netzwerk überprüft wird, unter Verwendung von mCherry als Proxy für bioB (Abbildung 3), so dass wir die optisch an die relative Menge an bioB messen , die von der Zelle nach Induktion mit IPTG erzeugt werden würde. Als nächstes stellen wir Antwortdaten für die indirekte Steuerung und Direktsteuerung funktionalisierten Oberflächen. Diese Diagramme (Abbildung 4) wurden unter Verwendung von gemessenen Lösungen von freiem entwickeltBiotin die funktionalisierten Oberflächen &quot;Reaktionsprofile zu charakterisieren. Schließlich stellen wir Kenndaten zeigt , wie die gentechnisch veränderten Zellen werden induziert , an Biotin (Abbildung 5) zu erzeugen, wodurch die funktionalisierten Oberflächen zu modifizieren. <img alt="Abbildung 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Abbildung 1: Planung und Bau von induzierbare, manipulierten Zellen. (A) Die Primer wurden entworfen , um die bioB - Gen aus dem E. coli Genom zu isolieren, die in der Biotin - Synthesewegs eine entscheidende Enzym kodiert. (B) Die P L, tetO-1 -lacI und P trc-2 - Sequenzen von einem Plasmid isoliert werden , um einen genetischen Schalter mit entsprechenden Primern enthält. (C) Das extrahierte bioB - Gen und die beiden Fragmente aus dem Kippschalter kann dann verwendet werden , um das Gen Schaltung zu schaffen. Die Zugabe von IPTG kann dann indUCE die Expression von bioB und dadurch Biotinsynthese wenn DTB als Substrat für bioB hinzugefügt wird. (D) Das zusammengesetzte Plasmid in K-12 MG1655 E. coli transformiert wurde. Dies verursacht die Anwesenheit von IPTG die Expression von bioB zu induzieren und dadurch Biotin - Synthese durch die engineered Zellinie wenn DTB als Substrat bereitgestellt wurde. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Abbildung 2: Wachstumskurven für gentechnisch veränderten Zellen. Die gentechnisch induzierbare MG1655 Wildtyp - Zellen wurden in Minimalmedien (dh Biotin freien M9 - Medien) sowie Minimalmedium , supplementiert mit DTB (200 ng / ml) und / oder IPTG (0,5 mM) gezüchtet und überwacht. Die Diagramme zeigen die OD 600 lesen, gemessen alle 5 mi<html> n für 24 h. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> Abbildung 3: Testen des Engineered Gen - Netzwerk. Das fluoreszierende Protein mCherry wurde anstelle von der verwendeten bioB Gen , so dass wir optisch die Induktionsprofil messen konnte , wenn gentechnisch veränderten Zellen mit IPTG induziert wurden. Wir Kontrast, die mit IPTG (rote Rhomben) induzierten Zellen mit den Zellen nicht mit IPTG (blaue Rauten) induziert. Diese Ergebnisse zeigen die Wirksamkeit des induzierbaren Gen-Netzwerk. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> /55300/55300fig4.jpg &quot;/&gt; Abbildung 4: Überprüfung der Funktionalisierte - Material - Schnittstelle. Durch Aussetzen unserer funktionalisierten Oberflächenkonzentrationen von Biotin variiert, sind wir in der Lage , die optische Reaktion zu messen , indem OD 450 Absorption zu messen. Diese Ergebnisse ermöglichen es uns, eine Kalibrierungskurve zu erzeugen, die Verknüpfung, die Konzentration von Biotin an die optische Intensität der Antwort. Hier präsentieren wir die Biotin gegenüber dem optischen Signalkurven für die beiden indirekten (links) und direkte (rechts) funktionalisierten Oberfläche Schemata. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> Abbildung 5: manipulierte Zellen Kontrollmaterial Schnittstelle. Durch die Verwendung von Protokollabschnitte 5 oder 6, sind wir in der Lage, die Produkte von induzierten, engineered c zu verwenden,ells chemisch die funktionalisierte Oberfläche zu modifizieren. Wir können diese Antworten überwachen optisch von 450 OD Messung. Ferner kann durch die Kalibrierungskurve in Abbildung entwickelt unter Verwendung von 4, kann man die optische Intensität der Reaktion auf das Biotin innerhalb des Konzentrations verbinden. Wir stellen Ihnen hier die verschiedenen Biotin-Konzentrationen, die von unserer indirekten Steuerschema funktionalisierten Oberfläche gemessen, für Wildtyp-Zellen (weiß), nicht-induzierten Zellen, die die pKE1-lacI-bioB Plasmid (orange) enthält, und induzierten Zellen mit dem pKE1-lacI-bioB Plasmid (grau). <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Chemisch </td><td> Endkonzentration </td><td> Menge </td></tr><tr><td> 5x M9-Salze </td><td> 1x </td><td> 20 ml </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 mM </td><td> 200 ul </td></tr><tr><td> 1 M CaCl 2 </td><td> 0,1 mM </td><td> 10 &amp; mgr; l </td></tr><tr><td> 20% Glucose </td><td> 0,40% </td><td> 2 mL </td></tr><tr><td> 2% Biotin freie Casaminosäuren </td><td> 0,02% </td><td> 1 ml </td></tr><tr><td> DI-Wasser </td><td> N / A </td><td> 76,8 ml </td></tr></tbody></table> Tabelle 1: M9 Medien Rezept. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td colspan="2"> Primer - Sequenz </td><td> Verwendung </td></tr><tr><td> 1-f </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> lacI Kassettenentnahme </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> lacI Kassettenentnahme </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P trc-2 - Extraktion </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P trc-2 - Extraktion </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> bioB Extraktion </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> bioB Extraktion </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Synthetische RBS zusätzlich </td></tr></tbody></table> Tabelle 2: Liste der Grundierungen. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Schritt 1 </td><td> Schritt 2 </td><td> Schritt 3 </td><td> Schritt 4 </td><td> Schritt 5 </td><td> Schritt 6 </td><td> Schritt 7 </td><td> Schritt 8 </td><td> Schritt 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 0.30 </td><td> 00.10 </td><td> 0.30 </td><td> 01: 00 / kb </td><td> 00.10 </td><td> 0.30 </td><td> 01: 00 / kb </td><td> 02.00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> 12 mal wiederholen, </td><td colspan="3" rowspan="2"> Wiederholen 25mal </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / Zyklus </td></tr></tbody></table>Tabelle 3: PCR - Programm. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td> Volumen </td></tr><tr><td> Zelllysat (template) </td><td> 10 &amp; mgr; l </td></tr><tr><td> Primer (je) </td><td> 0.625 &amp; mgr; l (je) </td></tr><tr><td> 5x Q5 Puffer </td><td> 5 ul </td></tr><tr><td> Q5 Polymerase </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> dNTP Mix </td><td> 0,5 ul </td></tr><tr><td> DI-Wasser </td><td> 6,75 &amp; mgr; l </td></tr></tbody></table> Tabelle 4: Ganzzellen - PCR - Reaktion (25 &amp; mgr; l). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td> Volumen </td></tr><tr><td> 10x Reaktionspuffer </td><td> 5 ul </td></tr><tr><td> Enzyme 1 </td><td> 1 ul </td></tr><tr><td> Enzyme 2 </td><td> 1 ul </td></tr><tr><td> Template-DNA </td><td> 1 &amp; mgr; g </td></tr><tr><td> DI-Wasser </td><td> 43 &amp; mgr; l - Volumen von DNA </td></tr></tbody></table> Tabelle 5: Restriktionsenzymverdau Reaktion (50 &amp; mgr; l). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td> Volumen </td></tr><tr><td> DNA </td><td> 50 ug Vektor + X ug Insert </td></tr><tr><td> 10fach Ligasepuffer </td><td> 1 ul </td></tr><tr><td> T4 Ligase </td><td> 1 ul </td></tr><tr><td> DI-Wasser </td><td> 8 &amp; mgr; l - Volumen von DNA </td></tr></tbody></table>Tabelle 6: Ligatur Reaktion (10 &amp; mgr; l). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td> Konzentration </td><td> Notizen </td></tr><tr><td> CaCl 2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / ml (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 ug / ml </td><td></td></tr><tr><td> IPTG </td><td> 0,5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / mL </td><td> 2 mg in 100 ul DMSO </td></tr><tr><td> SPDP </td><td> 20 mg / mL </td><td> 2 mg in 100 ul DMSO </td></tr><tr><td> LC-LC-Biotin </td><td> 20 mg / mL </td><td> 2 mg in 100 ul DMSO </td></tr><tr><td> HRP </td><td> 10 mg / mL </td><td> in PBS </td></tr><tr><td> SA (indirekt) </td><td> 10 mg / mL </td><td> in PBS </td></tr><tr><td> SA (direkt) </td><td> 0,17 &amp; mgr; g / mL </td><td> in PBS </td></tr><tr><td> BSA </td><td> 20 mg / mL </td><td> in PBS </td></tr><tr><td> DTT </td><td> 100 mM </td><td> In DI-Wasser </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 18,6 mg in 10 ml PBS </td></tr><tr><td> Kasein </td><td> 0,50% </td><td> in PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> In DI-Wasser </td></tr><tr><td> Tween 80 in PBS </td><td> 0,05% </td><td></td></tr><tr><td> Natriumacetat </td><td> 50 mM </td><td> In DI Wasser, einstellen auf 5,1 pH mit 3 M HCl </td></tr><tr><td> TMB </td><td> 1% </td><td> in DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> In DI-Wasser </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> In DI-Wasser </td></tr></tbody></table>Tabelle 7: Liste der Reagenzlösungen.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Dieser Beitrag stellt eine Reihe von Protokollen für die gentechnisch veränderten Zellen entwickeln und funktionalisierte Oberflächen , die synthetisch konstruierte E. coli steuern können , und programmierbare Materialoberflächen zu manipulieren.

Unter Verwendung der synthetischen Biologie lebenden Zellen zu entwickeln, die Schnittstelle mit programmierbarer Materialien

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

8.8K Aufrufe.  Carnegie Mellon University.  Dieser Beitrag stellt eine Reihe von Protokollen für die gentechnisch veränderten Zellen entwickeln und funktionalisierte Oberflächen , die synthetisch konstruierte E. coli steuern können , und programmierbare Materialoberflächen zu manipulieren. 

Serie: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Bridging the Bio-elektronische Schnittstelle mit Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Forschung

Biotechnik

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the importance of 3-dimensional (3D) cellular assemblies in these fields. Artificial scaffolds have often been used to construct 3D cellular assemblies. However, the scaffolds used to construct cellular assemblies are sometimes toxic and may change the properties of the cells. Thus, it would be beneficial to establish a non-toxic method for facilitating cell-cell contact. In this paper, we introduce a novel method for constructing stable cellular assemblies by using optical tweezers with dextran. One of the advantages of this method is that it establishes stable cell-to-cell contact within a few minutes. This new method allows the construction of 3D cellular assemblies in a natural hydrophilic polymer and is expected to be useful for constructing next-generation 3D single-cell assemblies in the fields of regenerative medicine and tissue engineering.

We demonstrate a novel method for constructing a single-cell-based 3-dimensional (3D) assembly without an artificial scaffold.

Bearbeiten von lebenden Zellen, stabile zelluläre 3D-Baugruppe ohne künstlichen Gerüst zu bauen

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the ...

Biochemie

Engineering Intracellular Protein Sensors in Mammalian Cells

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells to sense and respond to these biomarkers may help the understanding of molecular mechanisms underlying pathologies, as well as to develop new cell-based therapies. While several systems that detect extracellular proteins have been developed, a modular framework that can be easily re-engineered to sense different intracellular proteins was missing.
Here, we describe a protocol to implement a modular genetic platform that senses intracellular proteins and activates a specific cellular response. The device operates on intracellular antibodies or small peptides to sense with high specificity the protein of interest, triggering the transcriptional activation of output genes, through a TEV protease (TEVp)-based actuation module. TEVp is a viral protease that selectively cleaves short cognate peptides and is widely used in biotechnology and synthetic biology for its high orthogonality to the cleavage site. Specifically, we engineered devices that recognize and respond to protein-biomarkers of viral infections and genetic diseases, including mutated huntingtin, NS3 serine-protease, Tat and Nef proteins to detect Huntington&#8217;s disease, hepatitis C virus (HCV) and human immunodeficiency virus (HIV) infections, respectively. Importantly, the system can be hand tailored for the desired input-output functional outcome, such as fluorescent readouts for biosensors, stimulation of antigen presentation for immune response, or initiation of apoptosis to eliminate unhealthy cells.

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general architecture.

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells ...

Genetik

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Automatisierte Roboter Liquid Handling Versammlung Modular DNA-Geräte

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

Funktionale Oberfläche-Immobilisierung von Genen mit mehrstufigen Strang Verschiebung Lithographie

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

Eine multilayer mikrofluidische Plattform für die Leitung einer längeren zellfreien Genexpression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

Herstellung von Proteinproduktion synthetischer Zellen mit zellfreien bakteriellen Extrakten, Liposomen und Emulsionstransfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

Simple, Affordable, and Modular Patterning of Cells using DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells of the same or different type, micropatterning techniques have proved useful. DNA Programmed Assembly of Cells (DPAC) is a micropatterning technique that targets the adhesion of cells to a substrate or other cells using DNA hybridization. The most basic operations in DPAC begin with decorating cell membranes with lipid-modified oligonucleotides, then flowing them over a substrate that has been patterned with complementary DNA sequences. Cells adhere selectively to the substrate only where they find a complementary DNA sequence. Non-adherent cells are washed away, revealing a pattern of adherent cells. Additional operations include further rounds of cell-substrate or cell-cell adhesion, as well as transferring the patterns formed by DPAC to an embedding hydrogel for long-term culture. Previously, methods for patterning oligonucleotides on surfaces and decorating cells with DNA sequences required specialized equipment and custom DNA synthesis, respectively. We report an updated version of the protocol, utilizing an inexpensive benchtop photolithography setup and commercially available cholesterol modified oligonucleotides (CMOs) deployed using a modular format. CMO-labeled cells adhere with high efficiency to DNA-patterned substrates. This approach can be used to pattern multiple cell types at once with high precision and to create arrays of microtissues embedded within an extracellular matrix. Advantages of this method include its high resolution, ability to embed cells into a three-dimensional microenvironment without disrupting the micropattern, and flexibility in patterning any cell type.

Here we present a protocol to micropattern cells at single-cell resolution using DNA-programmed adhesion. This protocol uses a benchtop photolithography platform to create patterns of DNA oligonucleotides on a glass slide and then labels cell membranes with commercially available complementary oligonucleotides. Hybridization of the oligos results in programmed cell adhesion.

Einfache, erschwingliche und modulare Musterung von Zellen mit DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells ...

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Schnelle Charakterisierung genetischer Teile mit zellfreien Systemen

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Protokolle für die Implementierung einer<em&gt; Escherichia coli</em&gt; Basierend TX-TL Zellfreie Expression System für Synthetische Biologie

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...