Name: inducible and reversible dominant-negative (dn) protein inhibition
Uploaded: 2019-01-07T14:00:00.000+00:00
Duration: 8 min 35 s
Description: Watch this Scientific Journal Video about Inducible and Reversible Dominant-negative DN Protein Inhibition at JoVE.com

The pCS2+CB-Myc6 vector was a gift from Marshall Horwitz (University of Washington, Seattle, WA, USA). The HEI-OC1 cells were kindly provided by Fedrico Kalinec (David Geffen School of Medicine, UCLA, Los Angeles, CA, USA). Technical support was provided by the UNMC Mouse Genome Engineering Core (C.B. Gurumurthy, Don Harms, Rolen Quadros) and the Creighton University Integrated Biomedical Imaging Facility (Richard Hallworth, John Billheimer). The UNMC Mouse Genome Engineering was supported by an Institutional Development Award (IDea) from the NIH/NIGMS, grant number P20 GM103471. The Integrated Biomedical Imaging Facility was supported by the Creighton University School of Medicine and grants GM103427 and GM110768 from the NIH/NIGMS. The facility was constructed with support from grants from the National Center for Research Resources (RR016469) and the NIGMS (GM103427). The mouse lines generated in this study were maintained at Creighton University's Animal Resource Facility, whose infrastructure was improved through a grant by NIH/NCRR G20RR024001. This work received past support through an NIH/NCRR 5P20RR018788-/NIH/NIGMS 8P20GM103471 COBRE grant (to Shelley D. Smith), NIH/ORIP R21OD019745-01A1 (S.M.R.-S.), and an emerging research grant from the Hearing Health Foundation (to S. Tarang). The content of this research is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Generation of the transgenic CBRb mouse and all animal care and experiments associated with the study were approved by the Creighton University Institutional Animal Care and Use Committee (IACUC) and performed by their guidelines.
1. Transgenic CB-Myc6-Rb1 Construct
NOTE: The cloning of CBRb into a pTet_Splice vector was done in a multi-step process (Figure&#160;1A and 1B).
<ol>
	<li>Perform the first stage cloning into the pCS2+CB-Myc6 vector.
	<ol>
		<li>To create the CBRb transgene construct, amplify a 1583-bp-long Rb1 cDNA fragment (528 amino acids corresponding to the amino acid region 369&#8211;896) of the RB1 protein using the following primer set: for EcoRI+RB 1243F, use GGGGAATTCATTAAATTCAGCAAGTGATCAACCTTC, and for XbaI+EcoRV+RB 2826R, use CCCTCTAGATATCTATTTGGACTCTCCTGGGAGATGTTTACTTCC.</li>
		<li>Clone the fragment generated (1546 bp) between the EcoR1 and XbaI restriction sites of the pCS2+CB-Myc6 vector as previously described1,12. 
		NOTE: The 1012-bp-long CB-Myc6 construct (337 amino acids) fused to the Rb1 fragment resulted in a protein of approximately 865 amino acids (about 108 kDa), which is slightly smaller than the endogenous RB1 protein (~110 kDa) (Figure 1A), with a CB-Myc6 tag at the N-terminus and Rb1 at the C-terminus.</li>
	</ol>
	</li>
	<li>Perform the second stage subcloning into the pTet-Splice vector.
	<ol>
		<li>To amplify the CB-RB-Myc6 fusion fragment and to gain the Tet-promoter, amplify the cassette, consisting of the CB-myc6-Rb1 using primers containing the EcoRV (XbaI+EcoRV+RB 2826R) and SalI sites: for SalI+CBF, use CCAGTCGACAGGATGTGGTGGTCCTTGATCCTTC.</li>
		<li>Subclone the fragment generated (2567 bp) into the pTet-Splice vector, between the SalI and EcoRV restriction sites, in such a way that the entire TetO-DN-CB-myc6-Rb1 transgene, including the SV40 intron and the PolyA signal, can be isolated through a single digestion with NotI (Figure 1B). 
		NOTE: The NotI fragment was used to generate the transgenic funders.</li>
	</ol>
	</li>
</ol>
2. In Vitro Testing of the TetO-DN-CB-myc6-Rb1 Transgene
<ol>
	<li>Dox-regulation: NIH3T3 cell line 
	NOTE: Unless otherwise stated, all volumes have been adjusted for a 6-well plate.
	<ol>
		<li>Grow NIH3T3 cells following the vendor&#39;s specifications, using the recommended cell culture media containing 10% fetal bovine serum at 37 &#176;C with 10% CO2.</li>
		<li>Cotransfect the cells with pTet-Splice and pCMV-Tet3G vectors (from step 1) for 24 h. Follow the steps mentioned below for cotransfection.
		<ol>
			<li>Mix 2&#8211;4 &#181;L of the lipid-based transfection reagent/well and 1 mL of incomplete (without serum) Dulbecco&#39;s Modified Eagle Medium (DMEM) for 5 min at room temperature. For a 12- or 24-well plate, use 250 or 500 &#181;L of culture media, respectively, and adjust the transfection reagent volume accordingly.</li>
			<li>Add 2&#8211;3 &#181;g of plasmid DNA/well to the transfection reagent-DMEM and incubate for 20 min at room temperature.</li>
			<li>Add the mix containing DNA and the transfection reagent in DMEM to each well. After 3&#8211;4 h of incubation, add 1 mL of complete media (so that the final volume is 2 mL/well). Keep aliquots of Dox stock (1 mg/mL) and add 2 &#181;L in each of the wells (+ Dox). Incubate the cells at 37 &#176;C with 5% CO2. 
			NOTE: Control samples should consist of cotransfected cells not treated with Dox (- Dox), as well as NIH3T3 cells transfected only with the transactivator pCMV-Tet3G vector and treated with Dox for a 24 h period. For pCMV-Tet3G, concentrations of 0.1&#8211;1 &#181;g/mL Dox should be sufficient to induce the transgene expression.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Test the reversibility of the construct using the HEK293 cell line.
	<ol>
		<li>To test the reversibility of the TetO-DN-CB-myc6-Rb1 transgene, culture HEK293 cells in Eagle&#39;s Minimum Essential Medium (EMEM) following the vendor&#39;s specifications and cotransfect with both pTet-Splice and pCMV-Tet3G vectors for 24 h, as described above (step 2.1.2).</li>
		<li>For the transgene inactivation, remove the Dox-containing media after 24 h, wash the cells 2x&#8211;3x with phosphate buffered saline (PBS) and incubate them in Dox-free media for an additional 24 h. 
		NOTE: Upon Dox-removal, the transgene inactivation and regular protein expression should be resumed within that 24 h period.</li>
	</ol>
	</li>
	<li>To assess the functionality of the TetO-DN-CB-myc6-Rb1 construct in promoting unscheduled cell proliferation, perform the functional analyses using an HEI-OC1 cell line, as described below.
	<ol>
		<li>Culture HEI-OC1 cells in 10% DMEM under permissive conditions (33 &#176;C with 10% CO2). For cell proliferation studies, count the cells using a cell counter, and plate 10,000 HEI-OC1 cells on a 96-well plate in a 200 &#181;L volume. Incubate the cells overnight.</li>
		<li>On the following day, perform a transient cotransfection of pTet-Splice and pCMV-Tet3G vectors using a lipid-based transfection reagent (see steps 2.1.2). In a separate well, perform pmR-ZsGreen1 transfection at2-&#181;g using the lipid-based transfection reagent (steps 2.1.2) to calculate the transfection rate. Use non-transfected cells as controls.</li>
		<li>Detect the presence of green fluorescence under a fluorescence microscope (excitation = 485 nm, emission = 530 nm) for the transfected cells 24 h after transfection. Record the presence or absence of green fluorescence and calculate the rate of transfection as the total number of GFP-positive cells (transfected cells) over the cells labeled with DAPI (total cells). 
		NOTE: We estimated a transfection rate of ~70%.</li>
		<li>To induce transgene expression, add 1 &#181;g/mL Dox to a subset of transfected cells while using the other subset as control (-Dox). Use untreated HEI-OC1 cells as additional controls.</li>
		<li>To assess cell proliferation, use a cell proliferation kit according to the manufacturer&#39;s protocol.
		<ol>
			<li>In brief, 48 h after transfection, remove the cell culture medium and add 100 &#181;L of 1x dye-binding solution to each well of the microplate. Incubate for 1 h at 37 &#176;C.</li>
			<li>Thereafter, measure the fluorescence intensity of each sample using a fluorescence microplate reader (excitation = 485 nm, emission = 530 nm).</li>
		</ol>
		</li>
		<li>To further assess cell proliferation using immunocytochemistry, plate the HEI-OC1 cells on a cover glass in a 12-well plate and incubate overnight at 37 &#176;C.
		<ol>
			<li>On the following day, cotransfect with the pTet-Splice and pCMV-Tet3G and perform the Dox treatment (+ Dox). Use untransfected cells as controls. Process HEI-OC1 cells for Ki-67 labeling.</li>
			<li>Fix the cells with 4% paraformaldehyde (PFA) in PBS, pH 7.4, for 10 min at room temperature. Wash the cells 3x with ice-cold PBS and incubate the cells in 0.25% non-ionic detergent in PBS for 10 min.</li>
			<li>Wash the cells again, 3x in PBS for 5 min, and block using 10% serum in a humidified chamber for 1 h at room temperature.</li>
			<li>Incubate the cells in 500 &#181;L of Ki-67 primary antibody (1:200 dilution) for 3 h at room temperature or overnight at 4 &#176;C.</li>
			<li>Wash the cells 3x for 5 min with PBS. After that, incubate the cells with the secondary antibody for 1 h at room temperature in the dark.</li>
			<li>Remove the secondary antibody solution and wash the cells 3x with PBS for 5 min each in the dark.</li>
			<li>For phalloidin labeling, incubate the HEI-OC1 cells in 1:200 phalloidin for 30 min. To label the nuclei of cells, incubate the cells with 5 &#181;g/mL DAPI for 10 min at room temperature. 
			NOTE: Ensure that the phalloidin dye conjugate is different than the secondary antibody conjugate.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
3. Generation of CBRb+/ROSA-CAG-rtTA+ (CBRb) Transgenic Mice and In Vivo Testing of the DN-CBRb Approach
<ol>
	<li>Upon confirmation of the effective Dox regulation of the TetO-DN-CB-myc6-Rb1 transgene, purify the NotI fragment and microinject them into mouse zygotes, which are later transferred into pseudo-pregnant females. 
	NOTE: These procedures were carried out at the University of Nebraska Medical Center (UNMC) Mouse Genome Engineering Core Facility.</li>
	<li>After delivery, genotype the pups using a primer set specific to the CB-Rb1 fusion region: for CBRb F, use 5&#39; CTGTGGCATTGAATCAGAAATTGTGGCTGG 3&#8242;, and for CBRB R, use 5&#8242; GTACTTCTGCTATATGTGGCCATTACAACC 3&#8242;. 
	NOTE: The PCR product size observed on agarose gel is 401 bp (60-bp CB region + 341-bp Rb1 region (Table 1). Ten independent founder lines were identified, based on the presence of the TetO-DN-CB-myc6-Rb1 transgene. In five of these lines, progeny inherited the transgene, which confirmed the germline transmission of the transgene. One of the transgenic lines was ultimately used to establish and maintain the line and generate experimental TetO-DN-CB-myc6-Rb1 animals for further studies.</li>
	<li>Breed adult TetO-DN-CB-myc6-Rb1 mice to the ROSA-CAG-rtTA tetracycline inducer line (Stock #006965) (alternatively, breed to a tTA inducer line) to generate experimental DN-CBRb mice. Genotype the offspring of this cross using the following primer set: for rtTA-WT R, use GGAGCGGGAGAAATGGATATG; for rtTA Mutant R, use GCGAGGAGTTTGTCCTCAACC; and for rtTA Common, use AAAGTCGCTCTGAGTTGTTAT. The PCR product sizes are 340 bp (mutant), 340 bp and 650 bp (heterozygote), and 650 bp (wild-type).</li>
	<li>Generate a dose-response curve of the RB1 protein following the Dox treatment to determine the time and length of the Dox treatment necessary to elicit a transgene expression. 
	NOTE: In this experiment, western blot and qRT-PCR were used to assess tissue-specific transgene activation and RB1 expression.</li>
	<li>Perform fluorescence in situ hybridization (FISH) to confirm the genomic insertion of the transgene. 
	NOTE: This was carried out at the Centre for Applied Genomics of the Hospital for Sick Children (Toronto, Canada). ELISA or western blotting (using protein-specific antibody) can be used to assess transgene activation, tissue-specificity, and changes in the levels of the endogenous POI. For the DN-CB-myc6-Rb1 construct, we used an anti-RB1 antibody.</li>
</ol>

<ol>
	<li>Li, F. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preferential+MyoD+homodimer+formation+demonstrated+by+a+general+method+of+dominant+negative+mutation+employing+fusion+with+a+lysosomal+protease.">Preferential MyoD homodimer formation demonstrated by a general method of dominant negative mutation employing fusion with a lysosomal protease.</a> Journal of Cell Biology. 135 (4), 1043-1057 (1996).</li><li>Tarang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+a+retinoblastoma+(rb)1-inducible+dominant-negative+(DN)+mouse+model.">Generation of a retinoblastoma (rb)1-inducible dominant-negative (DN) mouse model.</a> Frontiers Cellular Neuroscience. 9 (52), (2015).</li><li>Kominami, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+selective+role+of+cathepsins+B+and+D+in+the+lysosomal+degradation+of+endogenous+and+exogenous+proteins.">The selective role of cathepsins B and D in the lysosomal degradation of endogenous and exogenous proteins.</a> FEBS Letters. 287 (1-2), 189-192 (1991).</li><li>Cortellino, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defective+ciliogenesis,+embryonic+lethality+and+severe+impairment+of+the+sonic+hedgehog+pathway+caused+by+inactivation+of+the+mouse+complex+A+intraflagellar+transport+gene+Ift122/Wdr10,+partially+overlapping+with+the+DNA+repair+gene+Med1/Mbd4.">Defective ciliogenesis, embryonic lethality and severe impairment of the sonic hedgehog pathway caused by inactivation of the mouse complex A intraflagellar transport gene Ift122/Wdr10, partially overlapping with the DNA repair gene Med1/Mbd4.</a> Developmental Biology. 325 (1), 225-237 (2009).</li><li>Ferreira, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+embryonic+lethality+of+H+ferritin+gene+deletion+in+mice.">Early embryonic lethality of H ferritin gene deletion in mice.</a> Journal of Biological Chemistry. 275 (5), 3021-3024 (2000).</li><li>Lee, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mice+deficient+for+rb+are+nonviable+and+show+defects+in+neurogenesis+and+haematopoiesis.">Mice deficient for rb are nonviable and show defects in neurogenesis and haematopoiesis.</a> Nature. 359 (6393), 288-294 (1992).</li><li>Turlo, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=When+cre-mediated+recombination+in+mice+does+not+result+in+protein+loss.">When cre-mediated recombination in mice does not result in protein loss.</a> Genetics. 186 (3), 959-967 (2010).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+cell-cycle+reentry+and+cell+death+after+acute+inactivation+of+the+retinoblastoma+gene+product+in+postnatal+cochlear+hair+cells.">Rapid cell-cycle reentry and cell death after acute inactivation of the retinoblastoma gene product in postnatal cochlear hair cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (2), 781-785 (2008).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+first+knockout+mouse+model+of+retinoblastoma.">The first knockout mouse model of retinoblastoma.</a> Cell Cycle. 3 (7), 952-959 (2004).</li><li>Zhao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletions+of+retinoblastoma+1+(Rb1)+and+its+repressing+target+S+phase+kinase-associated+protein+2+(Skp2)+are+synthetic+lethal+in+mouse+embryogenesis.">Deletions of retinoblastoma 1 (Rb1) and its repressing target S phase kinase-associated protein 2 (Skp2) are synthetic lethal in mouse embryogenesis.</a> Journal of Biological Chemistry. 291 (19), 10201-10209 (2016).</li><li>Yamasaki, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+E2F-1+reduces+tumorigenesis+and+extends+the+lifespan+of+Rb1(+/-)+mice.">Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/-) mice.</a> Nature Genetics. 18 (4), 360-364 (1998).</li><li>Li, F. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+dominant+negative+retinoblastoma+protein+(RB)+inhibiting+satellite+myoblast+differentiation+implies+an+indirect+interaction+between+MyoD+and+RB.">Selection of a dominant negative retinoblastoma protein (RB) inhibiting satellite myoblast differentiation implies an indirect interaction between MyoD and RB.</a> Molecular and Cellular Biology. 20 (14), 5129-5139 (2000).</li><li>Pitkanen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+human+retinoblastoma+gene+product+in+mouse+fibroblasts:+Effects+on+cell+proliferation+and+susceptibility+to+transformation.">Expression of the human retinoblastoma gene product in mouse fibroblasts: Effects on cell proliferation and susceptibility to transformation.</a> Experimental Cell Research. 207 (1), 99-106 (1993).</li><li>Chano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuromuscular+abundance+of+RB1CC1+contributes+to+the+non-proliferating+enlarged+cell+phenotype+through+both+RB1+maintenance+and+TSC1+degradation.">Neuromuscular abundance of RB1CC1 contributes to the non-proliferating enlarged cell phenotype through both RB1 maintenance and TSC1 degradation.</a> International Journal of Molecular Medicine. 18 (3), 425-432 (2006).</li><li>Kole, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+therapeutics:+Beyond+RNA+interference+and+antisense+oligonucleotides.">RNA therapeutics: Beyond RNA interference and antisense oligonucleotides.</a> Nature Reviews Drug Discovery. 11 (2), 125-140 (2012).</li><li>Yamamoto, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ons+and+offs+of+inducible+transgenic+technology:+A+review.">The ons and offs of inducible transgenic technology: A review.</a> Neurobiology of Disease. 8 (6), 923-932 (2001).</li><li>Houdebine, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+animal+models+in+biomedical+research.">Transgenic animal models in biomedical research.</a> Methods in Molecular Biology. 360, 163-202 (2007).</li><li>Brehm, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+protein+recruits+histone+deacetylase+to+repress+transcription.">Retinoblastoma protein recruits histone deacetylase to repress transcription.</a> Nature. 391 (6667), 597-601 (1998).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F-HDAC+complexes+negatively+regulate+the+tumor+suppressor+gene+ARHI+in+breast+cancer.">E2F-HDAC complexes negatively regulate the tumor suppressor gene ARHI in breast cancer.</a> Oncogene. 25 (2), 230-239 (2006).</li><li>Magnaghi-Jaulin, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoblastoma+protein+represses+transcription+by+recruiting+a+histone+deacetylase.">Retinoblastoma protein represses transcription by recruiting a histone deacetylase.</a> Nature. 391 (6667), 601-605 (1998).</li></ol>

The authors have nothing to disclose.

To circumvent the limitations associated with traditional transgenic strategies, we sought to generate a mouse model in which an endogenous POI can be conditionally inactivated by overexpressing a DN mutant form of it in a spatiotemporal manner. To abolish the function of endogenous POIs, several options have been proposed15,16,17. We have modified an earlier genetic strategy1 by combining the Dox-depende...

Most approaches aiming at the gene and protein ablations rely on permanent processes, which generally lead to the complete elimination or truncation of the gene, RNA sequences, or protein of interest (POI). The overall goal of this method is to engineer a recombinant protein to abolish the function of endogenous, wild-type protein. We have revisited and revamped an alternative strategy1,2, which allows for the temporary ablation of a POI through DN inhibition. This method works for both multimeric and monomeric peptides but is best suited for proteins that function in a multimeric assembly.
The method consists of fusing the lysosomal protease CB to a subunit of a multimeric POI (CB fusion complex). The resultant CB fusion complex can interact with and proteolytically digest the endogenous protein or divert the entire CB-POI complex to the lysosome to be degraded3. Moreover, a combination of the CB fusion complex with the inducible nature of the tetracycline-controlled transcriptional activation (TetO) system allows for an inducible and controlled expression of the transgene in a reversible fashion2. Although useful in many circumstances, the complete deletion of genes or proteins in vivo can result in lethality4,5,6. Likewise, tissue-specific, conditional deletion of some genes or proteins using the Cre/Lox system may not be straightforward, as it will, ultimately, lead to the permanent loss of critical genomic elements7. Therefore, depending on the gene or POI, neither of these approaches will be effective in providing a useful model for subsequent studies, particularly genes&#39; or proteins&#39; functional studies in late postnatal and adult mice.
To circumvent the problems associated with such approaches and provide proof-of-principle on the effectiveness of the proposed method, we have chosen to test the method presented here by generating a conditional DN version of the Retinoblastoma 1 (RB1) protein. Several options have been proposed8,9,10 to abolish the function of endogenous RB1; however, all of them faced some of the same limitations discussed above: permanent germline deletion of RB1 is embryonically lethal, and, consistent with its tumor suppressor role, permanent RB1 conditional deletion leads to a variety of tumors11. Even though a DN version of RB1 does not seem to occur naturally, a better alternative to the currently available strategies should allow for a temporally controlled inactivation of the endogenous RB1 and provide an alternative mechanism to eventually restore its function. The basis for such a construct was described over two decades ago1. However, due to technological limitations, it lacked a mechanism to control transgene activation, response, and tissue specificity. This study is the first to combine the elegance of the doxycycline (Dox)-dependent transcriptional system with an engineered transgenic construct of lysosomal protease CB and Rb1 proteins. The resulting CBRb mouse model allows for a temporarily regulated Dox-mediated RB1 regulation2. The advantage of using such a proteome-based approach to study gene function is that it can be adopted for any gene of interest, with minimal information on its activity.
The proposed DN transgene strategy offers many advantages over traditional approaches. First, DN protein inhibition leads to only a partial ablation in protein activity, thus preserving a residual endogenous expression. Such an outcome is highly desirable in situations where a complete elimination of protein activity leads to embryonic lethality, greatly limiting any investigation to study gene function in a live mouse. Second, the presence of the TetO system enables transgene activation only in the presence of an antibiotic, which allows for an efficient and reversible control of the transgene activity. Thus, by ceasing the antibiotic administration, the transgenic system can be deactivated, and a normal RB1 expression is back in place. Third, the specificity of the transgene expression can vary depending on the promoter of choice. While we have chosen the ubiquitous ROSA-CAG promoter for proof-of-principle, placing the transgene under a tissue-specific promoter is likely to restrict unwanted transgene expression and facilitate studies on the therapeutic application of this transgene methodology.

<table><tbody><tr><td>Dulbecco&#039;s Modified Eagle&#039;s Medium, DMEM</td><td>GIBCO-BRL</td><td>11965-084</td><td></td></tr><tr><td>Minimum Essential Medium Eagle, MEME&amp;nbsp;</td><td>Sigma&amp;nbsp;</td><td>M8042</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Sigma&amp;nbsp;</td><td>F2442&amp;nbsp;</td><td></td></tr><tr><td>Lipofectamine&amp;nbsp;</td><td>DharmaFECT</td><td>T-2010-03</td><td></td></tr><tr><td>Sal I</td><td>Roche</td><td>11745622</td><td></td></tr><tr><td>EcoRV-HF</td><td>New England BioLabs</td><td>R3195S</td><td></td></tr><tr><td>NotI</td><td>Roche</td><td>13090730</td><td></td></tr><tr><td>CaspaTag&amp;nbsp;</td><td>Millipore</td><td>APT523</td><td></td></tr><tr><td>DAPI</td><td>Sigma&amp;nbsp;</td><td>D9542</td><td></td></tr><tr><td>Staurosporine</td><td>Sigma&amp;nbsp;</td><td>S4400</td><td></td></tr><tr><td>CyQuant NF cell proliferation kit&amp;nbsp;</td><td>Invitrogen</td><td>C35007</td><td></td></tr><tr><td>Retinoblastoma 1 antibody</td><td>Abcam</td><td>Ab6075</td><td></td></tr><tr><td>c-Myc antibody</td><td>Sigma&amp;nbsp;</td><td>M5546</td><td></td></tr><tr><td>b-actin</td><td>Sigma&amp;nbsp;</td><td>A5316</td><td></td></tr><tr><td>Ki-67&amp;nbsp;</td><td>Thermofisher scientific</td><td>MA5-14520</td><td></td></tr><tr><td>Phallodin</td><td>Thermofisher scientific</td><td>A12379</td><td></td></tr><tr><td>Fluorescence microplate reader</td><td>FLUOstar OPTIMA, BMG Labtech</td><td></td><td></td></tr><tr><td>Epifluorescence microscope&amp;nbsp;</td><td>NikonEclipse80i</td><td></td><td></td></tr><tr><td>The TetO-DN-CB-myc6-Rb1 (DN-CBRb) mouse line is available from the Jackson Laboratory as JAX#032011.&amp;nbsp;</td><td></td><td></td><td></td></tr></tbody></table>

inducible and reversible dominant-negative (dn) protein inhibition

Dominant-negative (DN) protein inhibition is a powerful method to manipulate protein function and offers several advantages over other genome-based approaches. For example, although chimeric and Cre-LoxP targeting strategies have been widely used, the intrinsic limitations of these strategies (i.e., leaky promoter activity, mosaic Cre expression, etc.) have significantly restricted their application. Moreover, a complete deletion of many endogenous genes is embryonically lethal, making it impossible to study gene function in postnatal life. To address these challenges, we have made significant changes to an early genetic engineering protocol and combined a short (transgenic) version of the Rb1 gene with a lysosomal protease procathepsin B (CB), to generate a DN mouse model of Rb1 (CBRb). Due to the presence of a lysosomal protease, the entire CB-RB1 fusion protein and its interacting complex are routed for proteasome-mediated degradation. Moreover, the presence of a tetracycline inducer (rtTA) element in the transgenic construct enables an inducible and reversible regulation of the RB1 protein. The presence of a ubiquitous ROSA-CAG promoter in the CBRb mouse model makes it a useful tool to carry out transient and reversible Rb1 gene ablation and provide researchers a resource for understanding its activity in virtually any cell type where RB1 is expressed.

Generally, designing a DN mutation requires a considerable amount of information on the structure and function of the POI. In contrast, the DN strategy presented here is particularly useful when the structural and functional information for the POI is limited. If the POI is a multimeric protein, a fusion of one subunit to a lysosomal protease can dominantly inhibit the assembled multimer and, potentially, other ligands through a combination of proteolysis of the endogenous subunits and su...

Watch this Scientific Journal Video about Inducible and Reversible Dominant-negative DN Protein Inhibition at JoVE.com

Inducible and Reversible Dominant-negative DN Protein Inhibition

Here we present a protocol to develop a dominant-negative inducible system, in which any protein can be conditionally inactivated by reversibly overexpressing a dominant-negative mutant version of it.

Inducible and Reversible Dominant-negative (DN) Protein Inhibition

Dominant-negative (DN) protein inhibition is a powerful method to manipulate protein function and offers several advantages over other genome-based ...

inducible-and-reversible-dominant-negative-dn-protein-inhibition

Universidad San Sebastian

Research

JoVE Journal

Genetics

8.3K Views.  Creighton University School of Dentistry. Here we present a protocol to develop a dominant-negative inducible system, in which any protein can be conditionally inactivated by reversibly overexpressing a dominant-negative mutant version of it.

Video: Inducible and Reversible Dominant-negative DN Protein Inhibition

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, in the case that the KD of the protein of interest has a lethal effect on cells or the anticipated effect of the KD is time-dependent, unconditional KD methods are not appropriate. Conditional systems are more suitable in these cases and have been the subject of much interest. These include Ecdysone-inducible overexpression systems, Cytochrome P-450 induction system1, and the tetracycline regulated gene expression systems. 
The tetracycline regulated gene expression system enables reversible control over protein expression by induction of shRNA expression in the presence of tetracycline. In this protocol, we present an experimental design using functional Tet-ON system in human cancer cell lines for conditional regulation of gene expression. We then demonstrate the use of this system in the study of tumor cell-monocyte interaction.

This protocol serves as a scheme for setting up a functional Tet-ON system in cancer cell lines and its subsequent use, in particular for studying the role of tumor cell-derived proteins in recruitment of monocytes/macrophages to the tumor microenvironment.

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

Cancer Research

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the differentiation of hiPSCs derived from a patient with the triplication of the alpha-synuclein gene (SNCA) locus into Parkinson&#8217;s disease (PD)-relevant dopaminergic neuronal populations. Accumulating evidence has shown that high levels of SNCA are causative for the development of PD. Recognizing the unmet need to establish novel therapeutic approaches for PD, especially those targeting the regulation of SNCA expression, we recently developed a CRISPR/dCas9-DNA-methylation-based system to epigenetically modulate SNCA transcription by enriching methylation levels at the SNCA intron 1 regulatory region. To deliver the system, consisting of a dead (deactivated) version of Cas9 (dCas9) fused with the catalytic domain of the DNA methyltransferase enzyme 3A (DNMT3A), a lentiviral vector is used. This system is applied to cells with the triplication of the SNCA locus and reduces the SNCA-mRNA and protein levels by about 30% through the targeted DNA methylation of SNCA intron 1. The fine-tuned downregulation of the SNCA levels rescues disease-related cellular phenotypes. In the current protocol, we aim to describe a step-by-step procedure for differentiating hiPSCs into neural progenitor cells (NPCs) and the establishment and validation of pyrosequencing assays for the evaluation of the methylation profile in the SNCA intron 1. To outline in more detail the lentivirus-CRISPR/dCas9 system used in these experiments, this protocol describes how to produce, purify, and concentrate lentiviral vectors and to highlight their suitability for epigenome- and genome-editing applications using hiPSCs and NPCs. The protocol is easily adaptable and can be used to produce high titer lentiviruses for in vitro and in vivo applications.

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the ...

A New Toolkit for Evaluating Gene Functions using Conditional Cas9 Stabilization

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory tool to introduce accurate and targeted modifications in the genome. Its enormous popularity and rapid spread are attributed to its easy use and accuracy compared to its predecessors. Yet, the constitutive activation of the system has limited applications. In this paper, we describe a new method that allows temporal control of CRISPR/Cas9 activity based on conditional stabilization of the Cas9 protein. Fusing an engineered mutant of the rapamycin-binding protein FKBP12 to Cas9 (DD-Cas9) enables the rapid degradation of Cas9 that in turn can be stabilized by the presence of an FKBP12 synthetic ligand (Shield-1). Unlike other inducible methods, this system can be adapted easily to generate bi-cistronic systems to co-express DD-Cas9 with another gene of interest, without conditional regulation of the second gene. This method enables the generation of traceable systems as well as the parallel, independent manipulation of alleles targeted by Cas9 nuclease. The platform of this method can be used for the systematic identification and characterization of essential genes and the interrogation of the functional interactions of genes in in vitro and in vivo settings.

Here, we describe a genome-editing tool based on the temporal and conditional stabilization of clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (Cas9) under the small molecule, Shield-1. The method can be used for cultured cells and animal models.

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory ...

Studying Protein Function and the Role of Altered Protein Expression by Antibody Interference and Three-dimensional Reconstructions

A strict management of protein expression is not only essential to every organism alive, but also an important strategy to investigate protein functions in cellular models. Therefore, recent research invented different tools to target protein expression in mammalian cell lines or even animal models, including RNA and antibody interference. While the first strategy has gathered much attention during the past two decades, peptides &#160;mediating a translocation of antibody cargos across cellular membranes and into cells, obtained much less interest. In this publication, we provide a detailed protocol how to utilize a peptide carrier named Chariot in human embryonic kidney cells as well as in primary hippocampal neurons to perform antibody interference experiments and further illustrate the application of three-dimensional reconstructions in analyzing protein function. Our findings suggest that Chariot is, probably due to its nuclear localization signal, particularly well-suited to target proteins residing in the soma and the nucleus. Remarkably, when applying Chariot to primary hippocampal cultures, the reagent turned out to be surprisingly well accepted by dissociated neurons.

Controlling protein expression is not only essential to every organism alive, but also an important strategy to investigate protein functions in cellular models. The protocol presented shows the application of antibody interference in mammalian cells including primary hippocampal neurons and demonstrates the use of three-dimensional reconstructions in studying protein function.

A strict management of protein expression is not only essential to every organism alive, but also an important strategy to investigate protein functions ...

Bioengineering

Applying an Inducible Expression System to Study Interference of Bacterial Virulence Factors with Intracellular Signaling

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a signaling pathway. The method is based, on the one hand, on the inducible expression of a specific protein to initiate a signaling event at a defined and predetermined step in the selected signaling cascade. Concomitant expression, on the other hand, of the gene of interest then allows the investigator to evaluate if the activity of the expressed target protein is located upstream or downstream of the initiated signaling event, depending on the readout of the signaling pathway that is obtained. Here, the apoptotic cascade was selected as a defined signaling pathway to demonstrate protocol functionality. Pathogenic bacteria, such as Coxiella burnetii, translocate effector proteins that interfere with host cell death induction in the host cell to ensure bacterial survival in the cell and to promote their dissemination in the organism. The C. burnetii effector protein CaeB effectively inhibits host cell death after induction of apoptosis with UV-light or with staurosporine. To narrow down at which step CaeB interferes with the propagation of the apoptotic signal, selected proteins with well-characterized pro-apoptotic activity were expressed transiently in a doxycycline-inducible manner. If CaeB acts upstream of these proteins, apoptosis will proceed unhindered. If CaeB acts downstream, cell death will be inhibited. The test proteins selected were Bax, which acts at the level of the mitochondria, and caspase 3, which is the major executioner protease. CaeB interferes with cell death induced by Bax expression, but not by caspase 3 expression. CaeB, thus, interacts with the apoptotic cascade between these two proteins.

The method described here is used to induce the apoptotic signaling cascade at defined steps in order to dissect the activity of an anti-apoptotic bacterial effector protein. This method can also be used for inducible expression of pro-apoptotic or toxic proteins, or for dissecting interference with other signaling pathways.

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a ...

Immunology and Infection

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Biology

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Development of Inhibitors of Protein-protein Interactions through REPLACE: Application to the Design and Development Non-ATP Competitive CDK Inhibitors

REPLACE is a unique strategy developed to more effectively target protein-protein interactions (PPIs). It aims to expand available drug target space by providing improved methodology for the identification of inhibitors for such binding sites and which represent the majority of potential drug targets. The main goal of this paper is to provide a methodological overview of the use and application of the REPLACE strategy which involves computational and synthetic chemistry approaches. REPLACE is exemplified through its application to the development of non-ATP competitive cyclin dependent kinases (CDK) inhibitors as anti-tumor therapeutics. CDKs are frequently deregulated in cancer and hence are considered as important targets for drug development. Inhibition of CDK2/cyclin A in S phase has been reported to promote selective apoptosis of cancer cells in a p53 independent manner through the E2F1 pathway. Targeting the protein-protein interaction at the cyclin binding groove (CBG) is an approach which will allow the specific inhibition of cell cycle over transcriptional CDKs. The CBG is recognized by a consensus sequence derived from CDK substrates and tumor suppressor proteins termed the cyclin binding motif (CBM). The CBM has previously been optimized to an octapeptide from p21Waf (HAKRRIF) and then further truncated to a pentapeptide retaining sufficient activity (RRLIF). Peptides in general are not cell permeable, are metabolically unstable and therefore the REPLACE (REplacement with Partial Ligand Alternatives through Computational Enrichment) strategy has been applied in order to generate more drug-like inhibitors. The strategy begins with the design of Fragment ligated inhibitory peptides (FLIPs) that selectively inhibit cell cycle CDK/cyclin complexes. FLIPs were generated by iteratively replacing residues of HAKRRLIF/RRLIF with fragment like small molecules (capping groups), starting from the N-terminus (Ncaps), followed by replacement on the C-terminus. These compounds are starting points for the generation of non-ATP competitive CDK inhibitors as anti-tumor therapeutics.

We describe implementation of the REPLACE strategy for targeting protein-protein interactions. REPLACE is an iterative strategy involving synthetic and computational approaches for the conversion of optimized peptidic inhibitors into drug like molecules.

REPLACE is a unique strategy developed to more effectively target protein-protein interactions (PPIs). It aims to expand available drug target space by ...

Eukaryotic Transcription Inhibitors

Certain biochemical processes, such as embryonic development and cell growth regulation, depend on the repression of specific genes.&#160;DNA binding proteins known as eukaryotic transcription inhibitors regulate the repression of gene expression in eukaryotes. The presence of these inhibitors at the required location and time in the cell is triggered by the presence of hormones and additional signals from other cells.
Eukaryotic transcription inhibitors usually contain two distinct domains, a DNA binding domain and a repressor domain. Repressor domains of transcription inhibitors can bind to other proteins, such as basal transcriptional regulators, activators, co-activators, and co-repressors.&#160; Repression domains can be vaguely categorized on the basis of their constituent amino acids, such as alanine -rich domains, glutamine rich domains, and proline rich domains. They can also be categorized as acidic or basic domains, and as hydrophilic or hydrophobic. These domains are often interchangeable and different repressor domains can associate with the same DNA binding domain.
Eukaryotic transcription inhibitors can carry out their function through three major mechanisms &#8211; inhibiting DNA binding, blocking activation, and gene silencing.&#160;
Inhibition of DNA binding either prevents the activator from binding to the promoter or enhancer site, or it can prevent the transcription initiation complex from binding the transcription start site or the TATA box. This could occur either through the binding of the inhibitor to the regulatory or start site or through the association of the inhibitory domain with activators, co-activators, or proteins involved in the transcription machinery.&#160; For example in humans, the transcription inhibitor NF-E binds to the CCAAT box of the fetal &#947;-globin gene and inhibits the binding of the activator CP1.
Blocking activation prevents the signal from a transcription activator bound to a promoter or enhancer from reaching the transcription start site. This can occur when an inhibitor binds to a site adjacent to the promoter or enhancer, like in the regulation of c-myc where the inhibitor myc-PRF binds next to the promoter. It can also occur through the inhibitor binding to a DNA bound activator.&#160; This type of repression occurs when the inhibitor GAL80 in yeast binds to the activator GAL4 when it is bound to the promoter.
Gene silencing occurs when the inhibitor either locks or disorganizes the transcription initiation complex by simultaneously binding to one of the proteins that constitute the machinery and to a site on the DNA near the transcription start site, thereby anchoring the transcription machinery. For example, in yeasts the inhibitor &#945;-2&#160; inactivates the mating type a-specific genes by binding as a dimer to the activator GRM and to DNA sequences bordering the binding site of GRM.

Eukaryotic Transcription Inhibitors: Inhibiting DNA Binding, Blocking Ativation &amp; Gene Silencing

Certain biochemical processes, such as embryonic development and cell growth regulation, depend on the repression of specific genes.&#160;DNA binding ...

Inducible and Reversible Dominant-negative (DN) Protein Inhibition

Summary

Explore More Videos

Chapters in this video

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

A New Toolkit for Evaluating Gene Functions using Conditional Cas9 Stabilization

Studying Protein Function and the Role of Altered Protein Expression by Antibody Interference and Three-dimensional Reconstructions

Applying an Inducible Expression System to Study Interference of Bacterial Virulence Factors with Intracellular Signaling

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Development of Inhibitors of Protein-protein Interactions through REPLACE: Application to the Design and Development Non-ATP Competitive CDK Inhibitors

Eukaryotic Transcription Inhibitors