Name: induction and validation of cellular senescence in primary human cells
Uploaded: 2018-06-20T14:30:00.000+00:00
Duration: 8 min 18 s
Description: Watch this Scientific Journal Video about Induction and Validation of Cellular Senescence in Primary Human Cells at JoVE.com

Biz üyeleri verimli tartışmalar için yönetici laboratuar ve Thijmen van Vliet veri ve iletişim kuralı UV kaynaklı yaşlanma üzerinde paylaştığınız için teşekkür ederiz.

<ol>
	<li>Hayflick, L., Moorhead, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+serial+cultivation+of+human+diploid+cell+strains.">The serial cultivation of human diploid cell strains.</a> Experimental Cell Research. 25, 585-621 (1961).</li><li>Mu&#241;oz-Esp&#237;n, D., Serrano, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+senescence:+from+physiology+to+pathology.+Nature+reviews.">Cellular senescence: from physiology to pathology. Nature reviews.</a> Molecular cell biology. 15, 482-496 (2014).</li><li>Sharpless, N. E., Sherr, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forging+a+signature+of+in+vivo+senescence.">Forging a signature of in vivo senescence.</a> Nature Reviews Cancer. 15 (7), 397-408 (2015).</li><li>Correia-Melo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+are+required+for+pro-ageing+features+of+the+senescent+phenotype.">Mitochondria are required for pro-ageing features of the senescent phenotype.</a> The EMBO Journal. 10, e201592862 (2016).</li><li>Loaiza, N., Demaria, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+senescence+and+tumor+promotion:+Is+aging+the+key?.">Cellular senescence and tumor promotion: Is aging the key?.</a> Biochimica et Biophysica Acta (BBA) - Reviews on Cancer. , (2016).</li><li>Coppe, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescence-associated+secretory+phenotypes+reveal+cell-nonautonomous+functions+of+oncogenic+RAS+and+the+p53+tumor+suppressor.">Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor.</a> PLoS Biology. 6 (12), 2853-2868 (2008).</li><li>Baker, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+p16(Ink4a)-positive+cells+shorten+healthy+lifespan.">Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan.</a> Nature. 530 (7589), 184-189 (2016).</li><li>Xu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+senescent+cells+enhances+adipogenesis+and+metabolic+function+in+old+age.">Targeting senescent cells enhances adipogenesis and metabolic function in old age.</a> Elife. 4, e12997 (2015).</li><li>Baker, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clearance+of+p16Ink4a-positive+senescent+cells+delays+ageing-associated+disorders.">Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders.</a> Nature. 479 (7372), 232-236 (2011).</li><li>Jeon, O. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+clearance+of+senescent+cells+attenuates+the+development+of+post-traumatic+osteoarthritis+and+creates+a+pro-regenerative+environment.">Local clearance of senescent cells attenuates the development of post-traumatic osteoarthritis and creates a pro-regenerative environment.</a> Nature Medicine. 23 (6), 775-781 (2017).</li><li>Demaria, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Senescence+Promotes+Adverse+Effects+of+Chemotherapy+and+Cancer+Relapse.">Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse.</a> Cancer Discovery. 7 (2), 165-176 (2017).</li><li>Chang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clearance+of+senescent+cells+by+ABT263+rejuvenates+aged+hematopoietic+stem+cells+in+mice.">Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice.</a> Nature Medicine. 22 (1), 78-83 (2016).</li><li>Soto-Gamez, A., Demaria, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+interventions+for+aging:+the+case+of+cellular+senescence.">Therapeutic interventions for aging: the case of cellular senescence.</a> Drug Discov Today. 22 (5), 786-795 (2017).</li><li>Childs, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescent+cells:+an+emerging+target+for+diseases+of+ageing.">Senescent cells: an emerging target for diseases of ageing.</a> Nature Reviews Drug Discovery. 16 (10), 718-735 (2017).</li><li>Marthandan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conserved+genes+and+pathways+in+primary+human+fibroblast+strains+undergoing+replicative+and+radiation+induced+senescence.">Conserved genes and pathways in primary human fibroblast strains undergoing replicative and radiation induced senescence.</a> Biological Research. 49, 34 (2016).</li><li>Marthandan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conserved+Senescence+Associated+Genes+and+Pathways+in+Primary+Human+Fibroblasts+Detected+by+RNA-Seq.">Conserved Senescence Associated Genes and Pathways in Primary Human Fibroblasts Detected by RNA-Seq.</a> PLoS One. 11 (5), e0154531 (2016).</li><li>Hernandez-Segura, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unmasking+Transcriptional+Heterogeneity+in+Senescent+Cells.">Unmasking Transcriptional Heterogeneity in Senescent Cells.</a> Current Biology. 27 (17), 2652-2660 (2017).</li><li>Le, O. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ionizing+radiation-induced+long-term+expression+of+senescence+markers+in+mice+is+independent+of+p53+and+immune+status.">Ionizing radiation-induced long-term expression of senescence markers in mice is independent of p53 and immune status.</a> Aging Cell. 9 (3), 398-409 (2010).</li><li>Hall, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C/EBPalpha+regulates+CRL4(Cdt2)-mediated+degradation+of+p21+in+response+to+UVB-induced+DNA+damage+to+control+the+G1/S+checkpoint.">C/EBPalpha regulates CRL4(Cdt2)-mediated degradation of p21 in response to UVB-induced DNA damage to control the G1/S checkpoint.</a> Cell Cycle. 13 (22), 3602-3610 (2014).</li><li>Nitiss, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+DNA+topoisomerase+II+in+cancer+chemotherapy.">Targeting DNA topoisomerase II in cancer chemotherapy.</a> Nature Reviews Cancer. 9 (5), 338-350 (2009).</li><li>Pazolli, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+underlies+the+senescence-+associated+secretory+phenotype+of+tumor+stromal+fibroblasts+that+supports+cancer+progression.">Chromatin remodeling underlies the senescence- associated secretory phenotype of tumor stromal fibroblasts that supports cancer progression.</a> Cancer Research. 72, 2251-2261 (2012).</li><li>Venturelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+induction+of+apoptosis+and+senescence+by+the+DNA+methyltransferase+inhibitors+5-azacytidine+and+5-aza-2'-deoxycytidine+in+solid+tumor+cells.">Differential induction of apoptosis and senescence by the DNA methyltransferase inhibitors 5-azacytidine and 5-aza-2'-deoxycytidine in solid tumor cells.</a> Molecular Cancer Therapeutics. 12, 2226-2236 (2013).</li><li>Tennant, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+Trypan+Blue+Technique+for+Determination+of+Cell+Viability.">Evaluation of the Trypan Blue Technique for Determination of Cell Viability.</a> Transplantation. 2, 685-694 (1964).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Lee, B. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescence-associated+&#946;-galactosidase+is+lysosomal+&#946;-galactosidase.">Senescence-associated &#946;-galactosidase is lysosomal &#946;-galactosidase.</a> Aging Cell. 5, 187-195 (2006).</li><li>Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta-galactosidase+staining+on+bone+marrow.+The+osteoclast+pitfall.">Beta-galactosidase staining on bone marrow. The osteoclast pitfall.</a> Histology and Histopathology. 22 (9), 971-976 (2007).</li><li>Dimri, G. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+biomarker+that+identifies+senescent+human+cells+in+culture+and+in+aging+skin+in+vivo.">A biomarker that identifies senescent human cells in culture and in aging skin in vivo.</a> Proceedings of the National Academy of Sciences. 92 (20), 9363-9367 (1995).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences. 105 (7), 2415-2420 (2008).</li><li>Sherr, C. J., McCormick, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RB+and+p53+pathways+in+cancer.">The RB and p53 pathways in cancer.</a> Cancer Cell. 2 (2), 103-112 (2002).</li><li>Bunz, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+p53+and+p21+to+sustain+G2+arrest+after+DNA+damage.">Requirement for p53 and p21 to sustain G2 arrest after DNA damage.</a> Science. 282 (5393), 1497-1501 (1998).</li><li>Severino, J., Allen, R. G., Balin, S., Balin, A., Cristofalo, V. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Is+beta-galactosidase+staining+a+marker+of+senescence+in+vitro+and+in+vivo.">Is beta-galactosidase staining a marker of senescence in vitro and in vivo.</a> Experimental Cell Research. 257 (1), 162-171 (2000).</li><li>Stolzing, A., Coleman, N., Scutt, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glucose-induced+replicative+senescence+in+mesenchymal+stem+cells.">Glucose-induced replicative senescence in mesenchymal stem cells.</a> Rejuvenation Research. 9 (1), 31-35 (2006).</li><li>Blazer, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+glucose-induced+replicative+senescence:+point+of+no+return+and+effect+of+telomerase.">High glucose-induced replicative senescence: point of no return and effect of telomerase.</a> Biochemical and Biophysical Research Communications. 296 (1), 93-101 (2002).</li><li>Wiley, C. D., Campisi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+Ancient+Pathways+to+Aging+Cells-Connecting+Metabolism+and+Cellular+Senescence.">From Ancient Pathways to Aging Cells-Connecting Metabolism and Cellular Senescence.</a> Cell Metabolism. 23 (6), 1013-1021 (2016).</li><li>Kumar, R., Gont, A., Perkins, T. J., Hanson, J. E. L., Lorimer, I. A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+senescence+in+primary+glioblastoma+cells+by+serum+and+TGFbeta.">Induction of senescence in primary glioblastoma cells by serum and TGFbeta.</a> Scientific Reports. 7 (1), 2156 (2017).</li><li>Hypoxia Blagosklonny, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MTOR+and+autophagy:+converging+on+senescence+or+quiescence.">MTOR and autophagy: converging on senescence or quiescence.</a> Autophagy. 9 (2), 260-262 (2013).</li><li>Meuter, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Markers+of+cellular+senescence+are+elevated+in+murine+blastocysts+cultured+in+vitro:+molecular+consequences+of+culture+in+atmospheric+oxygen.">Markers of cellular senescence are elevated in murine blastocysts cultured in vitro: molecular consequences of culture in atmospheric oxygen.</a> Journal of Assisted Reproduction and Genetics. 31 (10), 1259-1267 (2014).</li><li>Coppe, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human-like+senescence-associated+secretory+phenotype+is+conserved+in+mouse+cells+dependent+on+physiological+oxygen.">A human-like senescence-associated secretory phenotype is conserved in mouse cells dependent on physiological oxygen.</a> PLoS One. 5 (2), e9188 (2010).</li><li>van Deursen, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+senescent+cells+in+ageing.">The role of senescent cells in ageing.</a> Nature. 509 (7501), 439-446 (2014).</li><li>Kim, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implications+of+time-series+gene+expression+profiles+of+replicative+senescence.">Implications of time-series gene expression profiles of replicative senescence.</a> Aging Cell. 12, 622-634 (2013).</li></ol>

Burada iletişim kuralları insan birincil fibroblastlar için optimize özellikle BJ ve WI-38 hücreleri. İkileştirici yaşlanma, iyonizan radyasyon ve doksorubisin, protokollerde başarıyla uygulanan diğer türlerini fibroblastlar (HCA2 ve IMR90) ve diğer hücre tipleri (Yani yenidoğan melanosit ve Lenfositi veya IPSC elde edilen cardiomyocytes) Bizim laboratuvarda. Ancak, ek hücre tipleri için uyarlamalar numaralı seribaşı hücreleri, yöntemleri ve hücreler ekleme/ayırma için plastik destekler için yardımcı kimyasallar ve toksisite önlemek için tedavi dozu gibi bazı ayrıntılar ayarlayarak optimize edilebilir.
Birincil fibroblastlar bile kullanımı bir dizi zorluklar teşkil etmektedir. Senescent hücreleri onların Proliferasyona göre daha ayırmak genellikle daha zordur ve çoğu zaman daha fazla duyarlı trypsinization veya diğer herhangi bir tür ayırma yöntemi, ayırma sonra canlılığı biri az olduğu anlamına gelir Proliferasyona hücreleri. Farklı yöntemleri yaşlanma-inducing için uygun denetimi zor bir seçimdir. Örneğin, doksorubisin gibi uyuşturucu dayalı tedaviler araçla kısa bir tedavi öneririm: PBS için 24 saat kontrol örnekleri doksorubisin tedavi hücreler için söz konusu olduğunda hemen hasat/işlem tarafından takip. Yaşlanma için indüklenen hücre tedavisi (altı gün kültür doksorubisin tedavi hücreler için) uygulandıktan sonra bir genişletilmiş kültür zaman geçmesi ve kontrol hücreleri zaman PBS çıkarıldıktan sonra kültürlü eşit miktarda olmalıdır iddia. Ancak, uzun bir kültür hücreleri daha fazla bölmek için aşırı birleşmesi olmak için veya daha fazla passaging gerektirecek şekilde sağlayacak ve PD. aşırı izdiham artırmak için korumak hücreleri rağmen görünmesini SA-β-gal gibi yaşlanma işaretleri neden olabilir onların potansiyel31Proliferasyona. Artan PD çoğaltma sınırlarını (ve ikileştirici yaşlanma) onları daha yakın almak ve onları daha az doksorubisin tedavi karşılıkları karşılaştırılabilir olun. Benzer bir durum diğer tedaviler için geçerli olacak. Biz her durum için daha uygun gördüğünüz denetimleri tavsiye ettiler.
Yaşlanma hücreleri uyarmak için kullanılan tekniklerin çoğu nispeten kolay ve düz ileri gibi görünüyor, ancak birçok faktör deneyler sonucu etkileyebilir. Örneğin, normal glikoz konsantrasyonu fibroblastlar için geleneksel hücre kültür ortamının 4,5 g/l. Diğerleri için daha yüksek konsantrasyonlarda erken yaşlanma33' e neden olabilir ancak, kök hücreler gibi bazı hücre türleri için glikoz düşük konsantrasyonlarda proliferatif onların potansiyel32, genişletebilir. Ayrıca, senescent hücreleri yüksek metabolik ve yüksek miktarda salgılanan faktörler34üretmek için enerji harcamak gibi diğer yaşlanma ilişkili fenotipleri salınımlarını glikoz konsantrasyonlarda tarafından etkilenebilir.
Başka bir potansiyel hücre kültür orta serum değişkendir. Kompozisyon serum normalde tanımlı değildir ve hayvan kaynak ve toplu iş göre değişir. Özellikle, büyüme faktörleri ve pro-inflamatuar protein miktarı yaşlanma35etkileyebilir. Önerdiğimiz bir serum aynı toplu iş için bütün deneyin gereksiz ve karıştırıcı değişkenlik önlemek için kullanılır. Ancak, bazı ELISA tabanlı iletişim kuralları için kullanılan orta serum ücretsiz kullanımı gibi kaçınılmaz bazı teknik koşullar SASP ifade azaltabilirsiniz.
Oksijen gerginlik tam yaşlanma indüksiyon için önemlidir. Böylece hücrelerin prolifere değil ama geri dönüşümsüz tutuklandı36değildir hipoksi geroconversion, inhibe olabilir. Ancak, en yaygın sorun deneysel kurulumunda hipoksi ama hyperoxia değildir. Nitekim, standart kültür koşulları kez % 20 oksijen "normoxia" kullanın., ancak çoğu hücre tipleri için fizyolojik şartlarda düşüktür. Fare blastokistlerin mevcut yaşlanma (SA-βgal ve DNA hasarı) işaretleri ne zaman % 20 oksijen, onların içinde vivoaksine, kültürlü-türetilmiş karşıtları ya da %5 oksijen37, kültürlü aynı hücreleri. Ayrıca, fare fibroblastlar daha fazla fizyolojik şartlarda (%3 oksijen) ve geleneksel görüntü olanlar (% 20 oksijen) SASP38kültürlü. Burada, tüm kültürler için %5 oksijen kullandık ve deneyler ve biz araştırmacılar ilgi belirli hücre türü için kullanılan oksijen konsantrasyonları yeniden gözden geçirilmesi için çağırıyorum.
Son olarak, başka bir faktör dikkate senescent hücrelerin içsel heterojenite olduğunu. Bir taraftan, farklı hücre tipleri ve hatta hücre suşları yaşlanma ilişkili fenotipleri farklılıkları görüntülemek. Ayrıca, bir upregulation görmek nerede rağmen gösterildiği Şekil 3A, olduğu gibi örneğin fibroblastlar bazı suşları değil upregulate p16 yaşlanma indüksiyon15,16,17, üzerine transkripsiyon düzeyinde yapmak P16, bu istatistiksel olarak anlamlı değildi. Protein düzeyleri ölçme bazı durumlarda bu CDK inhibitörü artan bir faaliyet göstermek bu yüzden P16 translasyonel ve translasyon düzeyinde de kontrol edilir. Ancak, bazı hücreler diğer CDK inhibitörleri p21 gibi sadece güveniyor olabilir. İkisi de transkripsiyon düzeylerini ölçme tavsiye ediyoruz. SASP tam bileşimi de3ürettiği cepten bağlıdır. Ayrıca, bazı hücreler yapısal β-galaktozidaz, SA-β-gal Bu yaşlanma3mutlaka göstergesi değildir boyama için olumlu bir sonuç veren yüksek seviyede hızlı. Bazı durumlarda, bu sorunu SA-β-gal boyama protokolü sırasında boyama çözüm ile kuluçka zamanı azaltarak aşmak. Belirtildiği gibi aşırı birleşmesi hücreleri de SA-β-gal ile onlar biz araştırmacılar bu boyama gerçekleştirmek için seyrek kültür hücrelere teşvik senescent31, varlık olmadan leke. Öte yandan, yaşlanma fenotip istikrarlı39değil. SASP bileşimi ve yaşlanma diğer işaretleri görünümünü çoğu saat-bağımlı17,40. Burada, hangi hücrelerin her tedavi sonrası zaman puan tamamen senescent olarak kabul edilir ve rutin olarak bizim Laboratuvarda kullanılan tavsiye ettiler. Önemlisi, işaretçileri daha kısa bir zamanda noktada ölçüm eksik yaşlanma40nedeniyle olumsuz sonuçları render. Beri senescent tedaviler çoğunda hücreler yüzdesi haline değil, Ayrıca, uzun bir zaman noktası kullanarak genişletmek ve ifade senescent işaretleri azaltır kültür sollamak kaç senescent hücre için yeterli zaman verebilir. Senescent hücreleri heterojen ve farklı veri işaretleyicilerini birden çok uyarılar görünümlerinde, biz son derece araştırmacılar aynı örnek içinde birden çok yaşlanma işaretleri kullanmak için teşvik.

1961'de Hayflick ve Moorhead kültür birincil fibroblastlar sonra art arda pasajlar1proliferatif potansiyellerini kaybetmek bildirdi. Bu işlem sıralı telomerlerin kısalma her hücre bölünmesi sonra neden olur. Telomerlerin eleştirel kısa uzunluğu ulaştığında, nükleer silahların yayılmasına karşı geri dönüşü olmayan bir tutuklama etkinleştiren DNA hasarı yanıt (DDR) tarafından tanınır — de ikileştirici yaşlanma tanımlanır. İkileştirici yaşlanma Şu anda hücre mitogens hem apoptotik sinyal2,3duyarsız işler kalıcı hücre döngüsü tutuklama durumunu ikna etmek için bilinen birçok uyarinin biridir. Yaşlanma program normalde yüksek lizozomal etkinlik, mitokondrial disfonksiyon, nükleer değişiklikleri, kromatin düzenlemeler, endoplazmik retikulum stres, DNA hasarı ve yaşlanma ilişkili dahil olmak üzere ek özellikler ile karakterizedir salgı fenotip (SASP)3,4. Senescent hücreleri vücutta birden fazla işlevi var: geliştirme, yara iyileşmesi ve tümör bastırma2. Aynı şekilde, yaşlanma ve paradoksal olarak, tümör ilerleme5önemli bir rol oynamak için bilinir. Yaşlanma negatif ve kısmen çelişkili etkileri genellikle için SASP6atfedilen.
Son zamanlarda, bu fareler senescent hücrelerden ortadan kaldırılması ömrü uzatma ve yaşlanma özellikleri7,8,9,10,11, çoğunu ortadan kaldırılması yol gösterildi 12. aynı şekilde, birden çok uyuşturucu da senescent hücreleri (senolytics) ortadan kaldırmak için veya SASP13,14hedeflemek için geliştirilmiştir. Anti-aging tedavi potansiyel son zamanlarda alanına daha fazla dikkat çekti.
Çalışma mekanizmaları için hücresel yaşlanma ilişkili ve farmakolojik müdahaleler için gösterimleri özellikle de insan birincil fibroblastlar ex vivo modellerinde güveniyorsun. Ortak bazı özellikleri farklı yaşlanma indükleyicileri tarafından aktif olmakla birlikte, yaşlanma fenotip büyük bir değişkenlik gözlenen ve hücre türü, uyarıcı ve zaman noktası3,15gibi çeşitli faktörlere bağlıdır. 16,17. Eğitim ve senescent hücreleri hedefleme için heterojenite düşünün zorunludur. Bu nedenle, bu iletişim kuralı bir dizi farklı tedavileri kullanarak birincil fibroblastlar yaşlanma ikna etmek için kullanılan yöntem sağlamayı amaçlamaktadır. Bunu izah gibi yöntemler kolayca diğer hücre tipleri için adapte edilebilir.
İkileştirici yaşlanma dışında biz beş diğer yaşlanma-inducing tedaviler tarif: iyonlaştırıcı radyasyon, ultraviyole (UV) ışınları, doksorubisin, oksidatif stres ve epigenetik değişiklikler (yani promosyon histon asetilasyon veya DNA demethylation) . Hem, iyonizan radyasyon ve UV radyasyon doğrudan DNA hasarına neden ve yaşlanma18,19uygun doz tetik. Doksorubisin aynı zamanda yaşlanma DNA hasarı üzerinden olmak üzere DNA'ya enterkalasyon tarafından neden olur ve topoizomeraz II işlevi bozmakta ve böylece DNA durdurma mekanizmaları20onarmak. Genlerin yaşlanma için temel ifade normalde histon asetilasyon ve DNA metilasyonu tarafından kontrol edilir. Sonuç olarak, histon deacetylase inhibitörleri (Örneğin, sodyum bütrat ve SAHA) ve DNA demethylating (Örneğin, 5-aza) ajanlar yaşlanma Aksi takdirde normal hücreleri21,22tetikler.
Son olarak, dört senescent hücrelere ilişkili en yaygın veri işaretleyicilerini açıklanacaktır: yaşlanma ilişkili-β-galaktozidaz (SA-β-gal), DNA sentezi tarafından EdU birleşme tahlil, hücre döngüsü düzenleyiciler overexpression oranı etkinlik ve siklin bağımlı kinaz inhibitörleri p16 ve p21 ve overexpression ve SASP üyeleri salgılanmasını.

<table><tbody><tr><td>DMEM Media - GlutaMAX</td><td>Gibco</td><td>31966-047</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Hyclone</td><td>SV30160.03</td><td></td></tr><tr><td>Penicillin-Streptomycin (P/S; 10,000 U/ml)</td><td>Lonza</td><td>DE17-602E</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>SC-202581</td><td></td></tr><tr><td>Nuclease-Free Water (not DEPC-Treated)</td><td>Ambion</td><td>AM9937</td><td></td></tr><tr><td>T75 flask</td><td>Sarstedt</td><td>833911002</td><td></td></tr><tr><td>Trypsin/EDTA Solution</td><td>Lonza</td><td>CC-5012</td><td></td></tr><tr><td>PBS tablets</td><td>Gibco</td><td>18912-014</td><td></td></tr><tr><td>1.5 ml microcentrifuge tubes</td><td>Sigma-Aldrich</td><td>T9661-1000EA</td><td></td></tr><tr><td>Corning&amp;nbsp;15 mL centrifuge tubes</td><td>Sigma-Aldrich</td><td>CLS430791</td><td></td></tr><tr><td>6-well plate</td><td>Sarstedt</td><td>83.3920</td><td></td></tr><tr><td>24-well plate</td><td>Sarstedt</td><td>83.3922</td><td></td></tr><tr><td>13mm round coverslips</td><td>Sarstedt</td><td>83.1840.002</td><td></td></tr><tr><td>Steriflip</td><td>Merck Chemicals</td><td>SCGP00525</td><td></td></tr><tr><td>Cesium137-source</td><td></td><td></td><td>IBL 637 Cesium-137&amp;gamma;-ray machine</td></tr><tr><td>UV radiation chamber</td><td></td><td></td><td>Opsytec, Dr. G&amp;ouml;bel BS-02</td></tr><tr><td>Doxorubicin dihydrochloride&amp;nbsp;</td><td>BioAustralis Fine Chemicals</td><td>BIA-D1202-1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma-Aldrich</td><td>7722-84-1</td><td></td></tr><tr><td>5-aza-2&amp;rsquo;-deoxycytidine</td><td>Sigma-Aldrich</td><td>A3656</td><td></td></tr><tr><td>SAHA</td><td>Sigma-Aldrich</td><td>SML0061</td><td></td></tr><tr><td>Sodium Butyrate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>B5887</td><td></td></tr><tr><td>X-gal (5-Bromo-4-chloro-3-indolyl-&amp;beta;-D-galactopyranoside)</td><td>Fisher Scientific</td><td>7240-90-6</td><td></td></tr><tr><td>Citric acid monohydrate</td><td>Sigma-Aldrich</td><td>5949-29-1</td><td></td></tr><tr><td>Sodium dibasic phosphate</td><td>Acros organics</td><td>7782-85-6</td><td></td></tr><tr><td>Potassium ferrocyanide&amp;nbsp;</td><td>Fisher Scientific</td><td>14459-95-1</td><td></td></tr><tr><td>Potassium ferricyanide</td><td>Fisher Scientific</td><td>13746-66-2</td><td></td></tr><tr><td>Sodium Chloride</td><td>Merck Millipore</td><td>7647-14-5</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Fisher Chemicals</td><td>7791-18-6</td><td></td></tr><tr><td>25% glutaraldehyde</td><td>Fisher Scientific</td><td>111-30-8,7732-18-5</td><td></td></tr><tr><td>16% formaldehyde (w/v)</td><td>Thermo-Fisher Scientific</td><td>28908</td><td></td></tr><tr><td>EdU (5-ethynyl-2&amp;rsquo;-deoxyuridine)</td><td>Lumiprobe</td><td>10540</td><td></td></tr><tr><td>Sulfo-Cyanine3 azide (Sulfo-Cy3-Azide)</td><td>Lumiprobe</td><td>D1330</td><td></td></tr><tr><td>Sodium ascorbate</td><td>Sigma-Aldrich</td><td>A4034</td><td></td></tr><tr><td>Copper(II) sulfate pentahydrate (Cu(II)SO&lt;sub&gt;4&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O)</td><td>Sigma-Aldrich</td><td>209198</td><td></td></tr><tr><td>Triton X-100</td><td>Acros organics</td><td>215682500</td><td></td></tr><tr><td>TRIS base</td><td>Roche</td><td>11814273001</td><td></td></tr><tr><td>LightCycler 480 Multiwell Plate 384, white&amp;nbsp;</td><td>Roche</td><td>4729749001</td><td></td></tr><tr><td>Lightcycler 480 sealing foil&amp;nbsp;</td><td>Roche</td><td>4729757001</td><td></td></tr><tr><td>Sensifast Probe Lo-ROX kit&amp;nbsp;</td><td>Bioline</td><td>BIO-84020</td><td></td></tr><tr><td>UPL Probe Library</td><td>Sigma-Aldrich</td><td>Various</td><td></td></tr><tr><td>Human IL-6 DuoSet ELISA</td><td>R&amp;amp;D</td><td>D6050</td><td></td></tr><tr><td>Bio-Rad TC20</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Counting slides</td><td>Bio-Rad</td><td>145-0017</td><td></td></tr><tr><td>Dry incubator</td><td>Thermo-Fisher Scientific</td><td>Heratherm</td><td></td></tr><tr><td>Dimethylformamide</td><td>Merck Millipore</td><td>1.10983</td><td></td></tr><tr><td>Parafilm &#039;M&#039; laboratory film</td><td>Bemis&amp;nbsp;</td><td>#PM992</td><td></td></tr><tr><td>Tweezers</td><td></td><td></td><td></td></tr><tr><td>Needles</td><td></td><td></td><td></td></tr></tbody></table>

induction and validation of cellular senescence in primary human cells

Hücresel yaşlanma kalıcı hücre döngüsü tutuklama farklı zararlı uyaranlara yanıt olarak aktif bir durumdur. Harekete geçirmek-in hücresel yaşlanma tümör giderme, yenileme ve yaşlanma doku dahil olmak üzere çeşitli patofizyolojik koşullar bir özelliğidir. Hücresel yaşlanma vivo içinde indükleyicileri hala kötü karakterizedir. Ancak, bir dizi uyaranlara hücresel yaşlanma ex vivotanıtmak için kullanılabilir. Bunların arasında en yaygın yaşlanma-indükleyicileri ikileştirici bitkinlik, iyonize ve iyonizan radyasyon, genotoksik uyuşturucu, oksidatif stres ve demethylating ve ajanlar acetylating vardır. Burada, bu uyaranlara fibroblastlar yaşlanma ikna etmek için kullanma hakkında ayrıntılı yönergeler sağlayacaktır. Bu iletişim kuralı kolayca primer hücre ve hücre hatları, kanser hücrelerinin de dahil olmak üzere farklı türleri için adapte edilebilir. Biz aynı zamanda yaşlanma indüksiyon doğrulama için farklı yöntemler açıklanmaktadır. Özellikle, biz lizozomal enzim yaşlanma ilişkili β-galaktozidaz (SA-β-gal), 5-ethynyl-2'-deoxyuridine (EdU) birleşme tahlil, ifadesi hücre döngüsünün düzeyi kullanarak DNA sentezi oranı etkinliğini ölçme üzerinde odaklanmak inhibitörleri p16 ve p21 ve ifade ve salgı üye Senescence-Associated salgı fenotip (SASP). Son olarak, örnek sonuçlar sağlar ve uygulamalar bu iletişim kurallarının tartışmak.

SA-β-gal senescent fibroblastlar boyama zenginleştirme
Β-galaktozidaz (β-gal) bu tüm hücrelerde ifade edilir ve bir optimum pH 4.025,26olan lizozomal bir enzimdir. Ancak, yaşlanma sırasında organellerin Boyutu'nda artırın ve sonuç olarak, β-gal senescent hücreleri birikir. Bu enzim artan miktarda bir suboptimal pH 6,025,27, bile onun bir etkinlik tespit olanak sağlar. Şekil 1A karşı senescent birincil fibroblastlar Proliferasyona SA-β-gal boyama temsilcisi görüntüleri gösterir. Hücreleri de büyümüş ve düzensiz bir hücre gövdesi ile bakmak. Böylece bir boyama DAPI ile birlikte görselleştirme ve hücre (Şekil 1B) sayma kolaylaştırır belirtildiği gibi tek tek hücreler, ayırt etmek zor olabilir. Bir Floresan Mikroskobu DAPI boyama gözlemlemek için fotoğraf çekmek gereklidir. "Mavi" SA-β-gal boyama resimleri siyah görünmesi bu parlak alan kanal resimleri siyah/beyaz, alınacak anlamına gelir. Not, bir örnek içindeki tüm hücreleri β-gal için olumludur. Yaşlanma indüksiyon verimliliğini uyarıcı ve hücre tipi/kullanılan üzerindeki yükü son derece bağlıdır. Burada açıklanan protokoller vermiştir > % 50 β-gal pozitif hücrelerinin içinde bizim ellerde birincil fibroblastlar (BJ ve WI-38).
Daha az hücre EdU yaşlanma indüksiyon sonra dahil.
EdU bu etkin DNA sentezi sırasında DNA28dahil edilecek nükleozit timidin bir analog var. EdU birleşme DNA içine EdU, alkin grup28yoksun çünkü düzenli timidin gerçekleştirilemez reaksiyon için Copper-Catalyzed azid-alkin cycloaddition (CuAAC) yaptıktan sonra görüntülenmeyecektir. Bu belirli protokol için bir Sulfo-Cy3-azid kullanılıyor. Alkin azid kaplin yerini almıştır hücreleri floresan Cy3 filtre (Şekil 2A) altında görüntülenir. EdU birleşme tahlil gerçekleştirerek, Proliferasyona hücreleri olmayan Proliferasyona hücrelerden ayrılır ki dikkate almak önemlidir. Sigara Proliferasyona hücreler EdU birleşme tahlil hücre döngüsü tutuklama bu iki tür arasında ayırımcılık değil durgun veya senescent, anlamı olabilir.
Senescent fibroblastlar upregulate CDK inhibitörleri p16 ve p21
Senescent hücreleri oluşturmak CDKs inhibitörleri hücre döngüsü29durdurmak için kullanın. Özellikle p16 ve p21 genellikle senescent hücreleri3işaretleri ölçülür. Bir veya her iki işaretleri normal upregulated senescent hücrelerdeki upregulation çoğu zaman transkripsiyon düzeyinde ifade var... Her iki işaretleyiciyi de aynı anda bazı hücreler değil upregulate p16 transkripsiyon düzeyinde ve p21 evrensel ama özgü olmayan kalem yaşlanma15,17,30için kullanmadan önce teşvik edilmektedir. Şekil 3 p16 temsilcisi göreli quantifications gösterir ve fibroblastlar p21 mRNA yaşlanma için indüklenen. İmmunostaining ve/veya protein düzeyleri tespit etmek için Batı kurutma gibi diğer teknikleri da mümkündür.
Bir SASP senescent fibroblastlar görüntülemek
En senescent hücre transcriptionally upregulate çeşitli genler için kodlama salgılanan proteinler, SASP6adı verilen bir fenomen. SASP faktörler katılan inflamasyon, Örneğin, interlökin ve kemokinler dahildir veya hücre dışı matriks (ECM) bozulması, Örneğin, MMPs, ama son derece heterojen. İndüksiyon SASP faktörlerin ya mRNA ifade seviye qPCR üzerinden ya da salgılanan protein ile Enzyme-Linked IMMUNO jelleştirici Assay (ELISA) düzeyi ölçülerek değerlendirilir. Şekil 4 IL6, transkripsiyon ve salgılanan düzeyde upregulation gösterilen bir temsili resim gösterir. Biz sadece bir temsil IL6 kullanılır; Ancak, birden çok protokol 3.4 üzerinde önerilen listeden SASP üyeleri ölçmek için teşvik edilir.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57782/57782fig1.jpg"> Şekil 1: SA-β-gal senescent birincil fibroblastlar boyama zenginleştirme. BJ birincil sünnet derisi fibroblastlar (PD 34.1) iyonizan radyasyon (10 Gy) açarak yaşlanma için indüklenen. Hücreleri SA-βgal için on gün sonra ışınlama lekeli. SA-βgal (yukarı) tedavi edilmediği veya iyonizan radyasyon (aşağı) maruz BJ birincil fibroblastlar içinde boyama(a)temsilcisi sonuçları elde etmek için. Son büyütme: 100 X. (B) temsilcisi rakam SA-β-gal DAPI ile BJ birincil fibroblastlar için her iki tedavi edilmemiş (üç sol panel) Co lekeli veya (üç doğru panel) iyonlaştırıcı radyasyona maruz. (Mavi) boyama DAPI tek tek hücreler miktar kolaylaştırmak görselleştirmek için yardımcı olur. Parlak sahada çekilmiş olan fotoğraflar siyah/beyaz görünür. Bu nedenle, bu belirli resimleri SA-β-gal boyama siyah Perinükleer noktalar gibi görünür. Son büyütme: 100 X. SA-β-gal pozitif hücre Proliferasyona (Prol., beyaz) (C) miktar BJ fibroblastlar iyonlaştırıcı radyasyona maruz-tedavi karşılıkları (Senatör, mavi) karşı. Miktar standart hata ortalamaya gösterilen hata çubukları ile üç biyolojik çoğaltır kullanılarak gerçekleştirildi. İstatistiksel anlamlılık bir unpaired iki kuyruklu öğrenci t-testi delta-CT değerleri tarafından tespit edilmiştir. (n = 3, ± SEM, *** p değeri = < 0,01). <a href="/files/ftp_upload/57782/57782fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57782/57782fig2.jpg"> Şekil 2: daha az sayıda hücre EdU dahil yaşlanma indüksiyon sonra. (A)temsilcisi görüntü EdU birleşme testin Proliferasyona WI-38 fibroblastlar PD 43.86 (solda) ve iyonlaşma radyasyonlu karşılıkları (sağda). Son büyütme: 100 X. EdU pozitif hücre Proliferasyona (Prol., beyaz) (B) miktar BJ fibroblastlar (PD 38,7) radyoaktif karşılıkları (Senatör, mavi) karşı. Miktar standart hata ortalamaya gösterilen hata çubukları ile üç biyolojik çoğaltır kullanılarak gerçekleştirildi. İstatistiksel anlamlılık kararlı bir unpaired iki kuyruklu öğrenci t-testi delta-CT değerleri tarafından (n = 3, ± SEM, *** p değeri = < 0,01). <a href="/files/ftp_upload/57782/57782fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57782/57782fig3.jpg"> Şekil 3: Senescent fibroblastlar upregulate CDK inhibitörleri p16 ve p21. (A)miktar p16 mRNA ifadede Proliferasyona (Prol., beyaz, PD 35,3) veya 5 aza tedavi BJ hücrelerin (Senatör, mavi). (B) miktar p21 mRNA ifade Proliferasyona (Prol., beyaz, PD 35,3) içinde veya 5 aza tedavi BJ (Senatör, mavi) hücreleri. Miktar standart hata ortalamaya gösterilen hata çubukları ile üç biyolojik çoğaltır (her iki teknik çoğaltır) kullanılarak gerçekleştirildi. İstatistiksel anlamlılık kararlı bir unpaired iki kuyruklu öğrenci t-testi delta-CT değerleri tarafından (n = 3, ± SEM, *** = p değeri < 0,01). <a href="/files/ftp_upload/57782/57782fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57782/57782fig4.jpg"> Şekil 4: Senescent fibroblastlar görüntülemek bir salgı fenotip (SASP). BJ fibroblastlar ifadede (A) IL6 miktar mRNA ya Proliferasyona (Prol., beyaz, PD 38,7) veya indüklenen yaşlanma için iyonizan radyasyon (Senatör, mavi) tarafından. (B) miktar IL6 protein ifade Proliferasyona PD 38.6 (Prol., beyaz) veya iyonizan radyasyon tedavi WI38 fibroblastlar (Senatör, mavi). Miktar standart hata ortalamaya gösterilen hata çubukları ile üç biyolojik çoğaltır kullanılarak gerçekleştirildi. QPCR veri söz konusu olduğunda her biyolojik REPLICATE iki teknik çoğaltmaları vardı. İstatistiksel anlamlılık kararlı bir unpaired iki kuyruklu öğrenci t-testi delta-CT değerleri tarafından (n = 3, ± SEM, ***p değeri = < 0,01). <a href="/files/ftp_upload/57782/57782fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td></td>
			<td>Eritici</td>
			<td>Hisse senedi çözüm</td>
			<td>Çalışma çözüm</td>
			<td>Seyreltme tedavisi için</td>
			<td>Son konsantrasyonu</td>
		</tr>
<tr>
<td>SAHA</td>
			<td>DMSO</td>
			<td>100 mM</td>
			<td>1 mM</td>
			<td>1:1,000</td>
			<td>1 ΜM</td>
		</tr>
<tr>
<td>Sodyum bütrat</td>
			<td>Steril su</td>
			<td>---</td>
			<td>1 M</td>
			<td>1:250</td>
			<td>4 mM</td>
		</tr>
<tr>
<td>5-aza-2'-deoxycytidine (5-aza)</td>
			<td>DMSO</td>
			<td>100 mM</td>
			<td>10 mM</td>
			<td>1:1,000</td>
			<td>10 ΜM</td>
		</tr>
</tbody></table>Tablo 1: Stok ve çalışma çözümleri farklı Epigenetically kaynaklı yaşlanma için kullanılan tedaviler için.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Bileşen</td>
			<td>Birim</td>
			<td>Son konsantrasyonu</td>
		</tr>
<tr>
<td>20 mg/mL X-gal</td>
			<td>1 mL</td>
			<td>1 mg/mL</td>
		</tr>
<tr>
<td>0,2 M sitrik asit sodyum fosfat tampon ph 6,0</td>
			<td>4 mL</td>
			<td>40 mM</td>
		</tr>
<tr>
<td>100 mM potasyum ferrocyanide</td>
			<td>1 mL</td>
			<td>5 mM</td>
		</tr>
<tr>
<td>100 mM potasyum ferricyanide</td>
			<td>1 mL</td>
			<td>5 mM</td>
		</tr>
<tr>
<td>5 M sodyum klorür</td>
			<td>0.6 mL</td>
			<td>150 mM</td>
		</tr>
<tr>
<td>1 M magnezyum klorür</td>
			<td>0,04 mL</td>
			<td>2 mM</td>
		</tr>
<tr>
<td>Su</td>
			<td>12.4 mL</td>
			<td>-</td>
		</tr>
<tr>
<td>Toplam</td>
			<td>20 mL</td>
			<td></td>
		</tr>
</tbody></table>Tablo 2: Boyama boyama yaşlanma ilişkili (SA) - β - gal için kullanılan çözüm bileşimi.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Hedef</td>
			<td colspan="2">(5' 3' ->) astar ileri</td>
			<td colspan="2">Astar (5' 3' ->) ters</td>
			<td>UPL sonda</td>
		</tr>
<tr>
<td>Tübülin</td>
			<td colspan="2">CTTCGTCTCCGCCATCAG</td>
			<td colspan="2">CGTGTTCCAGGCAGTAGAGC</td>
			<td>#40</td>
		</tr>
<tr>
<td>Aktin B</td>
			<td colspan="2">ccaaccgcgagaagatga</td>
			<td colspan="2">ccagaggcgtacagggatag</td>
			<td>#64</td>
		</tr>
<tr>
<td>P16</td>
			<td colspan="2">GAGCAGCATGGAGCCTTC</td>
			<td colspan="2">CGTAACTATTCGGTGCGTTG</td>
			<td>#67</td>
		</tr>
<tr>
<td>P21</td>
			<td colspan="2">tcactgtcttgtacccttgtgc</td>
			<td colspan="2">ggcgtttggagtggtagaaa</td>
			<td>#32</td>
		</tr>
<tr>
<td>IL6</td>
			<td colspan="2">CAGGAGCCCAGCTATGAACT</td>
			<td colspan="2">GAAGGCAGCAGGCAACAC</td>
			<td>#45</td>
		</tr>
<tr>
<td>IL8</td>
			<td colspan="2">GAGCACTCCATAAGGCACAAA</td>
			<td colspan="2">ATGGTTCCTTCCGGTGGT</td>
			<td>#72</td>
		</tr>
<tr>
<td>IL1a</td>
			<td colspan="2">GGTTGAGTTTAAGCCAATCCA</td>
			<td colspan="2">TGCTGACCTAGGCTTGATGA</td>
			<td>#6</td>
		</tr>
<tr>
<td>CXCL1</td>
			<td colspan="2">CATCGAAAAGATGCTGAACAGT</td>
			<td colspan="2">ATAAGGGCAGGGCCTCCT</td>
			<td>#83</td>
		</tr>
<tr>
<td>CXCL10</td>
			<td colspan="2">GAAAGCAGTTAGCAAGGAAAGGT</td>
			<td colspan="2">GACATATACTCCATGTAGGGAAGTGA</td>
			<td>#34</td>
		</tr>
<tr>
<td>CCL2</td>
			<td colspan="2">AGTCTCTGCCGCCCTTCT</td>
			<td colspan="2">GTGACTGGGGCATTGATTG</td>
			<td>#40</td>
		</tr>
<tr>
<td>CCL20</td>
			<td colspan="2">GCTGCTTTGATGTCAGTGCT</td>
			<td colspan="2">GCAGTCAAAGTTGCTTGCTG</td>
			<td>#39</td>
		</tr>
<tr>
<td>PAI1</td>
			<td colspan="2">AAGGCACCTCTGAGAACTTCA</td>
			<td colspan="2">CCCAGGACTAGGCAGGTG</td>
			<td>#19</td>
		</tr>
<tr>
<td>MMP1</td>
			<td colspan="2">GCTAACCTTTGATGCTATAACTACGA</td>
			<td colspan="2">TTTGTGCGCATGTAGAATCTG</td>
			<td>#7</td>
		</tr>
<tr>
<td>MMP3</td>
			<td colspan="2">CCAGGTGTGGAGTTCCTGAT</td>
			<td colspan="2">CATCTTTTGGCAAATCTGGTG</td>
			<td>#72</td>
		</tr>
<tr>
<td>MMP9</td>
			<td colspan="2">GAACCAATCTCACCGACAGG</td>
			<td colspan="2">GCCACCCGAGTGTAACCATA</td>
			<td>#53</td>
		</tr>
</tbody></table>Tablo 3: Astar dizileri ve onların karşılık gelen UPL mRNA yaşlanma işaretlerinin içinde insan kaynaklı örnekleri algılamak için sonda.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Bileşen</td>
			<td>Birim/örnek</td>
		</tr>
<tr>
<td>Sensifast yoklama Lo-Rox mix</td>
			<td>5 ΜL</td>
		</tr>
<tr>
<td>Astar-set (50 µM)</td>
			<td>0.1 ΜL</td>
		</tr>
<tr>
<td>UPL sonda</td>
			<td>0.1 ΜL</td>
		</tr>
<tr>
<td>Nükleaz ücretsiz su</td>
			<td>2.3 ΜL</td>
		</tr>
<tr>
<td>cDNA (~ 4 ng)</td>
			<td>2.5 ΜL</td>
		</tr>
<tr>
<td>Toplam</td>
			<td>7.5 ΜL</td>
		</tr>
</tbody></table>Tablo 4: QPCR reaksiyon bileşimi UPL sistemi için karıştırın.

Watch this Scientific Journal Video about Induction and Validation of Cellular Senescence in Primary Human Cells at JoVE.com

Induction and Validation of Cellular Senescence in Primary Human Cells

İndüksiyon ve birincil insan hücrelerinde hücresel yaşlanma doğrulama

Burada, bir dizi indüksiyon için protokol ve kültürlü hücrelerdeki hücresel yaşlanma doğrulanmasını tartışmak. Biz farklı yaşlanma-inducing uyaranlara üzerinde odaklanmak ve ortak yaşlanma ilişkili işaretçileri miktar açıklayın. Fibroblastlar içerebilen bir model olarak kullanarak teknik ayrıntıları sağlar, ancak iletişim kuralları için çeşitli hücresel modelleri adapte edilebilir.

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

induction-and-validation-of-cellular-senescence-in-primary-human-cells

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Developmental Biology

Unit 1

Cell Proliferation

SCIENTISTS IN ACTION

16.6K Görüntüleme.  University of Groningen, University Medical Center Groningen. Burada, bir dizi indüksiyon için protokol ve kültürlü hücrelerdeki hücresel yaşlanma doğrulanmasını tartışmak. Biz farklı yaşlanma-inducing uyaranlara üzerinde odaklanmak ve ortak yaşlanma ilişkili işaretçileri miktar açıklayın. Fibroblastlar içerebilen bir model olarak kullanarak teknik ayrıntıları sağlar, ancak iletişim kuralları için çeşitli hücresel modelleri adapte edilebilir.

Video: Induction and Validation of Cellular Senescence in Primary Human Cells

Collection of Serum- and Feeder-free Mouse Embryonic Stem Cell-conditioned Medium for a Cell-free Approach

The capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) to generate various cell types has opened new avenues in the field of regenerative medicine. However, despite their benefits, the tumorigenic potential of ESCs and iPSCs has long been a barrier for clinical applications. Interestingly, it has been shown that ESCs produce several soluble factors that can promote tissue regeneration and delay cellular aging, suggesting that ESCs and iPSCs can also be utilized as a cell-free intervention method. Therefore, the method for harvesting mouse embryonic stem cell (mESC)-conditioned medium (mESC-CM) with minimal contamination of serum components (fetal bovine serum, FBS) and feeder cells (mouse embryonic fibroblasts, MEFs) has been highly demanded. Here, the present study demonstrates an optimized method for the collection of mESC-CM under serum- and feeder-free conditions and for the characterization of mESC-CM using senescence-associated multiple readouts. This protocol will provide a method to collect pure mESC-specific secretory factors without serum and feeder contamination.

This protocol provides a method for the collection of mouse embryonic stem cell (mESC)-conditioned medium (mESC-CM) derived from serum (fetal bovine serum, FBS)- and feeder (mouse embryonic fibroblasts, MEFs)-free conditions for a cell-free approach. It may be applicable for the treatment of aging and aging-associated diseases.

Serum- toplanması ve Besleyici serbest Fare Embriyonik Hücre içermeyen Yaklaşım Hücre klimalı Orta Kök

The capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) to generate various cell types has opened new avenues in the field ...

Gelişim Biyolojisi

Evaluation of Injury-induced Senescence and In Vivo Reprogramming in the Skeletal Muscle

Cellular senescence is a stress response that is characterized by a stable cellular growth arrest, which is important for many physiological and pathological processes, such as cancer and ageing. Recently, senescence has also been implicated in tissue repair and regeneration. Therefore, it has become increasingly critical to identify senescent cells in vivo. Senescence-associated &#946;-galactosidase (SA-&#946;-Gal) assay is the most widely used assay to detect senescent cells both in culture and in vivo. This assay is based on the increased lysosomal contents in the senescent cells, which allows the histochemical detection of lysosomal &#946;-galactosidase activity at suboptimum pH (6 or 5.5). In comparison with other assays, such as flow cytometry, this allows the identification of senescent cells in their resident environment, which offers valuable information such as the location relating to the tissue architecture, the morphology, and the possibility of coupling with other markers via immunohistochemistry&#160;(IHC). The major limitation of the SA-&#946;-Gal assay is the requirement of fresh or frozen samples.
Here, we present a detailed protocol to understand how cellular senescence promotes cellular plasticity and tissue regeneration in vivo. We use SA-&#946;-Gal to detect senescent cells in the skeletal muscle upon injury, which is a well-established system to study tissue regeneration. Moreover, we use&#160;IHC to detect Nanog, a marker of pluripotent stem cells, in a transgenic mouse model. This protocol enables us to examine and quantify cellular senescence in the context of induced cellular plasticity and in vivo reprogramming.

Evaluation of Injury-induced Senescence and In Vivo Reprogramming in the Skeletal Muscle

Here we present a detailed protocol to detect both senescent and pluripotent stem cells in the skeletal muscle upon injury while inducing in vivo reprogramming. This method is suitable for evaluating the role of cellular senescence during tissue regeneration and reprogramming in vivo.

Yaralanma kaynaklı yaşlanma ve In Vivo kas iskelet yeniden programlama değerlendirilmesi

Cellular senescence is a stress response that is characterized by a stable cellular growth arrest, which is important for many physiological and ...

A Sensitive Method to Quantify Senescent Cancer Cells

Human cells do not indefinitely proliferate. Upon external and/or intrinsic cues, cells might die or enter a stable cell cycle arrest called senescence. Several cellular mechanisms, such as telomere shortening and abnormal expression of mitogenic oncogenes, have been shown to cause senescence. Senescence is not restricted to normal cells; cancer cells have also been reported to senesce.
	Chemotherapeutical drugs have been shown to induce senescence in cancer cells. However, it remains controversial whether senescence prevents or promotes tumorigenesis. As it might eventually be patient-specific, a rapid and sensitive method to assess senescence in cancer cell will soon be required.
	To this end, the standard &beta;-galactosidase assay, the currently used method, presents major drawbacks: it is time consuming and not sensitive. We propose here a flow cytometry-based assay to study senescence on live cells. This assay offers the advantage of being rapid, sensitive, and can be coupled to the immunolabeling of various cellular markers.

Whether senescence prevents or promotes tumorigenesis remains controversial. Since chemotherapeutical drugs can induce cancer cells to senesce, studying senescence is essential for proposing new therapies. However, the standard and broadly used &beta;-galactosidase assay presents major drawbacks. We propose here a rapid and sensitive flow cytometry-based assay to quantify senescence.

Senesent Kanser Hücreleri ölçmek için bir Hassas Yöntem

Human cells do not indefinitely proliferate. Upon external and/or intrinsic  cues, cells might die or enter a stable cell cycle arrest called senescence. ...

Tıp

A Quantitative Measurement of Reactive Oxygen Species and Senescence-associated Secretory Phenotype in Normal Human Fibroblasts During Oncogene-induced Senescence

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. Recent studies have extended the role of cellular senescence to various physiological processes, including development, wound healing, immune surveillance, and age-related tissue dysfunction. Although cell cycle arrest is a critical hallmark of cellular senescence, an increased intracellular reactive oxygen species (ROS) production has also been demonstrated to play an important role in the induction of cellular senescence. In addition, recent studies revealed that senescent cells exhibit potent paracrine activities on neighboring cells and tissues through a senescence-associated secretory phenotype (SASP). The sharp increase in interest regarding therapeutic strategies against cellular senescence emphasizes the need for a precise understanding of senescence mechanisms, including intracellular ROS and the SASP. Here, we describe protocols for quantitatively assessing intracellular ROS levels during H-Ras-induced cellular senescence using ROS-sensitive fluorescent dye and flow cytometry. In addition, we introduce sensitive techniques for the analysis of the induction of mRNA expression and secretion of SASP factors. These protocols can be applied to various cellular senescence models.

Intracellular ROS has been shown to play an important role in the induction of cellular senescence. Here, we describe a sensitive assay for quantifying ROS levels during cellular senescence. We also provide protocols for assessing the senescence-associated secretory phenotype, which reportedly contributes to various age-related dysfunctions.

Reaktif oksijen türleri ve yaşlanma ilişkili salgı fenotip Normal insan fibroblast içinde bir nicel ölçüm onkogen kaynaklı yaşlanma sırasında

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. ...

Simultaneous Imaging and Flow-Cytometry-based Detection of Multiple Fluorescent Senescence Markers in Therapy-Induced Senescent Cancer Cells

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, senescence is a fundamentally different machinery restraining&#160;propagation of cancer cells. Decades of scientific studies have revealed the complex pathological effects of senescent cancer cells in tumors and microenvironments that modulate cancer cells and stromal cells. New evidence suggests that senescence is a potent prognostic factor during cancer treatment, and therefore rapid and accurate detection of senescent cells in cancer samples is essential. This paper presents a method to visualize and detect therapy-induced senescence (TIS) in cancer cells. Diffuse large B-cell lymphoma (DLBCL) cell lines were treated with mafosfamide (MAF) or daunorubicin (DN) and examined for the senescence marker, senescence-associated &#946;-galactosidase (SA-&#946;-gal), the DNA synthesis marker 5-ethynyl-2&#8242;-deoxyuridine (EdU), and the DNA damage marker gamma-H2AX (&#947;H2AX). Flow cytometer imaging can help generate high-resolution single-cell images in a short period of time to simultaneously visualize and quantify the three markers in cancer cells.

Here we present a flow cytometry-based method for visualization and quantification of multiple senescence-associated markers in single cells.

Tedaviye Bağlı Yaşlanan Kanser Hücrelerinde Çoklu Floresan Yaşlanma Belirteçlerinin Eşzamanlı Görüntüleme ve Akış Sitometrisine Dayalı Tespiti

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, ...

Kanser Araştırmaları

Far-Red Fluorescent Senescence-Associated &#946;-Galactosidase Probe for Identification and Enrichment of Senescent Tumor Cells by Flow Cytometry

Cellular senescence is a state of proliferative arrest induced by biological damage that normally accrues over years in aging cells but may also emerge rapidly in tumor cells as a response to damage induced by various cancer treatments. Tumor cell senescence is generally considered undesirable, as senescent cells become resistant to death and block tumor remission while exacerbating tumor malignancy and treatment resistance. Therefore, the identification of senescent tumor cells is of ongoing interest to the cancer research community. Various senescence assays exist, many based on the activity of the well-known senescence marker, senescence-associated beta-galactosidase (SA-&#946;-Gal). 
Typically, the SA-&#946;-Gal assay is performed using a chromogenic substrate (X-Gal) on fixed cells, with the slow and subjective enumeration of "blue" senescent cells by light microscopy. Improved assays using cell-permeant, fluorescent SA-&#946;-Gal substrates, including C12-FDG (green) and DDAO-Galactoside (DDAOG; far-red), have enabled the analysis of living cells and allowed the use of high-throughput fluorescent analysis platforms, including flow cytometers. C12-FDG is a well-documented probe for SA-&#946;-Gal, but its green fluorescent emission overlaps with intrinsic cellular autofluorescence (AF) that arises during senescence due to the accumulation of lipofuscin aggregates. By utilizing the far-red SA-&#946;-Gal probe DDAOG, green cellular autofluorescence can be used as a secondary parameter to confirm senescence, adding reliability to the assay. The remaining fluorescence channels can be used for cell viability staining or optional fluorescent immunolabeling.
Using flow cytometry, we demonstrate the use of DDAOG and lipofuscin autofluorescence as a dual-parameter assay for the identification of senescent tumor cells. Quantitation of the percentage of viable senescent cells is performed. If desired, an optional immunolabeling step may be included to evaluate cell surface antigens of interest. Identified senescent cells can also be flow cytometrically sorted and collected for downstream analysis. Collected senescent cells can be immediately lysed (e.g., for immunoassays or 'omics analysis) or further cultured.

A protocol for fluorescent, flow cytometric quantification of senescent cancer cells induced by chemotherapy drugs in cell culture or in murine tumor models is presented. Optional procedures include co-immunostaining, sample fixation to facilitate large batch or time point analysis, and the enrichment of viable senescent cells by flow cytometric sorting.

Akış Sitometrisi ile Yaşlanan Tümör Hücrelerinin Tanımlanması ve Zenginleştirilmesi için Uzak Kırmızı Floresan Yaşlanma İlişkili β-Galaktosidaz Probu

Cellular senescence is a state of proliferative arrest induced by biological damage that normally accrues over years in aging cells but may also emerge ...

Measurement of Protein Turnover Rates in Senescent and Non-Dividing Cultured Cells with Metabolic Labeling and Mass Spectrometry

Mounting evidence has shown that the accumulation of senescent cells in the central nervous system contributes to neurodegenerative disorders such as Alzheimer&#39;s and Parkinson&#39;s diseases. Cellular senescence is a state of permanent cell cycle arrest that typically occurs in response to exposure to sub-lethal stresses. However, like other non-dividing cells, senescent cells remain metabolically active and carry out many functions that require unique transcriptional and translational demands and widespread changes in the intracellular and secreted proteomes. Understanding how protein synthesis and decay rates change during senescence can illuminate the underlying mechanisms of cellular senescence and find potential therapeutic avenues for diseases exacerbated by senescent cells. This paper describes a method for proteome-scale evaluation of protein half-lives in non-dividing cells using pulsed stable isotope labeling by amino acids in cell culture (pSILAC) in combination with mass spectrometry. pSILAC involves metabolic labeling of cells with stable heavy isotope-containing versions of amino acids. Coupled with modern mass spectrometry approaches, pSILAC enables the measurement of protein turnover of hundreds or thousands of proteins in complex mixtures. After metabolic labeling, the turnover dynamics of proteins can be determined based on the relative enrichment of heavy isotopes in peptides detected by mass spectrometry. In this protocol, a workflow is described for the generation of senescent fibroblast cultures and similarly arrested quiescent fibroblasts, as well as a simplified, single-time point pSILAC labeling time-course that maximizes coverage of anticipated protein turnover rates. Further, a pipeline is presented for the analysis of pSILAC mass spectrometry data and user-friendly calculation of protein degradation rates using spreadsheets. The application of this protocol can be extended beyond senescent cells to any non-dividing cultured cells such as neurons.

This protocol describes the workflow for metabolic labeling of senescent and non-dividing cells with pulsed SILAC, untargeted mass spectrometry analysis, and a streamlined calculation of protein half-lives.

Metabolik Etiketleme ve Kütle Spektrometrisi ile Yaşlanan ve Bölünmeyen Kültürlü Hücrelerde Protein Devir Hızlarının Ölçülmesi

Mounting evidence has shown that the accumulation of senescent cells in the central nervous system contributes to neurodegenerative disorders such as ...

Biyokimya

Techniques to Induce and Quantify Cellular Senescence

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed cellular senescence. Accumulation of senescent cells occurs with organismal aging and through continual culturing in vitro. Senescent cells influence many biological processes, including embryonic development, tissue repair and regeneration, tumor suppression, and aging. Hallmarks of senescent cells include, but are not limited to, increased senescence-associated &#946;-galactosidase activity (SA-&#946;-gal); p16INK4A, p53, and p21 levels; higher levels of DNA damage, including &#947;-H2AX; the formation of Senescence-associated Heterochromatin Foci (SAHF); and the acquisition of a Senescence-associated Secretory Phenotype (SASP), a phenomenon characterized by the secretion of a number of pro-inflammatory cytokines and signaling molecules. Here, we describe protocols for both replicative and DNA damage-induced senescence in cultured cells. In addition, we highlight techniques to monitor the senescent phenotype using several senescence-associated markers, including SA-&#946;-gal, &#947;-H2AX and SAHF staining, and to quantify protein and mRNA levels of cell cycle regulators and SASP factors. These methods can be applied to the assessment of senescence in various models and tissues.

Cellular senescence, the irreversible state of cell-cycle arrest, can be induced by various cellular stresses. Here, we describe protocols to induce cellular senescence and methods to assess markers of senescence.

Teknikler İndüklemek ve Ölçmek Hücresel Yaşlılık etmek

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

Biyoloji

SA-&#946;-Galactosidase-Based Screening Assay for the Identification of Senotherapeutic Drugs

Cell senescence is one of the hallmarks of aging known to negatively influence a healthy lifespan. Drugs able to kill senescent cells specifically in cell culture, termed senolytics, can reduce the senescent cell burden in vivo and extend healthspan. Multiple classes of senolytics have been identified to date including HSP90 inhibitors, Bcl-2 family inhibitors, piperlongumine, a FOXO4 inhibitory peptide and the combination of Dasatinib/Quercetin. Detection of SA-&#946;-Gal at an increased lysosomal pH is one of the best characterized markers for the detection of senescent cells. Live cell measurements of senescence-associated &#946;-galactosidase (SA-&#946;-Gal) activity using the fluorescent substrate C12FDG in combination with the determination of the total cell number using a DNA intercalating Hoechst dye opens the possibility to screen for senotherapeutic drugs that either reduce overall SA-&#946;-Gal activity by killing of senescent cells (senolytics) or by suppressing SA-&#946;-Gal and other phenotypes of senescent cells (senomorphics). Use of a high content fluorescent image acquisition and analysis platform allows for the rapid, high throughput screening of drug libraries for effects on SA-&#946;-Gal, cell morphology and cell number.

Cellular senescence is the key factor in the development of chronic age-related pathologies. Identification of therapeutics that target senescent cells show promise for extending healthy aging. Here, we present a novel assay to screen for the identification of senotherapeutics based on measurement of senescence associated &#946;-Galactosidase activity in single cells.

Senoterapötik Ilaçların tanımlanması için SA-β-Galactosidaz tabanlı tarama tahlili

Cell senescence is one of the hallmarks of aging known to negatively influence a healthy lifespan. Drugs able to kill senescent cells specifically in cell ...