Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00.000+00:00
Duration: 8 min 34 s
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

Jasmin Kresse usta teknik yardım minnetle kabul edilmektedir.

Kesin endoderm doğru İnsan ESC 1. Farklılaşma <ol><li> 37 ° C&#39;de bir kuluçka insan embriyonik kök hücreleri (ESCs) yetiştirmek ve% 5 CO2. </li><li> Coat bazal membran matris 1 ml yeni 6 oyuklu hücre kültürü plakasının ve oda sıcaklığında en az 30 dakika süre ile kültür eşya inkübe edin. Belirli ayrıntılar için ilgili üreticinin talimatlarına çevirmek lütfen. </li><li> Kültürlü insan EKH (örneğin, 4X) düşük büyütme kullanılarak mikroskop altında% 80 -90% confluency ulaşmış emin olun. steril cam Pasteur pipetiyle orta kapalı emerek boşluklardan gelen orta aspire. Fosfat tamponlu tuz (PBS) çözeltisi ile bir kez hücreler yıkanır. Bunun için, usulca her kuyuya 2 ml PBS eklemek plaka sallamak ve ölü hücreleri ve hücre enkaz kaldırmak için çözüm emmek. </li><li> hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. 37 ° C, bir hücreleri inkübed% 5 CO 2 hücreleri küçük kümeler halinde bozulma net işaretler göstermek kadar. NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. malzemeler bölümünde belirtilen enzim içermeyen pasajlama çözümü için, kuluçka süresi yaklaşık 7 dk. </li><li> 1 mi DMEM / F-12 ortamı ilave edin ve pipetleme ve 1 ml pipet ucu kullanarak aşağı tek bir hücre içine kalan hücre birikintisinin yok. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin. </li><li> g x 300, 5 dakika boyunca hücreler santrifüj. Süpernatant aspire ve 10 uM, Rho-kinaz (rock) inhibitörü içeren 5 ml ES hücre kültürü ortamında tekrar süspansiyon hücreleri. </li><li> hemasitometre kullanarak mikroskop altında hücrelerin sayısı ve 150.000 tohum - kullanılan ES hücre hattı bağlı, 6-kuyu başına ya da başka bir plaka taslağına 400.000 hücreleri. Kullanım cul37 ° C ve% 5 CO2 seviyesinde apoptozu ve kültür, bir kuluçka makinesi içinde hücreleri önlemek için orta ihtiva eden 10 uM ROCK inhibitörü Ture. </li><li> Yaklaşık 24 saat steril cam Pasteur pipet ile orta aspirat tohumlama ve ilkel çizgi indüksiyon orta 2 ml ekleyin sonra. NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS, 5 uM CHIR-99.021 ve 50 ng / ml, aktivin A&#39;nın nihai konsantrasyonlar içerir. Genel olarak, 6 oyuklu plakalar içinde kültivasyonu için ortam 2 ml kullanın. </li><li> 48 saat tohumlama sonra, indüksiyon orta endoderm için orta yerine. Günlük bir değiştirilen ortam içinde bir 48 saat daha, bu ortam içinde hücrelerin kültive edilmesi. NOT: Bu ortam Gelişmiş RPMI-1640 ortamı içinde% 1 glutamin,% 0.2 FCS ve 50 ng / ml aktivin A ihtiva etmektedir. Kesin endoderm doğru kararlıyız Hücreler yüzey işaretleyici CXCR4 ifade eder. CXCR4&#39;ün boyama DE-işlenen hücrelerin sayısını belirlemek için kullanılabilir. </li></ol><pclass = &quot;jove_title&quot;&gt; 2. Sitometrisi Analizi CXCR4 + Kesin Endoderm Hücrelerinin boyanması <ol><li> hasat öncesi son 24 saatte, ancak en az 1 saat süre ile hücre kültür ortamına 10 uM ROCK önleyici. </li><li> Kat yani bazal membran matrisi ile yeniden oluşturma, kullanılacak hücre kültürü ürünleri, immünofloresan boyama qPCR analiz veya oda slaytlar 12 oyuklu plakalar. Oda sıcaklığında en az 30 dakika boyunca plakaları veya slaytlar inkübe edin. </li><li> boyama ve / veya sıralama için kullanılan farklılaşmış hücrelerin kuyulardan steril cam Pasteur pipet ile orta aspire. </li><li> hücre kümeleri nazik ayrışması için enzim içermeyen pasajlama çözüm reaktif 1 ml ekleyin. Hücreler küçük kümeler halinde bozulma net belirtileri göstermeye kadar CO 2 37 ° C&#39;de inkübe hücreleri ve% 5. NOT: İnkübasyon süresi kullanılan reaktif bağlıdır. Bakır Aynalar belirtilen enzim içermeyen pasajı çözümü içinals bölümü, kuluçka süresi yaklaşık 7 dk. </li><li> 1 ml DMEM / F-12 orta ekleyin ve yukarı pipetleme ve 1 ml ucunu kullanarak aşağı tek hücre içine hücre agrega kalan bozabilir. yüzey hücreleri temizleme ve bir santrifüjleme tüp hücreleri aktarmak için kullanın. Tüm hücreler almak için, / FCS O W, DMEM / F-12 ortamı, 1 ml her bir yıkama ve santrifüj tüpüne orta ekleyin. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 yuvalı plaka üç kuyu hücre farklılaşmasının üç gün sonra 10-15 x 10 6 hücre ile sonuçlanmalıdır. g x 300, 5 dakika boyunca hücreler santrifüj. Not: Elde edilen hücreler tam sayısı ayırımında kullanılan pluripotent hücre hattına bağlıdır. </li><li> Süpernatant aspire ve 10 uM ROCK inhibitörü içeren PEB tampon içinde tekrar süspansiyon hücreleri. 10&#39;a kadar 7 hücreleri, bu tampon 100 ul kullanın. staini gününde 10 uM ROCK inhibitörü eklemeng. (PEB tamponu + UR olarak anılacaktır) tüm alt uygulamalar için bu tampon kullanın. NOT: PEB tamponu,% 0.5 BSA ve PBS içinde 2 mM EDTA içermektedir. daha fazla hücre lekeli isteniyorsa, buna göre tampon seviyesini ayarlamak. </li><li> Bu kabaca 1:10 seyreltme temsil 100 ul 10 7 hücre başına bir CXCR4-APC antikoru 10 ul ekleyin. NOT: Bir APC bağlı antikor kullanımı zorunlu değildir. Bunun yerine kullanılan mikro-bağlı ikame edilebilir. daha fazla hücre lekeli gerekiyorsa buna göre antikor seviyesini ayarlamak. </li><li> hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C&#39;de inkübe edin. 1-2 ml PEB tamponu ile tekrar süspansiyon hücreleri. g x 300, 5 dakika boyunca hücreler santrifüj. </li><li> Steril cam Pasteur pipetle süpernatant aspire ve 10 7 hücre başına 80 ul PEB hücre pelletini ve 20 ul anti-APC mikroboncukları ekleyin. NOT: </sdaha fazla hücre lekeli isteniyorsa trong&gt;, buna göre mikro boncuk ses seviyesini ayarlamak. </li><li> hafifçe parmak boru çevirerek karıştırın ve 15 dakika boyunca bir buzdolabında 4 ° C&#39;de inkübe edin. 1-2 ml PEB tamponu + RI ile hücreleri tekrar süspansiyon. g x 300, 5 dakika boyunca hücreler santrifüj. tampon aspire. 500 ul PEB tamponu + RI içinde süspanse. </li></ol> CXCR4&#39;ün + Hücreleri 3. Manyetik Ayırma <ol><li> üretim talimatlarına göre bir manyetik alan içinde orta büyüklükte bir manyetik sütun yerleştirin. 500 ul PEB tamponu + RI ile sütun ön durulayın. sütun tüm hücre süspansiyonu uygulayın. kolona bağlanacağı şekilde tüm hücreler akışı toplamak. Emin CXCR4 + hücreler optimum alımı için sütunları rahatsız etmemek olun. </li><li> sütun 500 ul PEB tamponu + RI ile üç kez yıkayın. üzerinden ilk akışını toplamak ve Adım 3.1 toplanan hücreler ile birleştirmek. manyetik alan manyetik sütun çıkarın ve koyunUygun toplama tüpü. kolona 1 mi PEB tamponu + RI ekleyin. Hücreler sıkıca sütuna pistonu bastırın Zehir için. </li><li> İsteğe bağlı: ayrı ayrı örnekler üzerinden tüm akışını toplamak ve akım sitometri kullanarak CXCR4 + hücrelerin sayısını analiz etmek 20 ul her kullanın. Onların sayısı her yıkama adımda düşüş gerekir. NOT: En az 2 x 10 4 canlı, kapı hücreler güvenilir sonuçlar için sayılmalıdır. </li><li> Tekrarlayın Adım 3.1 numune boyunca toplanan akışı ve yeni bir sütun kullanarak adım 3.2 numune boyunca ilk akışı ile 3.1-3.3 adımları tekrarlayın. Do not önceki sütun yeniden kullanın. piston havası kullanılarak bloke sütunun içine bastırılır. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. 6 x 10 6 hücre farklılaşma kadar etkinliğine bağlı olarak, ilk kriteri ve işlem 10 7 hücreleri kullanıldığında, ikinci bir kolon kullanılarak bir 1 x 10 6 hücre olabilir. </li&gt; <li> 5 dakika boyunca 300 xg&#39;de hücreleri Santrifüj. Süpernatant aspire ve steril bir cam Pasteur pipetle ve ek 10 uM ROCK inhibitörü ile Adım 1.9 1 ml endoderm indüksiyon ortamı hücreleri tekrar süspansiyon. </li><li> hemasitometre kullanarak mikroskop altında hücreleri saymak. Uygun bir yoğunlukta hücreler Tohum, yani ~ 12 oyuklu plakanın her bir kuyucuğu başına 4 x 10 5 hücre (app. 3.6 cm2 yüzey) ya da ~ 8 oyuklu odacık sürgünün oyuk başına 1.5 x 10 5 hücre. </li></ol> 4. İsteğe bağlı: Arıtılmış Kesin Endoderm Nüfus Analizi <ol><li> immünofloresan boyama kabaca 24 saat kesin endoderm (DE) ve / veya Pluripotency işaretleyici proteinleri% 4 formaldehit ve leke tohumlama sonra Adım 3.7 saflaştırılmış hücreleri düzeltmek. Not: Genellikle kullanılan DE belirteçler FOXA2 ve SOX17 arasında, yaygın olarak kullanılan pluripotense belirteçleri OCT3 / 4, Nanog ve Sox2 6, 8 bulunur. </li><li> foR RT-qPCR analizi, doğrudan ya da 24 saat sonra tohumlama saflaştırılmış hücreler hasat Toplam RNA çıkarmak ve çıkarılan toplam RNA örneklerinden cDNA ters transkribe. DE ve pluripotense işaretçi genler 6, 8 ekspresyonunu analiz etmek için RT-qPCR reaksiyon (kopyaların) cinsinden kalıp olarak 10 ng cDNA kullanın. Not: Genellikle kullanılan marker genleri Aşama 4.1&#39;de bahsedilmektedir. Döngü koşulları eğrisi analizi eriterek, ardından 95 ° C&#39;de 5 dakika ve 95 ° C&#39;de 15 saniye 40 döngü, 60 ° C&#39;de 1 dakika, bulunmaktadır. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Şu anda kullanılan farklılaşma protokolleri nadiren% 100 farklılaşmış hücrelerin neden. hala ele alınması gereken nedenlerden dolayı bazı hücreler farklılaşma sürecini karşı. kullanılan farklılaşma protokolünün verimlilik ve ESC eğilimi bağlı kalan pluripotent hücrelerin belirli bir sayıda yaygın, hatta kesin endoderm içine farklılaşma sonra gözlenir hattı. Bunlar artık hücreler gibi transkriptomik, proteomik ve miRNA ifade analizi olarak aşağı farklılaşmaları veya daha fazla a...

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücreleri, insan vücudunun hemen hemen herhangi bir hücre türü ayırt etmek yeteneğine sahiptir. Bu nedenle, in vitro farklılaşma protokolleri, kardiyomiyositlerde 1, hepatositler 2, beta hücreleri 3 akciğer epitelyal 4 ya da nöronal hücrelerin 5 gibi çok sayıda yetişkin hücre türleri oluşturmak için de kullanılabilir. Bu ESCS çeşitli dejeneratif hastalıkların 3 potansiyel tedavisi için değerli bir araç sağlar. Akciğer, karaciğer ve pankreas yetişkin dokularda doğru EKH in vitro farklılaşma kesin endoderm (DE) 6 andıran hücreleri içine bir sözde Gastrulasyon gerektirir. Bahsedilen somatik hücre tiplerinin üzerinden aşağı doğru farklılaşma önemli ölçüde daha az etkili olduğu için, optimal bir endoderm farklılaşma 7 oran-sınırlayıcı olarak kabul edilir. endoderm soy doğru kararlıyız Hücreler cha geçmesigen ekspresyon profili Karakteristik değişir. Pluripotensin ana düzenleyici genler aşağı düzenlenir gibi 9. CXCR4 Smad2 tarafından Transaktive bilinmektedir FOXA2, SOX17, HNF1B GATA aile üyeleri ve CXCR4 yüksek 6 yukarı düzenlenen bir yüzey reseptörü, 8, diğer transkripsiyon faktörleri salınımı / 3, bağlı, destekleyici bölgesi 10&#39;da spesifik bağlanma sitelerine düğüm / TGF-β sinyalizasyon ve SOX17 aşağı doğru. Böylece raporları 6, 8, 11-13, bir dizi kullanılan çok uygun bir belirtecidir. Bu sentezleme değişiklikler ESCs ilk ilkel bir çizgi-benzeri hücre popülasyonunun özelliklerini kazanmak ve daha sonra endoderm tohumu tabaka 6 olarak tamamlama olan bir sözde-Gastrulasyon etkinliği yansıtmaktadır. Birkaç hücre farklılaşma sürecine karşı veya diğer istenmeyen soyları 14 doğru ayırt edilebilir Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Bu hücreler, negatif ha olabilirnce ileri farklılaşma. Ayrıca, artık farklılaşmamış hücreler daha sonra transplantasyon deneyler için büyük riskler barındıran ve teratom 15-17 sebebiyet verebilir. Erken yüzey işaretleyici CXCR4 DE 18 doğru işlenen hücrelerin saflaştırılması için de kullanılabilir, bu istenmeyen hücreleri çıkarmak için. Burada, DE farklılaşma kültürlerinden CXCR4 + hücreleri pozitif seçim için bir yöntem tarif eder. Bunun için, yüzey işaretleyici CXCR4 daha sonra da manyetik mikro boncuklar bağlanan bir antikor ile bağlıdır. FACS sıralama sırasında zorlu koşullarda farklı olarak, manyetik olarak etiketlenmiş DE-benzeri hücreler, daha sonra kolayca hafif bir saflaştırma yöntemi kullanılarak bir tezgah üstü bir biçimde saflaştırılabilir. Bu protokol, DE farklılaşma sürecine karşı hücre popülasyonlarının çıkarılması için basit bir yöntem sağlar.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

embriyonik kök hücrelerin (ESCs) halinde pluripotent kök hücrelerin farklılaşması yetenekleri hücre yenileme terapisi için potansiyel bir terapötik uygulama sağlar. Terminal olarak farklılaşmış hücre türleri., Çeşitli dejeneratif hastalıkların tedavisinde kullanılan, akciğer, karaciğer ve pankreas dokularında karşı bu hücrelerin in vitro farklılaşma, bir birinci basamak olarak kesin endodermal hücrelerinin üretilmesini gerektirir edilebilir. Bu adım, oran-sınırlayıcı insülin üreten beta hücrelerinin hepatositlere ya da diğer endoderm türetilmiş hücre türleri terminal olgun hücre tipleri yönünde daha fazla türev içindir. endoderm soy doğru kararlıyız Hücreler çok böyle FOXA2, SOX17, HNF1B GATA aile üyeleri ve yüzey reseptörü CXCR4 olarak transkripsiyon faktörlerinin çok sayıda ifade eder. Ancak, farklılaşma protokolleri nadiren% 100 etkilidir. Burada, farklılaşma sonra CXCR4 + hücre popülasyonunun saflaştırılması için bir yöntem açıklanmaktadırManyetik mikroboncuklarm kullanarak DE içine. Bu saflaştırma ek istenmeyen soy hücreleri ortadan kaldırır. yumuşak bir saflaştırma yöntemi, hızlı ve güvenilir olduğu ve aşağı doğru uygulamalar ve farklılaşmaları geliştirmek için kullanılabilir.

farklılaşma üzerine EKH gen ve protein ekspresyonu köklü değişim geçirirler. 1 başarılı endoderm farklılaşmasını kontrol etmek için kullanılabilecek tipik marker genleri tasvir etmektedir. Bir gen ekspresyon analizi için ana hedeflerdir GSC, FOXA2 ve SOX17 bulunmaktadır. Farklılaşmamış EKH karşılaştırıldığında göreceli gen ekspresyon analizi, özellikle FOXA2 ve SO...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Burada, alt uygulamalar ve diğer farklılıklar iyileştirilmesi için kesin endoderm doğru kararlı farklılaştırılmış insan embriyonik kök hücrelerinin saflaştırılması için bir yöntem açıklanmaktadır.

İnsan Embriyonik Kök Hücreleri Yaratılan Endoderm Hücrelerinin Saflaştırılması Hızlı ve Etkin Yöntem

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

8.3K Görüntüleme.  Hannover Medical School.  Burada, alt uygulamalar ve diğer farklılıklar iyileştirilmesi için kesin endoderm doğru kararlı farklılaştırılmış insan embriyonik kök hücrelerinin saflaştırılması için bir yöntem açıklanmaktadır. 

Video: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

Yalıtım Normal kolon ve kolorektal Karsinom - gelişmiş bir iletişim kuralı üzerinden insan endotel hücrelerinin

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Kanser Araştırmaları

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery İnsan Embriyonik Kök Hücreleri türetilmesi

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Biyoloji

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Küçük Molekül İndüksiyon Pluripotent İnsan Embriyonik Kök Hücreleri İnsan Nöronal atalarıdır ve Nöronlar Verimli türetilmesi

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Nörobilim

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

Vitro Decidualization için insan endometrium Stromal hücre izolasyon

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

Gelişim Biyolojisi

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Decellularized Akciğer Yapı iskeleleri kullanarak ESC türetilmiş Fare Havayolu Epitel Hücreleri Üretimi

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Biyomühendislik

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

İnsan Embriyonik Kök Hücre Popülasyonlar Hepatosit gibi Hücreleri Sağlam Nesil

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

Yüksek Yoğunluklu İnsan Embriyonik Kök Hücre Kültürleri gelen Rapid Fibroblast Kaldırma

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Embriyonik Ventriküler Endotel Hücre İzolasyonu

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

iPSC'lerden Verimli İnsan Bağırsağı Organoid Üretimi için Matris Karşılaştırması

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

Yazar Spotlight: iPSC'leri Kullanarak İlaç Geliştirme için Organoid Üretimini İlerletmek

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

İnsan Kök Hücre Bakımı ve Bağırsak Organoid Üretimi için Bazal Membran Matrislerinin Karşılaştırmalı Çalışması

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

İnsan Embriyonik Kök Hücreleri Yaratılan Endoderm Hücrelerinin Saflaştırılması Hızlı ve Etkin Yöntem

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Yalıtım Normal kolon ve kolorektal Karsinom - gelişmiş bir iletişim kuralı üzerinden insan endotel hücrelerinin

Immunosurgery İnsan Embriyonik Kök Hücreleri türetilmesi

Küçük Molekül İndüksiyon Pluripotent İnsan Embriyonik Kök Hücreleri İnsan Nöronal atalarıdır ve Nöronlar Verimli türetilmesi

Vitro Decidualization için insan endometrium Stromal hücre izolasyon

Decellularized Akciğer Yapı iskeleleri kullanarak ESC türetilmiş Fare Havayolu Epitel Hücreleri Üretimi

İnsan Embriyonik Kök Hücre Popülasyonlar Hepatosit gibi Hücreleri Sağlam Nesil

Yüksek Yoğunluklu İnsan Embriyonik Kök Hücre Kültürleri gelen Rapid Fibroblast Kaldırma

Embriyonik Ventriküler Endotel Hücre İzolasyonu

İnsan Kök Hücre Bakımı ve Bağırsak Organoid Üretimi için Bazal Membran Matrislerinin Karşılaştırmalı Çalışması

İnsan Kök Hücre Bakımı ve Bağırsak Organoid Üretimi için Bazal Membran Matrislerinin Karşılaştırmalı Çalışması