Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00.000+00:00
Duration: 8 min 34 s
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

재스민 Kresse의 숙련 된 기술 지원은 기꺼이 인정 받고 있습니다.

확실한 내배엽으로 인간의 ESC 1. 차별화 <ol><li> 37 ℃ 배양기에서 인간 배아 줄기 세포 (는 ESC)를 배양하고, 5 % CO 2. </li><li> 코트 기저막 매트릭스 1 ㎖와 새로운 6- 웰 세포 배양 접시에 RT에서 적어도 30 분 동안 배양 도자기 부화. 특정 자세한 내용은 각 제조업체의 지침을 켜십시오. </li><li> 배양 된 인간는 ESC (예 : 4X) 낮은 배율을 사용하여 현미경으로 80 % -90 %의 포화 상태에 도달했는지 확인합니다. 멸균 유리 파스퇴르 피펫으로 매체를 흡입하여 공동의 매체를 기음. 인산염 완충 식염수 (PBS) 용액으로 한 번 세포를 씻으십시오. 이를 위해 부드럽게 각 웰에 2 ㎖의 PBS를 추가 플레이트를 흔들어 사균 및 세포 파편을 제거하는 용액을 빨아. </li><li> 세포 클러스터의 부드러운 해리에 대한 효소가없는 계대 솔루션 시약의 1 ML을 추가합니다. 37 ° C 형의 세포를 품어D 5 % CO 2 세포가 작은 클러스터로 중단의 명확한 징후를 표시 할 때까지. 주 : 배양 시간을 사용 시약에 따라 달라집니다. 자료 섹션에서 언급 된 효소가없는 계대 솔루션의 경우, 배양 시간은 약 7 분입니다. </li><li> 1 ml의 DMEM / F-12 배지를 추가로 pipetting에 의해 1 ML의 피펫 팁을 사용하여 아래 하나의 세포에 남아있는 세포 집합체을 방해. 표면으로부터 세포를 세척하고, 원심 분리 튜브에 세포를 전송하기 위해를 사용한다. 모든 셀을 검색하려면, DMEM / F-12 배지 1 ㎖ 잘 각각의 세척 및 원심 분리 튜브에 매체를 추가 할 수 있습니다. </li><li> g X 300에서 5 분간 세포를 원심 분리기. 상등액을 흡인하고 10 μM의 Rho 키나아제 (ROCK) 억제제를 함유하는 5 ㎖의 ES 세포 배양 배지에서 세포를 재현 탁. </li><li> 혈구를 사용하여 현미경으로 세포를 세어 150,000 시드 - 사용 ES 세포주에 따라 6- 웰 당 또는 다른 플레이트 레이아웃 400,000 세포. 사용 막 다른37 ° C, 5 % CO 2에서 세포 사멸과 문화를 인큐베이터에서 세포를 방지하기 위해 매체를 포함하는 10 μM의 ROCK 저해제를 진짜야. </li><li> 약 24 시간 멸균 유리 파스퇴르 피펫으로 매체 대기음을 파종하고 원시적 인 행진 유도 배지 2 ㎖를 추가 한 후. 참고 :이 매체는 고급 RPMI-1640 배지에 1 % 글루타민, 0.2 % FCS, 5 μM CHIR-99021 50 NG / ㎖ 티빈의 최종 농도가 포함되어 있습니다. 일반적으로, 6 웰 플레이트에서 배양을위한 배지 2 ㎖를 사용합니다. </li><li> 48 시간 시딩 후, 유도 매체를 내배엽 할 수있는 매체를 교체합니다. 매일 매체 변화에 또 다른 48 시간이 매체에 세포를 배양. 참고 :이 매체는 고급 RPMI-1640 배지에 1 % 글루타민, 0.2 % FCS 50 NG / ㎖ 티빈이 포함되어 있습니다. 최종 내배엽을 향해 최선을 다하고 있습니다 세포 표면 마커 CXCR4를 표현한다. CXCR4의 염색 DE 결정 세포 수를 정량화하는데 사용될 수있다. </li></ol><p클래스 = &quot;jove_title&quot;&gt; 2. 유동 세포 계측법 분석을위한 CXCR4 + 확실한 내배엽 세포의 염색 <ol><li> 수확 전 마지막 24 시간 그러나 최소한 1 시간 동안 세포 배양 배지에 10 μM의 ROCK 억제제를 추가합니다. </li><li> 코트 즉, 기저막 행렬 재 파종에 사용되는 세포 배양웨어, 면역 형광 염색법에 대한 qPCR에 분석 또는 챔버 슬라이드 12 웰 플레이트. 실온에서 적어도 30 분 동안 판 또는 슬라이드를 품어. </li><li> 오염 및 / 또는 정렬을 위해 사용되는 분화 된 세포의 웰에서 멸균 유리 파스퇴르 피펫으로 흡인 매체. </li><li> 세포 클러스터의 부드러운 해리에 대한 효소가없는 계대 솔루션 시약의 1 ML을 추가합니다. 세포를 작은 클러스터로 중단 뚜렷한 표시까지 CO 2, 37 ℃에서 인큐베이션하고 세포를 5 %. 주 : 배양 시간을 사용 시약에 따라 달라집니다. materi에 언급 된 효소가없는 계대 솔루션ALS 부는, 배양 시간은 약 7 분이다. </li><li> 1 ml의 DMEM / F-12 배지를 추가로 pipetting에 의해 1 ml의 팁을 사용하여 아래 하나의 세포로 세포 집합체 남아 방해. 표면으로부터 세포를 세척하고, 원심 분리 튜브에 세포를 전송하기 위해를 사용한다. 모든 셀을 검색하려면, / FCS 오 w DMEM / F-12 배지 1 ㎖ 잘 각각의 세척 및 원심 분리 튜브에 매체를 추가 할 수 있습니다. </li><li> 혈구를 사용하여 현미경으로 세포를 카운트. 6 잘 판의 세 우물에서 세포 분화의 삼일 후 10 ~ 15 × 10 6 세포에서 발생한다. g X 300에서 5 분간 세포를 원심 분리기. 참고 얻어지는 세포의 정확한 수는 사용 된 분화 다 능성 세포주에 의존 할 것이다. </li><li> 뜨는을 기음과 10 μM의 ROCK 저해제를 포함하는 PEB 버퍼에 세포를 재현 탁. 최대 10 7 세포에 대한 버퍼 100 μl를 사용합니다. staini의 날에 10 μM의 ROCK 저해제 추가NG. (PEB 버퍼 + RI 라 함) 모든 다운 스트림 응용 프로그램에 대한 버퍼를 사용합니다. 참고 : PEB 버퍼가 0.5 % BSA와 PBS에서 2 mM의 EDTA가 포함되어 있습니다. 이상의 세포가 염색 할 경우, 이에 따라 상기 버퍼 볼륨을 조절한다. </li><li> 이 약 1:10 희석을 대표하는 100 ㎕의 10 7 세포 당 CXCR4-APC 항체의 10 μl를 추가합니다. 참고 : APC 결합 항체의 사용은 필수가 아닙니다. 대신 사용 마이크로 비드에 따라 치환 될 수있다. 이상의 세포가 염색 될 경우 그에 따라 항체 량을 조정한다. </li><li> 부드럽게 손가락으로 튜브를 틀지하여 혼합하고 15 분 동안 냉장고에 4 ° C에서 품어. 1-2 ml의 PEB 버퍼와 세포를 재현 탁. g X 300에서 5 분간 세포를 원심 분리기. </li><li> 멸균 유리 파스퇴르 피펫으로 뜨는을 대기음 10 7 세포 당 80 μL의 PEB에있는 세포 펠렛을 resuspend 20 μl를 방지 APC 마이크로 비드를 추가합니다. 노트: </s이상의 세포가 염색 할 경우 tron​​g&gt; 따라서, 마이크로 비드 볼륨을 조절. </li><li> 부드럽게 손가락으로 튜브를 틀지하여 혼합하고 15 분 동안 냉장고에 4 ° C에서 품어. 1-2 ml의 PEB 버퍼 + RI와 세포를 재현 탁. g X 300에서 5 분간 세포를 원심 분리기. 버퍼를 대기음. 500 μL의 PEB 버퍼 + RI에 재현 탁. </li></ol> CXCR4 + 세포의 3. 자기 분리 <ol><li> 제조 지침에 따라 자기장에 중간 크기의 자석 열을 놓습니다. 500 μL의 PEB 버퍼 + RI와 열을 미리 씻어. 열에 전체 세포 현탁액을 적용합니다. 컬럼에 결합되므로, 모든 셀을 통해 유동을 수집한다. 확인 CXCR4 + 세포의 최적의 검색을 위해 열을 방해하지합니다. </li><li> 칼럼 500 μL의 PEB 버퍼 + RI로 3 회 씻는다. 내지 제 유동을 수집 단계 3.1에서 수집 된 세포와 결합. 자기장에서 자기 열을 제거하고에 배치적절한 포집 관. 컬럼에 1 ML의 PEB 버퍼 + RI를 추가합니다. 세포가 단단히 열에 플런저를 눌러 용출합니다. </li><li> 선택 사항 : 개별적으로 샘플을 통해 모든 흐름을 수집하고 유동 세포 계측법 사용 CXCR4 + 세포의 수를 분석하는 20 ㎕를 각각 사용한다. 그들의 수는 모든 세척 단계로 감소한다. 참고 : 적어도 2 × 10 4 가능한, 게이트 세포가 신뢰할 수있는 결과를 계산해야한다. </li><li> 반복 단계 3.1에서 샘플을 통해 수집 된 흐름과 새 열을 사용하여 단계 3.2에서 샘플을 통해 제 1 유동와 3.1-3.3 단계. 하지 마십시오 이전 칼럼을 다시 사용합니다. 플런저 공기를 사용하여이를 차단하는 열로 가압된다. </li><li> 혈구를 사용하여 현미경으로 세포를 카운트. 6 × 106 세포로 분화 최대의 효율에 따라 초기 정렬 및 절차 107 세포를 사용하는 경우 두 번째 열을 사용하여 다른 1 × 106 세포 수있다. </리&gt; <li> 5 분 동안 300 XG에 세포를 원심 분리기. 기음 뜨는 및 멸균 유리 파스퇴르 피펫와 추가로 10 μM의 ROCK 저해제와 단계 1.9에서 1 ml의 내배엽 유도 배지에서 세포를 재현 탁. </li><li> 혈구를 사용하여 현미경으로 세포를 카운트. 적절한 밀도로 세포를 시드 즉, ~ 12 웰 플레이트의 웰 당 4 × 10 5 세포 (응용 프로그램. 3.6 cm 2면) 또는 ~ 8 잘 챔버 슬라이드의 웰 당 1.5 × 10 5 세포. </li></ol> 4. 선택 사항 : 정제 된 결정적인 내배엽 인구의 분석 <ol><li> 면역 형광 염색법의 경우 약 24 시간 최종 내배엽 (DE) 및 / 또는 능성 마커 단백질 4 % 파라 포름 알데히드와 얼룩 시드 후 단계 3.7에서 정제 된 세포를 고정합니다. 참고 : 일반적으로 사용되는 DE 마커 FOXA2 및 SOX17을 포함, 일반적으로 사용되는 만능 마커는 OCT3 / 4, NANOG와 SOX2 6, 8을 포함한다. </li><li> FOR RT-qPCR에 분석, 직접 또는 24 시간 시딩 후 정제 된 세포를 수확 총-RNA 추출하고 추출 된 총-RNA 샘플에서의 cDNA를 전사 역. DE 및 다 능성 마커 유전자 (6), (8)의 발현을 분석하기 위해 RT-qPCR의 반응 (삼중) 당 10 ng의 주형으로서 cDNA를 사용합니다. 참고 : 일반적으로 사용되는 마커 유전자는 단계 4.1에 언급되어있다. 사이클 조건은 곡선 분석을 용융 다음 95 ℃에서 5 분, 95 ° C에서 15 초 40주기와 60 ° C에서 1 분입니다. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

현재 사용 분화 프로토콜은 거의 100 % 차별화 된 세포에서 발생합니다. 아직 해결해야 할 몇 가지 이유로 세포 분화 과정 레지스트. 사용 된 분화 프로토콜의 효율 및 ESC의 성향에 따라 잔류 다 능성 세포의 소정 수는 일반적으로, 심지어 최종 내배엽으로 분화 후에 관찰되는 광고. 이러한 잔류 세포는 transcriptomics, 단백질 체학 및 miRNA의 발현 분석 등 다운 스트림 분화 또는 추가 분석을 방해 할 수 ...

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포는 신체의 거의 모든 세포 유형으로 분화 할 수있는 능력을 가지고있다. 따라서, 생체 외 분화 프로토콜은 심근 1 간세포 2, 3 베타 세포, 폐 상피 4 또는 5 신경 세포 등 다양한 성인 세포 유형을 생성하기 위해 사용될 수있다. 이는 ESC에게 다양한 퇴행성 질환 (3)의 잠재적 인 치료를위한 유용한 도구를 만든다. 폐, 간, 췌장의 성인 조직으로는 ESC의 체외 분화는 최종 내배엽 (DE) 6 연상 세포로 의사 낭 배기가 필요합니다. 상기 체세포 유형 하류쪽으로 분화 상당히 비효율적이기 때문에, 최적의 내배엽 분화는 7 레이트 제한으로 간주된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 차를 받다이들 유전자 발현 프로파일 racteristic 변한다. 능성 마스터 조절 유전자 다운 규제 예 9. CXCR4가 된 Smad2 의해 transactivated 것으로 알려져 FOXA2, SOX17, HNF1B, GATA 가족 구성원과 CXCR4 높은 6 상향 조절되어 표면 수용체 (8)과 같은 다른 전사 인자의 발현 반면 / 3, 인해 프로모터 영역 (10)의 특정 결합 부위에 결절 / TGF-β 신호 및 SOX17의 하류. 따라서 리포트 6, 8, 11 ~ 13의 번호를 사용 매우 적합한 마커이다. 이러한 발현 변화는 ESC는 먼저 기본 연속 형 세포 집단의 특성을 획득하고이어서 배아 내배엽 층 (6)에 투입하는 의사 낭배 이벤트를 반영한다. 몇 세포가 분화 과정에 저항 또는 다른 의도하지 않은 계통 (14)으로 구별 할 수있다 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 이러한 세포 부정적인 influe있다후부 더 차별화. 또한, 잔여 미분화 세포는 나중에 이식 실험에 대한 큰 위험을 항구 및 기형 종 15-17을 야기 할 수 있습니다. 초기에 표면 마커 CXCR4 드 (18)를 향해 최선을 다하고 있습니다 세포의 정제에 사용할 수있는 이러한 원치 않는 세포를 제거합니다. 여기서는 DE 분화 배양에서 CXCR4 + 세포의 양성 선별을위한 방법을 설명한다. 이를 위해 표면 마커 CXCR4 후 다시 자성 마이크로 비드에 결합 된 항체에 의해 결합된다. FACS 정렬 동안 가혹한 조건 달리 자기 표지 DE 같은 세포를 쉽게 부드러운 정제 방법을 사용하여 벤치 탑 형태로 정제 될 수있다. 이 프로토콜은 DE 분화 과정 저항 세포 집단을 제거하기위한 간단한 방법을 제공한다.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포의 분화 능력은 세포 대체 요법에 대한 잠재적 인 치료 적 적용을 허용한다. 말단 분화 세포 유형. 각종 퇴행성 질환의 치료에 사용되는 폐, 간 및 췌장 조직을 향해 이러한 세포의 체외 분화는 첫 단계로 최종 내배엽 세포의 생성을 필요로 할 수있다. 이 단계는 속도 제한 인슐린 - 생산 베타 세포, 간세포 등 내배엽 유래의 세포 유형으로 말단 성숙 세포 유형 향해 더 분화된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 매우 같은 FOXA2, SOX17, HNF1B, GATA 가족의 구성원, 표면 수용체 CXCR4 같은 전사 인자의 군중을 표현한다. 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 여기서는 분화 후 CXCR4 + 세포군의 정제 방법을 서술자기 마이크로 비드를 사용하여 DE에. 이 정제는 또한 원치 않는 계통의 세포를 제거합니다. 부드러운 정제 방법은 신속하고 신뢰성 및 하류 어플리케이션 및 분화를 개선하는 데 사용될 수있다.

분화시 는 ESC 유전자와 단백질 발현의 급격한 변화를 겪는다. 1 성공적인 내배엽 분화를 확인하는 데 사용할 수있는 일반적인 마커 유전자를 보여주고있다. 유전자 발현 분석을위한 주요 목표 GSC, FOXA2 및 SOX17있다. 미분화는 ESC에 비해 상대적 유전자 발현 분석에서 특히 FOXA2 및 SOX17는&gt; 000 배 증가?...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

여기서는 하류 어플리케이션 및 상기 분화의 개선을위한 결정적인 내배엽으로 분화 노력하고 인간 배아 줄기 세포의 정제를위한 방법을 설명한다.

인간 배아 줄기 세포로부터 생성 된 내배엽 세포의 정제를위한 신속하고 효율적인 방법

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

8.3K 조회수.  Hannover Medical School.  여기서는 하류 어플리케이션 및 상기 분화의 개선을위한 결정적인 내배엽으로 분화 노력하고 인간 배아 줄기 세포의 정제를위한 방법을 설명한다. 

비디오: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

정상적인 대 장 암과 대 장 암-향상 된 프로토콜에서 인간의 내 피 세포의 고립

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

연구

암 연구학

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery에 의해 인간 배아 줄기 세포의 유도

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

생물학

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포에서 인간의 연결을 Progenitors과 뉴런의 효율 유도

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

신경과학

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

생체 외에서 Decidualization에 대 한 인간의 자궁내 막 기질 세포의 고립

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

발생학

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Decellularized 폐 공사장 공중 발판을 사용하여 ESC 파생 마우스기도 상피 세포의 생성

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

생체공학

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

인간 배아 줄기 세포 인구에서 Hepatocyte 같은 전지의 강력한 생성

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

고밀도의 인간 배아 줄기 세포 문화의 급속한 섬유 아세포 제거

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

배아 심실 내피 세포의 분리

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

iPSC에서 효율적인 인간 장 오가노이드 생성을 위한 매트릭스 비교

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

저자 스포트라이트: iPSC를 사용한 약물 개발을 위한 오가노이드 생성 발전

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

인간 줄기세포 유지와 장 오가노이드 생성을 위한 기저막 매트릭스의 비교 연구

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

인간 배아 줄기 세포로부터 생성 된 내배엽 세포의 정제를위한 신속하고 효율적인 방법

요약

더 많은 비디오 탐색

이 비디오의 챕터

정상적인 대 장 암과 대 장 암-향상 된 프로토콜에서 인간의 내 피 세포의 고립

Immunosurgery에 의해 인간 배아 줄기 세포의 유도

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포에서 인간의 연결을 Progenitors과 뉴런의 효율 유도

생체 외에서 Decidualization에 대 한 인간의 자궁내 막 기질 세포의 고립

Decellularized 폐 공사장 공중 발판을 사용하여 ESC 파생 마우스기도 상피 세포의 생성

인간 배아 줄기 세포 인구에서 Hepatocyte 같은 전지의 강력한 생성

고밀도의 인간 배아 줄기 세포 문화의 급속한 섬유 아세포 제거

배아 심실 내피 세포의 분리

인간 줄기세포 유지와 장 오가노이드 생성을 위한 기저막 매트릭스의 비교 연구

인간 줄기세포 유지와 장 오가노이드 생성을 위한 기저막 매트릭스의 비교 연구