Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00.000+00:00
Duration: 8 min 34 s
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

L&#39;assistenza tecnica abile di Jasmin Kresse è riconosciuto con gratitudine.

1. Differenziazione dei CES umana verso endoderma definitivo <ol><li> Coltivare cellule staminali embrionali umane (CES) in un incubatore a 37 ° C e 5% di CO 2. </li><li> Coat una nuova piastra di coltura cellulare 6 pozzetti con 1 ml di una matrice membrana basale e incubare la coltura-ware per almeno 30 minuti a temperatura ambiente. Per informazioni specifiche si prega di girare le istruzioni del rispettivo produttore. </li><li> Verificare che i CES umane coltivate hanno raggiunto l&#39;80% -90% di confluenza al microscopio con un ingrandimento basso (ad esempio, 4X). Aspirare il supporto dalle cavità succhiando via del mezzo con un bicchiere sterile Pasteur pipetta. Lavare le cellule una volta con una soluzione tampone fosfato (PBS). Per questo, aggiungere 2 ml di PBS a ciascun pozzetto dolcemente agitare la piastra e succhiare la soluzione per rimuovere le cellule morte e detriti cellulari. </li><li> Aggiungere 1 ml di reagente soluzione passaging senza enzima per dolce la dissociazione di gruppi di cellule. Incubare le cellule a 37 ° C und 5% di CO 2 fino a quando le cellule mostrano chiari segni di rottura in piccoli gruppi. NOTA: Il tempo di incubazione dipende dal reagente utilizzato. Per la soluzione passaging senza enzima citato nella sezione materiali, tempo di incubazione è di circa 7 min. </li><li> Aggiungere 1 ml DMEM / F-12 di media e disturbare gli altri aggregati di cellule in singole cellule pipettando su e giù con una punta della pipetta 1 ml. Usare questo per irrigare le cellule dalla superficie e trasferire le cellule a un tubo di centrifugazione. Per recuperare tutte le celle, lavare i pozzetti con 1 ml di DMEM / F-12 medio e aggiungere il mezzo al tubo di centrifugazione. </li><li> Centrifugare le cellule per 5 minuti a 300 x g. Aspirare il surnatante e risospendere le cellule in 5 ml di ES terreno di coltura cellulare contenente 10 mM Rho-chinasi (ROCK) inibitore. </li><li> Contare le cellule al microscopio utilizzando un emocitometro e sementi 150.000 - 400.000 cellule per 6 pozzetti o in un altro layout di piastra, a seconda della linea cellulare utilizzata ES. Usa culture terreno contenente inibitore ROCK 10 pM di evitare l&#39;apoptosi e la cultura nelle cellule in un incubatore a 37 ° C e 5% CO 2. </li><li> Circa 24 ore dopo la semina aspirare il terreno con uno sterile pipetta Pasteur di vetro e aggiungere 2 ml di terreno striscia di induzione primitiva. NOTA: Questo mezzo contiene concentrazioni finali di 1% glutamina, 0,2% FCS, 5 micron CHIR-99021 e 50 ng / ml activin A in avanzata RPMI-1640. Comunemente, usare 2 ml di terreno per la coltivazione in 6 pozzetti. </li><li> 48 ore dopo la semina, sostituire il mezzo per endoderma medio induzione. Coltivare le cellule in questo mezzo per altre 48 ore con cambio medio giornaliero. NOTA: Questo mezzo contiene 1% glutamina, 0,2% FCS e 50 ng / ml activina A in Advanced RPMI-1640. Le cellule che si sono impegnati verso l&#39;endoderma definitivo esprimono il marcatore di superficie CXCR4. La colorazione di CXCR4 può essere utilizzato per quantificare il numero di cellule disimpegnati. </li></ol><pclass = &quot;jove_title&quot;&gt; 2. La colorazione di CXCR4 + endoderma definitivo cellule per l&#39;analisi in citometria a flusso <ol><li> Per la finale 24 hr ma almeno 1 ora prima della raccolta delle cellule aggiungono inibitore ROCK 10 pM al mezzo di coltura. </li><li> Coat coltura-ware cellule che verrà utilizzato per la ri-semina con una matrice di membrana basale, cioè, piastre da 12 pozzetti per analisi qPCR o la camera di vetrini per immunofluorescenza. Incubare le piastre o le diapositive per almeno 30 minuti a temperatura ambiente. </li><li> Aspirare il mezzo con uno sterile pipetta Pasteur di vetro dai pozzi delle cellule differenziate utilizzati per la colorazione e / o l&#39;ordinamento. </li><li> Aggiungere 1 ml di reagente soluzione passaging priva di enzimi per il dolce di dissociazione di gruppi di cellule. Incubare le cellule a 37 ° C e 5% CO 2 finché le cellule mostrano evidenti segni di rottura in piccoli gruppi. NOTA: Il tempo di incubazione dipende dal reagente utilizzato. Per la soluzione passaging senza enzima di cui al Materisezione als, tempo di incubazione è di circa 7 min. </li><li> Aggiungere 1 ml DMEM / F-12 di media e disturbare restante aggregati di cellule in singole cellule pipettando su e giù con una punta di 1 ml. Usare questo per irrigare le cellule dalla superficie e trasferire le cellule a un tubo di centrifugazione. Per recuperare tutte le celle, lavare i pozzetti con 1 ml di DMEM / F-12 medio w / o FCS e aggiungere il mezzo al tubo di centrifugazione. </li><li> Contare le cellule sotto il microscopio con un emocitometro. Le cellule provenienti da tre pozzetti di una piastra da 6 pozzetti dovrebbero portare a 10-15 x 10 6 cellule dopo tre giorni di differenziazione. Centrifugare le cellule per 5 minuti a 300 x g. NOTA: Il numero esatto di cellule ottenute dipenderà dalla linea cellulare pluripotenti utilizzato per la differenziazione. </li><li> Aspirare il surnatante e risospendere le cellule in tampone PEB contenente inibitore ROCK 10 micron. Utilizzare 100 ml di questo buffer per un massimo di 10 7 cellule. Aggiungere l&#39;inibitore ROCK 10 pM del giorno di staining. Utilizzare questo buffer per tutte le applicazioni a valle (di seguito PEB tampone + RI). NOTA: tampone PEB contiene 0,5% BSA e 2 mM EDTA in PBS. Se più celle devono essere macchiati, regolare il volume di accumulo di conseguenza. </li><li> Aggiungere 10 ml di un anticorpo CXCR4-APC per 10 7 cellule in 100 microlitri, questo rappresenta circa una diluizione di 1:10. NOTA: L&#39;utilizzo di un anticorpo APC-linked non è obbligatoria. Invece può essere sostituito a seconda delle microsfere utilizzate. Se più celle devono essere macchiati regolare il volume anticorpi conseguenza. </li><li> Mescolare capovolgendo delicatamente il tubo con le dita e incubare a 4 ° C in frigorifero per 15 minuti. Risospendere le cellule con 1-2 ml di tampone PEB. Centrifugare le cellule per 5 minuti a 300 x g. </li><li> Aspirare il surnatante con un bicchiere sterile Pasteur pipetta e risospendere il pellet cellulare in 80 microlitri PEB per 10 7 cellule e aggiungere 20 microlitri anti-APC microsfere. NOTA: </sTrong&gt; Se più celle devono essere macchiato, regolare il volume micro-perline di conseguenza. </li><li> Mescolare capovolgendo delicatamente il tubo con le dita e incubare a 4 ° C in frigorifero per 15 minuti. Risospendere le cellule con 1-2 ml di PEB tampone + RI. Centrifugare le cellule per 5 minuti a 300 x g. Aspirare il buffer. Risospendere in 500 microlitri di buffer PEB + RI. </li></ol> 3. La separazione magnetica di CXCR4 + cellule <ol><li> Posizionare una colonna magnetica di medie dimensioni in un campo magnetico come da istruzioni di fabbricazione. Pre-lavare la colonna con 500 microlitri di buffer PEB + RI. Applicare l&#39;intera sospensione cellulare alla colonna. Raccogliere il flusso attraverso le cellule come non tutti lo legherà alla colonna. Fare attenzione a non disturbare le colonne per il recupero ottimale delle cellule CXCR4 +. </li><li> Lavare la colonna tre volte con 500 microlitri di buffer PEB + RI. Raccogliere il primo flusso attraverso e combinarlo con le cellule raccolte dal punto 3.1. Rimuovere la colonna magnetica dal campo magnetico e metterla in untubo di raccolta adatto. Aggiungere 1 ml di PEB tampone + RI sulla colonna. Per eluire le cellule premere con forza il pistone nella colonna. </li><li> Opzionale: Raccogliere tutte flusso attraverso campioni separatamente e 20 ml ciascuno di analizzare il numero di cellule CXCR4 + citometria a flusso. Il loro numero dovrebbe diminuire con ogni fase di lavaggio. NOTA: Almeno 2 x 10 4 praticabile, le cellule gated devono essere contati per ottenere risultati affidabili. </li><li> Ripetere i punti 3.1-3.3 con il flusso raccolte attraverso campione dal punto 3.1 e il primo flusso attraverso campione dal punto 3.2 con una nuova colonna. Non riutilizzare la colonna precedente. Utilizzando l&#39;aria stantuffo viene pressato nella colonna, che blocca. </li><li> Contare le cellule sotto il microscopio con un emocitometro. A seconda della efficienza della differenziazione fino a 6 x 10 6 cellule possono essere ordinati inizialmente e altre 1 x 10 6 cellule utilizzando una seconda colonna utilizzando 10 7 cellule per la procedura. </li&gt; <li> Centrifugare le cellule a 300 xg per 5 min. Aspirare il surnatante e con uno sterile Pasteur di vetro pipetta e risospendere le cellule in 1 ml di mezzo endoderma induzione dal punto 1.9 con l&#39;aggiunta di inibitore ROCK 10 micron. </li><li> Contare le cellule sotto il microscopio con un emocitometro. Seme le cellule ad una densità adeguata, vale a dire, ~ 4 x 10 5 cellule per pozzetto di una 12-pozzetti (app. 3,6 cm 2 di superficie) o ~ 1,5 x 10 5 cellule per pozzetto di un 8-ben camera-scivolo. </li></ol> 4. Opzionale: Analisi delle purificata Popolazione Endoderma definitiva <ol><li> Per immunofluorescenza fissare le cellule purificate dal punto 3.7 circa 24 ore dopo la semina con paraformaldeide al 4% e colorare per endoderma definitivo (DE) e / o proteine ​​marker pluripotenza. NOTA: comunemente usato DE marcatori includono Foxa2 e SOX17, marcatori pluripotenza comunemente usati includono Oct3 / 4, Nanog e SOX2 6, 8. </li><li> foanalisi R RT-qPCR, raccogliere le cellule purificate direttamente o 24 ore dopo la semina, estratto totale-RNA e reverse trascrivere cDNA dai campioni totale-RNA estratto. Utilizzare 10 ng cDNA come modello per reazione RT-qPCR (triplicato) per analizzare l&#39;espressione di DE e geni marcatori pluripotenza 6, 8. NOTA: i geni marcatori di uso comune sono menzionati al punto 4.1. condizioni del ciclo sono 5 min a 95 ° C e 40 cicli di 15 secondi a 95 ° C e 1 min a 60 ° C, seguita da analisi della curva di fusione. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

protocolli di differenziazione Attualmente utilizzati raramente si traducono in 100% di cellule differenziate. Per ragioni che devono ancora essere affrontate alcune cellule resistono il processo di differenziazione. A seconda della efficienza del protocollo differenziazione utilizzato e la propensione del CES linea un certo numero di cellule pluripotenti residue vengono comunemente osservato anche dopo differenziamento in endoderma definitiva. Queste cellule residue possono compromettere differenziazioni a valle o ulte...

Le cellule staminali pluripotenti come le cellule staminali embrionali (ESC) hanno la capacità di differenziarsi in qualsiasi tipo di cellula del corpo umano. Così, in vitro protocolli di differenziazione possono essere utilizzati per generare numerosi tipi cellulari adulto come cardiomiociti 1, epatociti 2, cellule beta 3, epiteliale polmonare 4 o cellule neuronali 5. Questo rende CES uno strumento prezioso per il potenziale trattamento di diverse malattie degenerative 3. La differenziazione in vitro dei CES verso tessuti adulti del polmone, del fegato e del pancreas richiede una pseudo-gastrulazione in cellule che ricordano l&#39;endoderma definitivo (DE) 6. Poiché differenziazione valle verso i suddetti tipi di cellule somatiche è molto meno efficienti, una differenziazione endoderma ottimale è considerata limitante 7. Le cellule che si sono impegnati nei confronti della stirpe endoderma subiscono chacambiamenti racteristic nel loro profilo di espressione genica. Maestri pluripotenza geni regolatori sono giù regolati, mentre l&#39;espressione di altri fattori di trascrizione, come Foxa2, SOX17, HNF1B era, i membri della famiglia GATA e il recettore di superficie CXCR4 è altamente upregulated 6, 8, 9. CXCR4 è noto per essere transactivated da SMAD2 / 3, a valle della nodale di segnalazione / TGF-β e SOX17 a causa di specifici siti di legame nella sua regione del promotore 10. Così è un marcatore molto adatto utilizzato in una serie di relazioni 6, 8, 11-13. Questi cambiamenti di espressione riflette un evento di pseudo-gastrulazione, in cui i CES prima acquisire caratteristiche di una popolazione di cellule striscia simile primitiva e, successivamente, si impegnano nello strato germinale endoderma 6. Tuttavia, i protocolli di differenziazione sono raramente efficiente al 100% come poche cellule possono resistere al processo di differenziazione o differenziare verso altre linee non intenzionali 14. Queste cellule possono Influe negativamentence ulteriore differenziazione. Inoltre, le cellule indifferenziate residue porto grandi rischi per i successivi esperimenti di trapianto e possono dar luogo a teratomi 15-17. Per rimuovere queste cellule indesiderate precoce sul marcatore CXCR4 superficie può essere utilizzato per la purificazione di cellule che si sono impegnati verso la DE 18. Qui, descriviamo un metodo per la selezione positiva di + cellule CXCR4 da De culture differenziazione. Per questo, il marcatore CXCR4 superficie è vincolato da un anticorpo che poi a sua volta si lega a microsfere magnetiche. A differenza delle dure condizioni durante FACS ordinamento, le cellule DE-come magneticamente etichettati possono quindi facilmente essere purificati in un formato da banco utilizzando un metodo di purificazione delicato. Questo protocollo fornisce un metodo semplice per la rimozione delle popolazioni cellulari che oppone il processo di differenziazione DE.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

Le capacità di differenziazione delle cellule staminali pluripotenti come le cellule staminali embrionali (ESC) permettono una potenziale applicazione terapeutica per le terapie di sostituzione cellulare. Terminally tipi di cellule differenziate potrebbero essere utilizzati per il trattamento di varie malattie degenerative. In vitro differenziazione di queste cellule verso tessuti del polmone, fegato e pancreas richiede come primo passo la generazione di cellule endodermico definitive. Questo passaggio è limitante per un&#39;ulteriore differenziazione verso tipi di cellule terminalmente maturate come le cellule beta produttrici di insulina, epatociti o altri tipi di cellule endoderma-derivati. Le cellule che si sono impegnati nei confronti della stirpe endoderma altamente esprimono una moltitudine di fattori di trascrizione come Foxa2, SOX17, HNF1B era, i membri della famiglia GATA, e il recettore CXCR4 superficiale. Tuttavia, i protocolli di differenziazione sono raramente efficiente al 100%. Qui, si descrive un metodo per la purificazione di una popolazione di cellule CXCR4 + dopo la differenziazionenella DE utilizzando microsfere magnetiche. Questa purificazione elimina inoltre le cellule di linee indesiderate. Il metodo di purificazione delicata è veloce e affidabile e può essere utilizzata per migliorare le applicazioni a valle e differenziazioni.

Su differenziazione CES subiscono drastici cambiamenti di espressione genica e proteica. La figura 1 illustra geni marcatori tipici che possono essere utilizzati per verificare una differenziazione endoderma successo. Obiettivi principali per l&#39;analisi di espressione genica sono GSC, Foxa2 e SOX17. In un parente analisi di espressione genica in particolare Foxa2 e SOX17 sono aumentate di&gt; 2.000 volte ...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Qui, si descrive un metodo per la purificazione delle cellule staminali embrionali differenziate umane che si sono impegnati verso l&#39;endoderma definitivo per il miglioramento delle applicazioni a valle e ulteriori differenziazioni.

Un metodo rapido ed efficace per la purificazione delle cellule endoderma generato da cellule staminali embrionali umane

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

8.3K Views.  Hannover Medical School.  Qui, si descrive un metodo per la purificazione delle cellule staminali embrionali differenziate umane che si sono impegnati verso l'endoderma definitivo per il miglioramento delle applicazioni a valle e ulteriori differenziazioni. 

Video: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

Isolamento di cellule endoteliali umane da Colon normale e Carcinoma colorettale - un protocollo migliorato

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Ricerca

Ricerca sul cancro

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivazione di cellule staminali embrionali umane da Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Biologia

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Derivazione efficiente di progenitori neuronali umane e Neuroni pluripotenti da cellule staminali embrionali umane con induzione piccole molecole

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Neuroscienze

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

Isolamento delle cellule stromali dell'endometrio umane per In Vitro decidualizzazione

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

Biologia dello sviluppo

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Generazione di cellule di topo Airway epiteliali ESC-derivati ​​dall&#39;uso di decellularized Lung Ponteggi

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Bioingegneria

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

Generazione robusta di epatociti-come le cellule da popolazioni di cellule staminali embrionali

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

Fibroblast rimozione veloce da alta densità Culture staminali embrionali umane

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Isolamento della embrionali ventricolari cellule endoteliali

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Confronto di matrici per la generazione efficiente di organoidi intestinali umani da iPSC

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

Autore in primo piano: Avanzamento della generazione di organoidi per lo sviluppo di farmaci con iPSC

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

Studio comparativo di matrici di membrana basale per il mantenimento di cellule staminali umane e la generazione di organoidi intestinali

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

Un metodo rapido ed efficace per la purificazione delle cellule endoderma generato da cellule staminali embrionali umane

Riepilogo

Esplora Altri Video

Capitoli in questo video

Isolamento di cellule endoteliali umane da Colon normale e Carcinoma colorettale - un protocollo migliorato

Derivazione di cellule staminali embrionali umane da Immunosurgery

Derivazione efficiente di progenitori neuronali umane e Neuroni pluripotenti da cellule staminali embrionali umane con induzione piccole molecole

Isolamento delle cellule stromali dell'endometrio umane per In Vitro decidualizzazione

Generazione di cellule di topo Airway epiteliali ESC-derivati dall'uso di decellularized Lung Ponteggi

Generazione robusta di epatociti-come le cellule da popolazioni di cellule staminali embrionali

Fibroblast rimozione veloce da alta densità Culture staminali embrionali umane

Isolamento della embrionali ventricolari cellule endoteliali

Studio comparativo di matrici di membrana basale per il mantenimento di cellule staminali umane e la generazione di organoidi intestinali

Studio comparativo di matrici di membrana basale per il mantenimento di cellule staminali umane e la generazione di organoidi intestinali

Un metodo rapido ed efficace per la purificazione delle cellule endoderma generato da cellule staminali embrionali umane

Riepilogo

Esplora Altri Video

Capitoli in questo video

Isolamento di cellule endoteliali umane da Colon normale e Carcinoma colorettale - un protocollo migliorato

Derivazione di cellule staminali embrionali umane da Immunosurgery

Derivazione efficiente di progenitori neuronali umane e Neuroni pluripotenti da cellule staminali embrionali umane con induzione piccole molecole

Isolamento delle cellule stromali dell'endometrio umane per In Vitro decidualizzazione

Generazione di cellule di topo Airway epiteliali ESC-derivati ​​dall'uso di decellularized Lung Ponteggi

Generazione robusta di epatociti-come le cellule da popolazioni di cellule staminali embrionali

Fibroblast rimozione veloce da alta densità Culture staminali embrionali umane

Isolamento della embrionali ventricolari cellule endoteliali

Studio comparativo di matrici di membrana basale per il mantenimento di cellule staminali umane e la generazione di organoidi intestinali

Studio comparativo di matrici di membrana basale per il mantenimento di cellule staminali umane e la generazione di organoidi intestinali

Generazione di cellule di topo Airway epiteliali ESC-derivati dall'uso di decellularized Lung Ponteggi