이 작품에 의해 지원 되었다 국립 과학 재단 부여 A.S. (뎁 #1427772, 1745411, 1750037).

1. 틱 컬렉션 및 표면 살 균
<ol><li>틱 틱 관련 서식, 진드기 제거에 1 m2 흰 헝겊을 끌어 호스트 종, 또는 실험실15,16틱 양육 수집. 미세 집게를 사용 하 여 진드기를 조작-80 ° c.에서 그들을 저장 하</li>
	<li>개별 PCR 튜브에 틱 하 고 15 vortexing에 의해 표면 오염 물질을 제거 연속적으로 과산화 수소 (H2O2), 70% 에탄올 및 ddH2오 500 μ s</li>
	<li>새로운 PCR 튜브에 진드기를 놓고 건조 하도록 허용 합니다.</li>
	<li>이 튜브에 기계적으로 박격포와 유 봉 (이 연구에 사용), 작은 구슬 구슬 때리는에 사용 하 여 진드기를 분쇄 하 여 틱 조직을 방해 또는 틱 메스와 떨어져 절단.</li>
</ol>2. DNA 정화
<ol><li>상업적으로 이용 가능한 DNA 추출 키트에 제공 된 지침에 따라 개별 틱에서 DNA를 정화. 100 μ의 최종 볼륨을 elute. 참고: 단계 2.2-2.8의 개요 그림 1 을 참조 하십시오. 대체 추출 방법에는 페 놀-클로 프롬 적 출17,18, 에탄올 강수량19또는 추출 chelating 소재20,21포함 됩니다.</li>
	<li>성공 DNA 정화 fluorometer 또는 분 광 광도 계를 사용 하 여 확인 합니다. Fluorometry, 190 μ 이중 가닥 DNA 분석 결과에서 DNA 템플렛의 10 μ를 사용 합니다. 예상된 수익률은 0.1-1.0 ng/μ22. 분 광 광도 학, 핵 산의 정량화에 DNA 템플렛의 1 μ를 사용 합니다. 예상된 A260/280 비율 약 1.823이다.</li>
	<li>증폭, 즉시 진행-20 ° c.에 샘플을 저장 하지 않을 경우</li>
</ol>3. 16S rRNA 유전자 증폭
<ol><li>포함 하는 27.5 μ 반응에서 PCR amplicon 설정: 1 μ M;에서 각 뇌관의 5 μ 상용의 12.5 μ PCR 혼합; 그리고 5 ng/μ 농도에 개별 틱에서 추출한 DNA의 5 μ. 참고 다음 프라이 머를 사용 하 여 16S rRNA 유전자13의 하이퍼 V3-V4 영역의 확대를 위한.: 5 '-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3' 5 '-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3'</li>
	<li>튜브에 대 한 프로그래밍 thermocycler 이동: 95 ° c 3 분;에 대 한 초기 변성 30 대 1) 95 ° C의 25 주기 s, 30 ° C 2) 57 s, 30 대 3) 72 ° C s; 5 분; 72 ° C에서 최종 확장 그리고 10 ° c.에 최종 보류</li>
	<li>PCR 완료 되 면, 4-6 μ/샘플 1.5 %agarose 젤에 로드 하 여 PCR 제품을 시각화. 460에서 밴드를 찾고 증폭을 확인 하는 혈압. 참고: Amplicon PCR 제품 보이지 않을 수 있습니다 젤에 샘플 농도 너무 낮은 경우 (< 10 ng). 뇌관 이합체 존재 낮은 농도 샘플에서 일반적 이다. 다른 비 목표 밴드 경우 어 닐 링 온도 조정 하거나 사이클의 수를 감소 합니다.</li>
	<li>정화, 즉시 진행 4 ° c.에 샘플을 저장 하지 않을 경우</li>
</ol>4. 16 Amplicon 정화
<ol><li>각 샘플에 대 한 새로운 PCR 튜브를 사용 하 여, 케이블의 PCR 제품을 ddH2O 총 60 μ를에 결합. 낮은 DNA 농도와 샘플에 대 한 증폭 바이어스를 줄이고 집중 샘플 수영장을 3 중 amplicon PCR을 수행 합니다.</li>
	<li>실내 온도 소용돌이 그들 사용 하기 전에 잘 상자성 구슬가지고.</li>
	<li>샘플의 60 μ에 상자성 구슬의 48 μ를 추가 하 고 5 분 장소 솔루션은 때까지 5 분에 대 한 자석 선반에 튜브 취소에 대 한 품 어. 제거는 상쾌한. 참고:이 구슬 농도 뇌관 이합체 (< 60 bp)의 제거 대상. 필요한 경우, 다른 일반적인 밴딩을 제거 하 비드 농도 조정 합니다.</li>
	<li>마그네틱 랙 튜브, 추가 갓 80%의 500 μ EtOH. 모든 튜브에 EtOH를 추가한 후 즉시 액체 밖으로 플라스틱. 비즈를 제거 하지 마십시오. EtOH 추가 및 제거 한 번 더 반복 합니다.</li>
	<li>5 분, 또는 작은 균열 구슬에 표시 됩니다 때까지 자석 선반에 튜브를 열어두고 여 초과 EtOH를 제거 하는 예제 건조</li>
	<li>TE 버퍼의 20 μ를 추가 하 고 5-10 분 동안 실내 온도에 자석에서 샘플을 품 어.</li>
	<li>자석에 다시 튜브를 놓습니다. 일단 구슬 및 액체 분리, PCR 제품을 청소를 얻으려면 신선한 튜브는 상쾌한 전송.</li>
	<li>(선택 사항) 4-6 μ/샘플 1.5% 젤에 로드 하 여 성공적인 amplicon 정화를 확인 하려면 제품을 시각화. 460 bp 밴드 표시, 고 아무 뇌관 이합체 이어야 한다.</li>
	<li>샘플을 저장 색인 PCR에 즉시 진행 하지, 4 ° c.</li>
</ol>5. 샘플 바코드 및 정화
<ol><li>앞으로 또는 반전 뇌관, 또는 상업적으로 사용 가능한 라이브러리 인덱스 키트에서 둘 다를 선택 하 여 각 샘플을 독특한 뇌관 조합을 할당 합니다. 참고: 고유 라벨 샘플 시퀀싱 후 차별화 수 있습니다. 키트는 일반적으로 충분 한 뇌관 96-384 샘플 시퀀스를 제공 합니다.</li>
	<li>듀얼 프라이 머, 또는 인덱스, 각 뇌관 (N7xx 및 S5xx), 12.5 μ 상용 PCR 마스터 믹스, ddH2O, 5 μ 그리고 청소 amplicon 제품의 2.5 μ의 2.5 μ를 포함 하는 25 μ 반응에서 PCR을 수행 하 여 샘플을 첨부 합니다.</li>
	<li>튜브에 대 한 프로그래밍 thermocycler 이동: 95 ° c 3 분;에 대 한 초기 변성 8-14 주기 1) 95 ° C 30에 대 한 s, 30 대 2) 55 ° C s 30 3) 72 ° C s; 5 분; 72 ° C에서 최종 확장 그리고 10 ° c.에 최종 보류</li>
	<li>PCR 완료 되 면, 4-6 μ/샘플 1.5 %agarose 젤에 로드 하 여 PCR 제품을 시각화. 550에 밴드를 찾고 증폭을 확인 하는 혈압. 참고: 인덱스 PCR 순환 상태를 시각화 결과 사용 합니다. 일반적인 바인딩 완화 또는 각 샘플에 대 한 보이는 밴드를 사이클 수를 증가 사이클 수를 낮춥니다.</li>
	<li>4 단계에서 나열 된 청소 절차를 반복 합니다. 정리 하는 동안 희석을 방지 하려면 중복에서 인덱스 PCR을 수행 하 고 제품 여기 수영장.</li>
	<li>즉시 라이브러리 정량화 및 정규화를 진행 4 ° c.에 샘플을 저장 하지 않을 경우</li>
</ol>6. 도서관 정량화 및 정규화
<ol><li>단계는 fluorometer 또는 분 광 광도 계를 사용 하 여 5.5에서 각 순화, 바코드 제품의 농도 추정 (단계 2.2 참조). 오후 1 시 약의 농도를 테 버퍼에서 샘플을 희석. 참고: 라이브러리 정량화는 시퀀싱 플랫폼에 권장 하는 농도 로딩 하는 샘플을 달성 하는 데 필요한. 도서관 부 량 정량을 통해 이루어집니다 하지만 시 약 및 시간 저장 정량 이전 샘플 농도 추정 합니다. 이 정량화 키트24에서 제공 하는 정량 기준의 평균 농도 1 오후 농도 라이브러리 정량화의 정확도 극대화 하기 위해 좋습니다.</li>
	<li>(라이브러리 정량화 kit)에서 정량 마스터 믹스, ddH2O, 2.0 μ 및 샘플 또는 표준의 2.0 μ의 6.0 μ를 포함 하는 10 μ 반응에서 정량 Pcr를 수행 합니다. 각 샘플 및 큰 정확도 정밀도 대 한 3 중에서 표준 실행 합니다. 세 개 이상의 희석 수준에서 각 샘플을 실행 (예., 오후 0 시 1 분, 1 오후, 그리고 10 오후 예상된 시작 농도 대 한) 정확한 정량화를 위해. 참고: 제공 된 뇌관 및 표준에 대 한 자세한 내용은 정량화 키트 사용에 따라 달라 집니다 및 제품 기술 데이터 시트에서 사용할 수 있습니다. 이 연구에 사용 된 정량화 키트에 대 한 테이블의 자료 를 참조 하십시오.</li>
	<li>프로그램에 대 한 실시간 PCR 악기를 정량 플레이트 또는 관 이동:; 5 분 동안 95 ° C의 초기 변성 1) 95 ° C의 35 주기 30 s와 45 2) 60 ° C에 대 한 s; 그리고 15 대 1) 95 ° C의 분리 단계 s, 30 대 2) 60 ° C, 및 3) 95 ° C 15에 대 한 s.</li>
	<li>시작 하는 농도 정량 결과에서 얻은 부 량 값과 사용 하는 샘플 희석 수준을 사용 하 여 각 샘플에 대 한 평균을 계산 합니다. 참고: 예를 들어 샘플 희석 1:100,000에 대 한 2pm의 평균 농도 수익률 200의 원래 시작 농도 nM. 부 량 결과; 정확 하지 않을 수 있습니다 주어진된 샘플에 대 한 희석 레벨의 범위 내에 표준 곡선의 경우, 어떤 경우에, 희석 레벨을 조정 하 고 다시 정량 Pcr을 수행.</li>
	<li>4 각 순화, 바코드 샘플 희석 단계 7.5에서에서 계산한 평균 농도에 따라 TE 버퍼에 nM. 참고: 예를 들면, 200의 평균 샘플 농도 nM, 희석 테에 샘플 1시 50분 4 nM 농도 달성 하기 위해 버퍼. 정확한 샘플 농도 시퀀싱 시스템 및 시 약 키트를 사용에 따라 달라 집니다. 권장된 농도 대 한 시퀀싱 시스템 사용자 설명서를 참조 하십시오.</li>
	<li>단일 관으로 모든 개별 라이브러리의 동등한 볼륨 (일반적으로 5-10 μ)을 추가 하 여 결합 된 라이브러리를 만듭니다. 참고: 모든 샘플 4 nM 농도에 있어야 해 서 동일한 볼륨 추가 풀링된 라이브러리에서 모든 샘플의 동등한 농도를 달성 한다.</li>
	<li>6.2-6.4 4 nM 농도 확인 하는 결합 된 라이브러리에 단계를 반복 합니다.</li>
	<li>결합 된 라이브러리 농도 계산 하 고 희석 또는 다시 4를 달성 하기 위해 필요한 Tris 버퍼를 사용 하 여 최종, 풀링된 라이브러리 구성 nM.</li>
	<li>즉시 샘플 로드를 진행-20 ° c.에 샘플을 저장 하지 않을 경우 손실 또는 변경 내용을 저장 하는 동안 DNA 농도 최소화 하기 위해 정량화 직후 실행 시퀀싱을 수행 합니다.</li>
</ol>7. 도서관 변성 및 희석, 고 시퀀싱 실행 (같은 날에 수행)
<ol><li>NaOH와 단계 6.9에서에서 4 nM 결합된 라이브러리 변성 주: 각 시퀀싱 시스템에 대 한 최종 라이브러리 준비 단계 다. 보다 상세 하 고 업데이트 된 프로토콜에 대 한 시퀀싱 시스템 사용자 가이드를 참조 하십시오. 새로운 사용자가 가능성이 시퀀싱 플랫폼의 사용에 훈련 될 필요가 있을 것 이다 또는 그들의 라이브러리 코어 시퀀싱 시설에 보낼 수 있습니다.</li>
	<li>시퀀싱 시 약 키트 (자료 테이블)에서 제공 하는 버퍼를 사용 하 여 원하는 로드 농도에 변성된 라이브러리를 희석. 참고: 최적의 로드 농도 시퀀싱 시스템 및 일반적으로 1-250 오후25범위에서 다릅니다.</li>
	<li>변성 고 시퀀싱 제어를 희석. 참고: 낮은 다양성 라이브러리에서 발생 하는 시퀀싱 문제에 대 한 수정 시퀀싱 제어를 추가 합니다. NaOH를 사용 하 여 시퀀싱 제어를 변성 하 고 도서관으로 동일한 농도에 희석.</li>
	<li>라이브러리 및 시퀀싱 제어를 결합 한다. 참고: 결합 된 라이브러리를 시퀀싱 제어의 비율 라이브러리 성과 시퀀싱 시스템 사용에 따라 달라 집니다 하지만 일반적으로 1:126.</li>
	<li>결합 된 라이브러리 및 시퀀싱 흐름 셀에 시퀀싱 제어 혼합물을 로드 합니다.</li>
</ol>8. Amplicon 시퀀스 분석
<ol><li>해당 시퀀싱 시스템 사용 하는 클라우드 컴퓨팅 환경에 실행된 통계를 검사 하 여 실행의 전반적인 성공을 평가 합니다. 참고: 연속 읽기 수 등 실행된 통계 시퀀싱 플랫폼 및 시 약 키트 사용에 따라 달라 집니다. 일반적인 시퀀싱 시스템에 대 한 목표 값은 표 1에 나열 됩니다.</li>
	<li>원시 시퀀싱 데이터를 다운로드 하 고 원하는 생물 정보학 오픈 소스 소프트웨어, 양적 통찰력 미생물 생태학 (QIIME)27 또는 Mothur28. 참고: 둘 다 QIIME와 Mothur는 오픈 소스 무료 다운로드. 이러한 프로그램을 사용 하 여 자세한 내용은 온라인 찾을 수 있습니다와 처음 사용자를 위한 상세한 충분히 있습니다. 다음 단계는 QIIME에서 실시 하는 생물 정보학 파이프라인에 대 한 광범위 한 개요를 제공 합니다. Python 친숙 하지만 필요 하지 않습니다 다음 스크립트의 구현을 용이 하 게 한다</li>
	<li>만들고 QIIME에 "validate_mapping_file.py" 스크립트를 사용 하 여 매핑 파일의 유효성을 검사 합니다. 참고: 매핑 파일 샘플 ID, amplicon 뇌관 시퀀스 및 샘플 설명을 포함 한 데이터 분석을 수행 하는 데 필요한 모든 메타 데이터를 포함 합니다. 유효성 검사 단계를 적절 한 형식에 필요한 모든 데이터가 입력 되었습니다 확인 합니다.</li>
	<li>Demultiplex 고 "split_libraries.py" 스크립트 (그림 1)를 사용 하 여 시퀀스를 필터링 합니다. 참고:이 스크립트 샘플 인덱스 뇌관 조합에 따라 바코드 읽기를 할당 하 고 샘플 Id 매핑 파일에서 입력. 그것은 또한 여러 품질 필터링 단계 오류 기반으로 사용자 정의 최소 품질 평가 점수, 시퀀스 길이, 및 최종-트리밍 컷 오프 시퀀싱에 대 한 제어를 수행 합니다.</li>
	<li>"Pick_open_references_otus.py" 스크립트를 사용 하 여 시퀀스에 조작 상 분류학 단위 (OTUs)를 할당 합니다. 참고:이 단계에서 시퀀스 id (일반적으로 97%)의 임계값에 따라 참조 시퀀스 컬렉션에 대 한 클러스터링 됩니다. 참조 시퀀스 컬렉션을 일치 하지 않는 읽기는 서로 대 한 클러스터링 됩니다. 드 노 보 및 폐쇄 기준 OTU 따기 옵션은 또한 사용할 수, 하지만 오픈 참조 따기 QIIME 개발자에 의해 권장 합니다.</li>
	<li>"Alpha_rarefaction.py" 또는 "normalize_table.py" 스크립트를 사용 하 여 OTU 테이블 정규화. 참고:이 단계는 열 합계에는 변형에 대 한 수정 또는 전체 순서 현대 시퀀싱 기술에서 발생 하는 샘플 당 읽습니다. 정규화는 전통적인 진공을 사용 하 여 수행할 수 있습니다 또는 누적 합계 스케일링 등 다른 방법을 통해.</li>
	<li>여러 알파-, 베타-다양성, 다양 성과 분류학 구성 다양성 분석 "core_diversity_analysis.py" 스크립트를 사용 하 여 한 번에 수행 합니다. 참고: 또는, 이러한 분석 실행할 수 있습니다 별도로 개별 스크립트를 사용 하 여 (예를 들어, "alpha_diversity.py").</li>
</ol>

저자는 공개 없다.

16S rRNA의 다음-세대 시퀀싱와 벡터 microbiomes 병원 체 전송에 미치는 영향의 연구 활성화 미생물 식별을 위한 표준 접근 되고있다. 여기에 설명 된 프로토콜 세부 I. pacificus, 라임 병;에 대 한 벡터 종에에서 미생물 커뮤니티 어셈블리를 조사 하기 위해이 메서드를 사용 하 여 그러나, 그것은 쉽게 다른 틱 종 또는 arthropod 벡터 종 연구에 적용할 수 있습니다.
실제로, 16S rRNA 시퀀싱 미생물 분석을 위한 벡터 모기, 체체파리 파리29,,3031, psyllids, 등의 microbiomes 연구를 광범위 하 게 사용 되었습니다. 벡터 내 미생물 확인을 위해 사용할 수 있는 다른 방법 등 현미경, 배양, 조직학에 게 얼룩이 지기. 이러한 메서드는 시퀀싱 목표 식별 및 설명 소설 미생물 (현미경), 항균 약물 (문화)의 효과 평가 하거나 (조직학 얼룩) 벡터 내에서 구체적이 고 알려진 미생물 지역화 하는 경우 보다 더 적절 한 수 있습니다. 그러나, 이러한 방법에서 낮은 특이성, 탐지, 및 확장성, 고통 그리고 따라서 덜 벡터 내에서 미생물의 전체 지역 사회를 식별 하거나 생태이 고 실험적인 다양 한에서 벡터 미생물 특성화에 적합 조건입니다. 반대로, 16S rRNA 유전자의 높 처리량 연속 낮은 풍요와 비 culturable 박테리아의 식별을 가능 하 게, 높은 해상도 포괄적인 참조 데이터베이스를 주어진 탐지 하며 높은 복제 따라 제공할 수 있습니다. 범위의 요구에
16S rRNA 시퀀싱은 지금은 널리 사용 되는 반면 미생물 식별,이 기술은 아니다 제한 없이. 주로, 미생물 오염 시퀀싱 결과의 해석 불분명 하 고 생물학 의미32혼동 수 있습니다. 또한, 주어진 보편적인 세균성 뇌관과 감도 사용 하 여 낮은 농도 16S rRNA 시퀀싱을 내재 하 고 있는 시작, 미생물 오염은 일반적인32. 오염 소스는 PCR 시 약, DNA 추출 키트, 실험실 표면 및 피부 및 연구원33,,3435의 의류를 포함합니다. 메 마른 환경에서 부정적인 컨트롤 및 기술 복제를 사용 하 여 협력 하 여 미생물 오염 물질의 효과 최소화할 수 있습니다 및36를 사용 모든 장비 및 시 약의 기록을 유지.
미생물 오염, 뿐만 아니라 고품질 시퀀싱 출력 크게 미생물 연속 데이터의 유용성을 방해 수 있습니다. 데이터 품질 실행된 통계 읽기 필터, 30, 및 클러스터 밀도의 Q-점수 (기본 호출에서 오류 예측된 확률의 측정) 위 읽기의 비율을 통과 수 등의 숫자에 의해 평가 될 수 있다. 이러한 통계에 대 한 값은 샘플 시퀀싱 시스템, 시 약 카트리지 및 % 컨트롤 사용, 시퀀싱, 실행의 수에 따라 달라 집니다 하지만 실행된 조건에 따라 최적의 값 온라인 사용할 수 있습니다. 특히, 클러스터 밀도, 시퀀싱, 이전 흐름 셀의 주어진된 평면에 라이브러리 클러스터 수 데이터 품질 및 수율을 최적화 하기 위한 키 매개 변수입니다. 둘 다 및에서 클러스터링 데이터 출력을 감소 하 고 샘플 때문에 부족 한 보도 분석에서 제외 되 고 결과 수 있습니다. 종종 부정확 한 라이브러리 정량화;을 반영 하는 불 쌍 한 클러스터 밀도 따라서, 치료는 적절 한 DNA 정리, 개별 샘플 정량화, 및 전체 도서관 정량화를 수행 하기 위해 취해야 한다.
높은 데이터 품질 및 수율 달성을 가정할 때, 분기 접근 방식을 큰 데이터 집합의 통계 문제를 해결 하는 데 사용 하는 데이터 분석에이 접근의 또 다른 한계 포즈. 예를 들어 여러 메서드 샘플 사이의 읽기 건의 주소 편차를 존재합니다. 서브 샘플링 모든 샘플에서 동일한 시퀀싱 깊이 달성 하기 위해 읽기 관련, 진공은 자주 사용 하지만 최근 데이터와 최소 시퀀싱 깊이37의 주관적인 선택의 다량을 낭비에 대 한 비판의 대상이 되었습니다. ,,3839. 스케일링 (CSS), 누적 합계 모든 시퀀스 읽지만 주어진된 백분위 수 내에서 누적 합계에 따라 그들의 무게를 유지 하는 대체 기술로 개발 되었습니다. 그러나, CSS는 널리 채택 되지 그 상대 참신 및 존재/부재 분석 하기 전에 정규화에 대 한 진공의 확인된 유틸리티.
표준 데이터 분석 절차는 또한 부정적인 컨트롤 시퀀스 읽기를 처리 및 낮은 풍부 읽기에서 이러한 구별에 대 한 부족 합니다. 앞에서 언급 했 듯이, 시퀀싱 부정적인 컨트롤 DNA 추출 단계에서 생성 된 것이 좋습니다 분석 중 미생물 오염 물질에서 진정한 벡터 미생물 거주자를 구분 하는 데 도움이. 그러나, 식별 및 필터링 의심된 오염 물질에 대 한 표준 및 통계적으로 엄격한 접근 부족 이다. 일반적인 방법은 OTUs 부정적인 컨트롤에 있는 모든 샘플에서 제거 하는 것입니다. 그러나,이 방법은 가능성이 이러한 미생물의 많은 키트 시 약40보다는 실제 샘플에서 발생 하는 때문에, 지나치게 보수적인 수 있습니다. 또 다른 일반적인 기술은 미생물 오염 물질 실제 샘플8,41에서 희소 하다 가정에 "희귀" 카테고리에 그룹화 미생물을 < 1%에 포함 한다. 그러나,이 메서드는 미생물 I. pacificus 그리고 I. holocyclus7,42. 에서 보듯이 endosymbiont에 의해 지배 된다 하는 경우에 특히 낮은 나타났는데에 존재 하는 진정한 벡터 미생물을 제거할 수 있습니다. 이러한 경우, 희귀 미생물 검출 필요 깊은 시퀀싱, amplicon PCR42, 동안에 endosymbiont의 확대를 억제 하는 뇌관을 개발 또는 계산 순서 분석 동안에 endosymbiont를 제거 7. 미생물 데이터 분석, 연구에서 결과 비교 하는 기능을 제한할 수 있습니다에서 주관과 편견에 대 한 기회를 만듭니다 OTUs 다양 한 희귀 주소로 방법 및 오염 물질 중 선택.
분류학과 계통 발생 정보 순서 읽기를 할당에 필요한 참조 데이터베이스의 선택과 주관에 대 한 또 다른 기회를 선물 한다. 변수 진 지역에서 확인 된 부모 게놈 시퀀스 읽기를 관련 된 작업은 본질적으로 도전, 신뢰할 수 있는 레퍼런스 데이터베이스 정확한 계통 발생 임무 결정적 이다. 여러 데이터베이스 실바43, Greengenes44, RDP45, NCBI46등이 과제를 나왔다. 실바는 RDP로 실바, 하지만 16S 기반 분류의 가장 큰만 속 수준 분류학 정보를 제공 합니다. Greengenes 종 수준 정보를 제공 하 고 QIIME, 같은 metagenomic 분석 패키지에 포함 되어 있지만 그것은 4 년 동안에 업데이트 되지 않은. NCBI, 분류학 정보에 대 한 기본 소스로 하는 동안 사용자가 제출한 시퀀스에서 매일 업데이트 분류 제공 하지만 그것은 큐레이터. 일반적으로 데이터베이스 중 선택, 범위, 및 통화에 대 한 사용자의 요구에 따라, 그것은 계통 발생 할당 및 다운스트림 분석47,48에 상당한 영향을 있습니다. 사용 하는 참조 데이터베이스에 관한 조사 간의 합의 이렇게 분석에 추가 바이어스를 피하는 것이 필수적.
이러한 데이터 처리 과제에 표준 접근 16S rRNA 시퀀싱 되는 점점 더 일반적인 기법으로 나타날 가능성이 것입니다. 시퀀싱 비용 및 시간에 지속적인된 감소가이 방법을 대중화 추가 됩니다. 이 기술의 증가 사용 구성과 다양 한 조건 하에서 벡터 microbiomes의 생태에 대 한 더 깊은 조사를 수 있게 된다. 아직도 그것의 유년기에 벡터 미생물 생물학의 지식으로 이러한 유형의 설명 연구는 선행 하는 벡터 제어의 수단으로는 미생물을 활용 하려고 중요 한 첫 번째 단계입니다. 그러나, 진정으로 병원 체 전송에서 미생물의 역할 이해, 미생물 식별은 이러한 미생물의 기능 역할의 지식으로 결합 해야 합니다. RNA 시퀀싱 transcriptomic 접근, 매핑 및 유전자 발현 측정을 포함 하는 미생물의 기능적 역할에 추론을 가능 하 게 하지만 깊은 시퀀싱을 필요로 하 고 대상 종의 게놈을 완벽 하 게 조립. 이러한 도전, 전산 도구 16S rRNA 시퀀싱 데이터 하지만 최근에 개발 되어 널리 채택 되지 않습니다 아직49에서 기능 구성 예측 우회. 생태 이론 뿐 아니라 이러한 도구를 개발, 미생물 id와 벡터 내의 기능적 역할 연결 벡터 미생물 연구에 16S rRNA 시퀀싱 데이터의 유틸리티를 증가할 것 이다.

부활과 벡터 품 어진 질병의 확산을 최근 몇 십년 간에서 글로벌 인간과 야생 동물의 건강에 심각한 위협이 포즈. 이 질병의 대부분에 대 한 효과적인 백신 부족 하 고 제어 노력 벡터와 벡터-호스트 상호 작용의 복잡 한 생물 학적 특성에 의해 방해. 병원 체 전송에서 벡터 내 미생물 상호 작용의 역할을 이해 이러한 문제를 회피 하는 새로운 전략의 개발에 대 한 수 있습니다. 특히, 벡터 관련 미생물 공생, symbionts, 병원 균, 미생물로 사이 상호 작용 병원 체 전송에 대 한 중요 한 결과가 있을 수 있습니다. 압도적인 증거를 이제 벡터 미생물과 질병 말라리아, Zika 바이러스, 그리고 라임 질병1,2,3에 대 한 능력 사이의 링크를 보여 주는 예제와 함께이 단언을 지원 합니다. 그러나, 질병 통제 예방 전략으로 이러한 결과 번역 구조, 기능, 및 벡터 microbiomes의 기원에 대 한 훨씬 더 상세한 이해를 요구 한다. 식별 및 다양 한 생태 및 실험 조건에서 벡터 미생물 커뮤니티의이 분야에서 앞으로 중요 한 경로 구성 합니다.
병원 체 벡터의 미생물 주민 확인을 위한 절차는 여기 서양 검은 다리 진드기, Ixodes pacificus, Lyme 질병 병원 체의 보렐 리아 burgdorferi종의 벡터를 이용 하 여 제공 됩니다. 틱 항구 다른 절지동물 보다 인간 병원 체의 더 많은 종류의, 하는 동안 상대적으로 작은 틱 microbiomes4의 생물학과 사회 생태에 대 한 알려져 있다. 그것은 분명 진드기 바이러스, 박테리아, 균 류, protozoans 공생, endosymbionts, 및 과도 미생물 주민5,4의 다양 한 배열을 항구. 이전 작업 Ixodes microbiomes 지리, 종, 성별, 생활 단계, 및 혈액 식사 소스6,,78와 관련 된 강력한 변화를 설명 했다. 그러나,이 변화를 기본 메커니즘 알 수와 자세한 출처의 조사와 이러한 미생물 커뮤니티의 보증 합니다. 틱 수직 전송을 통해 미생물을 수집할 수 있습니다 호스트 및 spiracles, 입, 항문 기 공9를 통해 환경에서 글귀와 접촉. 초기 형성 및 개발 틱 미생물의 형성 요인 이해, 특히 수직 및 환경 전송의 상대적 기여도 자연 패턴 및 눈금의 변화를 이해 하기 위한 중요 한 미생물 다양성 및 이러한 지역 사회 병원 체 전송, 질병 또는 벡터 제어 가능한 응용 프로그램 중 상호 작용 하는 방법.
차세대 시퀀싱 등 강력한 분자 기법, 지금 식별 미생물 지역 사회에 대 한 존재 하 고 다양 한 환경 또는 실험 조건에서 벡터 microbiomes 하 채택 될 수 있다. 이러한 높은 처리량 시퀀싱 접근의 출현 전에 미생물의 식별 현미경 검사 법 그리고 문화에 주로 의존 했다. 현미경 검사 법은 신속 하 고 쉽게 기술, 미생물을 식별 하기 위한 형태학 메서드는 본질적으로 주관적이 고 굵고 낮은 감도와 감지10제한. 문화 기반 방법 미생물 식별을 위해 광범위 하 게 사용 하 고 약물 치료11미생물의 감수 성을 결정 하는 데 사용 수 있습니다. 그러나,이 방법은 또한 겪고 있다 낮은 감도에서 환경 미생물의 2% 미만12설정 실험실에서 경작 될 수 추정 되었습니다. 조직학 얼룩 접근 감지 하 고 벡터 내에서 특정 미생물을 지역화, 틱, 내 다양 한 taxa 배포판의 조사 활성화 미생물 상호 작용에 대 한 가설을 공부 고용 또한 있다. 그러나, 미생물 정체성의 사전 지식을 적절 한 얼룩, 미생물 특성화 및 식별에 어울리지이 이렇게 만들기를 선택 하는 데 필요 합니다. 또한, 조직학 얼룩 매우 시간이 오래 걸리는, 힘 드는 프로세스 이며 큰 샘플 크기 위해 잘 확장 되지 않습니다. 생어 시퀀싱은 마찬가지로 그들의 감도 다양 한 미생물 커뮤니티의 탐지에서 제한 등 전통적인 분자 접근.
다음-세대 시퀀싱 샘플의 많은 수에서 미생물의 급속 한 식별 수 있습니다. 표준 표식 유전자 및 참조 데이터베이스 추가 하면 종종 단계로 속 또는 종의 분류학 해상도 향상. 작은 소 단위 ribosomal RNAs는 자주 16S rRNA 유전자 보존 및 가변 지역의 존재로 인해 가장 일반적인 각 세균에 대 한 독특한 amplicons 보편적인 뇌관의 창조에 대 한 허용으로이 목표를 달성 하는 데 사용 됩니다. 종13,14. 이 보고서는 16S rRNA 차세대 시퀀싱을 통해 틱 미생물에 taxa를 식별 하기 위한 절차를 자세히 설명 합니다. 특히,이 프로토콜 시퀀싱에 대 한 샘플 준비 단계를 강조 합니다. 더는 시퀀싱에 대 한 내용을 일반화 및 생물 정보학 단계 제공 됩니다, 현재 사용할 수 있는 다양 한 시퀀싱 플랫폼 및 분석 프로그램으로 각각의 광범위 한 기존 문서. 이 다음-세대 시퀀싱 방법의 전반적인 타당성은 주요 질병 벡터 내 미생물 커뮤니티 어셈블리의 조사에 적용 하 여 설명 했다.

<table><tbody><tr><td>Item</td><td>Name of Material/Equipment</td><td>Company</td><td>Catalog #</td></tr><tr><td>1</td><td>DNeasy Blood &amp;amp; Tissue Kit</td><td>Qiagen</td><td>69504</td></tr><tr><td>2</td><td>Qubit 4 Fluorometer</td><td>ThermoFisher Scientific</td><td>Q3326</td></tr><tr><td>3</td><td>NanoDrop 8000 Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-8000-GL</td></tr><tr><td>4</td><td>2x KAPA HiFi HotStart ReadyMix</td><td>Kapa Biosystems</td><td>KK2501</td></tr><tr><td>5</td><td>AMPure XP beads</td><td>Agen Court</td><td>A63880&amp;nbsp;</td></tr><tr><td>6</td><td>Magnetic Rack</td><td>ThermoFisher Scientific</td><td>MR02</td></tr><tr><td>6</td><td>TE buffer</td><td>Teknova</td><td>T0223</td></tr><tr><td>7</td><td>Nextera Index Kit</td><td>Illumina</td><td>FC-121-1011</td></tr><tr><td>8</td><td>KAPA Library Quantification Kit</td><td>Roche</td><td>KK4824</td></tr><tr><td>9</td><td>MiSeq System</td><td>Illumina</td><td>SY-410-1003</td></tr><tr><td>10</td><td>MiSeq Reagent Kit v3&amp;nbsp;</td><td>Illumina</td><td>MS-102-3001</td></tr><tr><td>11</td><td>10 mM Tris-HCl with 0.1% Tween 20</td><td>Teknova</td><td>T7724</td></tr></tbody></table>

tick microbiome characterization by next-generation 16s rrna amplicon sequencing

최근 수십 년간, 벡터 품 어진 질병이 다시 등장 있고 속도, 상당한 병 적 상태와 사망률 세계를 일으키는 놀라운 확대. 효과적이 고 널리 사용 가능한 백신은 소설 질병 완화 전략의 개발을 필요로 하는이 질병의 대부분 부족 합니다. 이 위해, 질병 통제의 한 유망한 애비뉴 벡터 미생물, 미생물 거주 벡터의 커뮤니티를 대상으로 포함 됩니다. 벡터 미생물 병원 체 역학에서 중추적인 역할을 담당 하 고는 미생물의 조작 벡터 품 어진 질병의 소수에 대 한 감소 된 벡터 풍부 또는 병원 체 전송 이어졌다. 그러나, 질병 제어 응용 프로그램에 이러한 결과 번역 벡터 미생물 생태학, 역사적으로이 분야에서 부족 한 기술에 의해 제한에 대 한 철저 한 이해를 필요 합니다. 차세대 시퀀싱 방법의 출현은 다양 한 미생물 커뮤니티의 급속 한, 높은 병렬 시퀀싱을 활성화 하 고 있다. 높은 보존 16S rRNA 유전자를 대상으로 다양 한 생태 및 실험 조건에서 벡터 내의 미생물의 characterizations 촉진 했다. 이 기술은 PCR, 시퀀싱, 흐름 셀에 로드 샘플 통해 샘플 바코드, 16S rRNA 유전자의 증폭과 생물 정보학 계통 발생 정보 시퀀스 데이터에 맞게 접근. 종 또는 속 수준 id 복제의 높은 숫자에 대 한 일반적으로 따라서 낮은 검출, 확인, 및 전통적인 경작, 현미경, 또는 조직학에 게 얼룩이 지기에서 출력의 문제를 우회 하는이 접근을 통해 달성 될 수 있다 기술입니다. 따라서,이 방법은 다양 한 조건 하에서 벡터 미생물을 특성화 하는 데 적합 하지만 현재 미생물 함수, 벡터, 또는 항생제 치료에 반응 내에서 위치 정보를 제공할 수 없습니다. 전반적으로, 16S 차세대 시퀀싱 정체성과 역할에서 질병 역학 벡터 미생물의 더 나은 이해를 위한 강력한 기술입니다.

총 3 개의 별도 달걀에서 42 틱 클러치 및 두 환경 노출 기간, 0과 토양, 2 주 미생물 시퀀싱에 대 한 처리 했다. 각 치료 그룹, 6-8 틱 샘플 복제를 포함 한 단일 클러치와 노출 시간으로 간주 됩니다. 이러한 처리 진드기 추출 물 다음-세대 시퀀서에 로드 된 하 고 필터를 통과 하는 12,885,713 쌍 간 읽기를 굴복. 이 실행에 포함 211,214 읽기 (이전 수에 포함)의 총 저조한 추출 단계에서 3 부정적인 컨트롤을 했다. 또한 각 통계에 대 한 최적의 값과 함께 실행된 품질 기준은 표 2에 자세히 나와 있습니다. OTUs는 시퀀싱 깊이, 또는 수의 독특한 시퀀스 샘플 당 읽습니다 2,129 읽기의 충분 한 것 미생물 지역 사회 (의 다양성을 적절 하 게 잡으려고 표시 샘플 당 수가 시퀀싱 노력 관련 진공 곡선 그림 2)입니다. 진공 레벨 샘플 형식에 따라 달라 집니다 그리고 각 연속 실행에 대 한 개별적으로 결정 되어야 합니다. 이 깊이 rarefying 후 1,714 OTUs 93.3 ± 4.3 OTUs 샘플 당 평균 모든 샘플에서 확인 되었다. 다운스트림 분석을 방지 하려면 모든 OTUs ≥ 1% 풍부에서 적어도 하나의 샘플에서 찾을 수 없습니다, 잠재적인 오염 물질을 제거 하 고 스파스 매트릭스에서 발생 하는 문제는 드문 일반 범주에 풀링된 했다. 또한, R에서 decontam 패키지 OTUs-실제 샘플, 상대적으로 부정적인 컨트롤에 표시를 식별 하기 위해 이용 되었다 그리고 이러한 OTUs 다운스트림 분석에서 제거 되었습니다.
사회 생태 분석 알파 다양성, 베타, 다양 성과 간단한 생물 정보학 파이프라인을 사용 하 여 생성 하는 분류 구성 다양성 출력의 종류를 보여 주기 위해 QIIME 다양성 분석 워크플로 사용 하 여 수행 했다. 예를 들어가 중 및 unweighted Unifrac 주 좌표 분석 "core_diversity_analyses.py" 스크립트를 사용 하 여 제작 하 고 애벌레 틱 클러치 id (그림 3)에 따라 공간 클러스터링을 밝혀. Boxplots의 OTU 시간별 (그림 4) 미생물 종 부유에 차이 보여주는 다양 한 환경 노출 시간 또한이 스크립트를 통해 생성 된 계산 합니다. 이들 알파와 베타 다양성 분석 매핑 파일에 나열 된 사용자 정의 범주에 따라 수행 됩니다 하지만 수치와 통계 일반 분류학 정보에 모든 샘플 (그림 5)에 대 한 생성 됩니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58239/58239fig1.jpg"> 그림 1 : 미생물 시퀀싱 워크플로. 미생물 시퀀싱 작업의 주요 단계 도서관 준비 및 시퀀싱 분석 단계에 대 한 설명선 표시 됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/58239/58239fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58239/58239fig2.jpg"> 그림 2 : 시퀀스에 대 한 진공 곡선 계산 정규화. 진공 곡선, 틱, 각 코 호트 표시 관찰된 OTU 건의 노력을 샘플링와 관련이 있습니다. 오차 막대는 각 클러치에서 현재 복제 샘플 때문 그리고 그들은 1 개의 표준 편차를 나타냅니다. 이상인 곡선 OTUs의 전체 다양성을 적절 하 게 잡으려고 안정 되는 지점에서 시퀀싱 깊이 선택 합니다. 여기, 2000 읽기의 시퀀싱 깊이 적절 한 나타납니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/58239/58239fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58239/58239fig3.jpg"> 그림 3 : 교장 분석 클러치로 조정입니다. Unweighted Unifrac 주 좌표 분석 (PCoA) 성인 및 다른 클러치에서 애벌레 틱 사이의 미생물 구성에 변화를 보여줍니다. 각 데이터 요소는 개별 틱을 나타냅니다. 이 그림은 QIIME "core_diversity_analyses.py" 스크립트를 통해 자동으로 생성 됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/58239/58239fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58239/58239fig4.jpg"> 그림 4 : 노출 시간으로 알파 다양성 boxplots. Boxplots OTU 묘사 시간이 지남에 미생물 다양성에 환경 노출 그룹 쇼 변화에 대 한 건의. 이 그림은 QIIME "core_diversity_analyses.py" 스크립트를 통해 자동으로 생성 됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/58239/58239fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58239/58239fig5.jpg"> 그림 5 : 한 클러치에 대 한 문 수준 미생물 id. 클러치 하나에서 개별 틱 샘플에 대 한 미생물 구성 문 수준에서 표시 됩니다. 이 그림으로 더 낮은 분류학 수준에서 요약 정보 자동으로 QIIME "core_diversity_analyses.py" 스크립트를 통해 생성 됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/58239/58239fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>통계</td>
			<td colspan="2">정의</td>
			<td>우리의 결과 (MiSeq V3)</td>
			<td>MiSeq v 3에 대 한 최적의</td>
			<td>HiSeq 빠른 모드에 대 한 최적의</td>
		</tr>
<tr>
<td>PF를 읽습니다.</td>
			<td colspan="2">시퀀싱의 수 순 필터 전달 읽습니다. 더 이상 1 기본 통화 처음 25 사이클에서 순 결 값 0.6 아래 경우 읽기 필터를 통과</td>
			<td>12,885,713</td>
			<td>14-16 백만</td>
			<td>600 백만</td>
		</tr>
<tr>
<td>오류 평가</td>
			<td colspan="2">읽기에 따라 기본 쌍 한 주기 동안 제대로 호출의 백분율 PhiX 컨트롤 정렬</td>
			<td>3.28 ±0.10</td>
			<td>* 다른 통계에 대 한 값에 따라 달라 집니다.</td>
			<td>* 다른 통계에 대 한 값에 따라 달라 집니다.</td>
		</tr>
<tr>
<td>% ≥Q30</td>
			<td colspan="2">99.9%의 정확도 기본 호출을 나타내는 Q 점수 ≥ 30, 기지의 비율</td>
			<td>68.94</td>
			<td>> 70%</td>
			<td>> 80%</td>
		</tr>
<tr>
<td>클러스터 PF (%)</td>
			<td colspan="2">순 결 필터를 통과 하는 클러스터의 백분율입니다.</td>
			<td>85.61 ±0.81</td>
			<td>90%</td>
			<td>90%</td>
		</tr>
<tr>
<td>밀도</td>
			<td colspan="2">Flowcell-데이터 품질 및 출력에 대 한 주요 통계에는 클러스터의 밀도</td>
			<td>552 ± 35 클러스터/mm ^2</td>
			<td>1200-1400 클러스터/mm ^2</td>
			<td>850-1000 클러스터/mm ^2</td>
		</tr>
</tbody></table>표 1: NGS 출력에 대 한 성능 매개 변수 키. 사용자 데이터 및 대상 값이이 연구 (자료 테이블)와 25% 시퀀싱 제어 추가에 사용 된 시퀀싱 플랫폼 및 시 약 키트에 따라 보고.

Watch this Scientific Journal Video about Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing at JoVE.com

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

여기 우리는 식별 및 벡터 내에서 미생물 커뮤니티의 16S rRNA 시퀀싱에 대 한 다음-세대 시퀀싱 프로토콜을 제시. 이 방법은 DNA 추출, 증폭 및 PCR, 시퀀싱 흐름 셀 및 생물 정보학에 계통 발생 정보를 시퀀스 데이터 일치를 통해 샘플의 바코드를 포함 한다.

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

tick-microbiome-characterization-next-generation-16s-rrna-amplicon

Universidad San Sebastian

Research

JoVE Journal

Biology

12.8K 조회수.  San Francisco State University. 여기 우리는 식별 및 벡터 내에서 미생물 커뮤니티의 16S rRNA 시퀀싱에 대 한 다음-세대 시퀀싱 프로토콜을 제시. 이 방법은 DNA 추출, 증폭 및 PCR, 시퀀싱 흐름 셀 및 생물 정보학에 계통 발생 정보를 시퀀스 데이터 일치를 통해 샘플의 바코드를 포함 한다.

비디오: Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

루트 미생물 탐색: 토양, Rhizosphere, 및 루트 Endosphere에서 세균성 지역 사회 데이터 추출

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

연구

유전학

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

인간의 우유 샘플의 타겟된 16S 시퀀싱 하는 방법

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...

면역학 및 감염병학

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the subcellular distribution of a specific tagged fluorescent marker in the secretory pathway. Arabidopsis is a powerful biological model for genetic studies because of its genome size, generation time, and conservation of molecular mechanisms among kingdoms. The array genotyping as an approach to map the mutation in alternative to the traditional method based on molecular markers is advantageous because it is relatively faster and may allow the mapping of several mutants in a really short time frame. This method allows the identification of proteins that can influence the integrity of any organelle in plants. Here, as an example, we propose a screen to map genes important for the integrity of the endoplasmic reticulum (ER). Our approach, however, can be easily extended to other plant cell organelles (for example see1,2), and thus represents an important step toward understanding the molecular basis governing other subcellular structures.

A fundamental quest in cell biology is to define the mechanisms that underlie the identity of the organelles that make eukaryotic cells. Here we propose a method to identify the genes responsible for the morphological and functional integrity of plant organelles using fluorescence microscopy and next-generation sequencing tools.

형광 - 현미경 검사와 차세대 장면 : Organelle 무결성에 관련된 유전자의 식별을위한 유용한 도구

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

생물학

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

16S 리보솜 RNA 유전자 증폭 산물의 차세대 시퀀싱

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA 메틸화 분석 차세대 시퀀싱 대상

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

세균 커뮤니티 특성화에 대한 효율적인 핵산 추출 및 16S rRNA의 유전자 시퀀싱

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

16S rRNA Amplicon 시퀀싱에 의해 배설물 미생물 특성화에 대 한 가이드 프로토콜

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

2단계 PCR 및 차세대 16S rRNA 유전자 시퀀싱을 사용한 미생물 분석

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

16S rRNA 시퀀싱: 박테리아 종 식별을위한 PCR 기반 기술

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...