Name: a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay
Uploaded: 2018-04-12T14:15:00.000+00:00
Duration: 8 min 26 s
Description: Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

이 작품은 상하이 과학 위원회 및 기술 (15411951800, 15410723200)에서 교부 금에 의해 지원 되었다. 저자 교수 YuMei 원 및 그들의 기술 지원에 대 한 병원 성 미생물과 복 단 대학 교수 차오 Zhao 감사 하 고 싶습니다.

이 메서드는 연구 윤리 위원회의 Huashan 병원, 복 단 대학교의 승인 된 지침에 따라 수행 되었다. 해당 표준 안전 조치는 각 단계에 따라 했다. 도식 프레 젠 테이 션, 그림 1을 참조 하십시오.
1. 세포 배양 및 플라스 미드 구조
<ol><li>정기적으로 유지 하는 Dulbecco에서 인간의 탯 줄 정 맥 내 피 세포 (HUVEC)이 글의 중간 (DMEM) 10% 태아 둔감 한 혈 청 (FBS), 페니실린, 100 단위/mL와 100 µ g/mL 스 습도 5%에서의 보완 수정의 CO2 배양 기 37 ° c.에</li>
	<li>PLKO.1 플라스 ApaI와 EcoRI shRNA 조각의 합성에 대 한 다이제스트. VHL shRNA 벡터의 oligonucleotide 시퀀스 CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14인지 확인 합니다.</li>
	<li>다음, 20 µΜ 시스템 올리고, 역방향 올리고의 5 µ L, 코 버퍼 x 10의 5 µ L ddH2O 함께 (총 볼륨은 50 µ L)의 35 µ L의 앞으로 5 µ L 믹스. 몇 시간에서 4 분, 그리고 천천히 실내 온도 아래로 냉각을 위한 98 ° C에 혼합물을 열.</li>
	<li>하룻밤을 위해 단련된 oligos 및 4 ° C에서 T4 리가 함께 PLKO.1 플라스 미드를 선. 16 h는 나중에, 25 µ L 유능한 DH5α 세포에 결 찰 믹스의 5 µ L를 추가 합니다. 그리고 성공적으로 합자 플라스 미드를 화면 연속 삽입 된 부분을 확인 합니다.</li>
</ol>2. lentivirus 패키지 및 감염
<ol><li>총, PLKO.1-shVHL 또는 PLKO.1 shScramble 벡터의 10 µ g, 7.5 µ g의 플라스 미드 psPAX2, 포장 및 봉투 플라스 미드 pMD2.G 태아 둔감 한 혈 청 (FBS) 25 분 없이 DMEM 미디어의 500 µ L에서의 2.5 µ g을 혼합.</li>
	<li>위의 준비 솔루션 FBS 없이 7 mLDMEM를 추가 합니다.</li>
	<li>10 cm 직경 조직 문화 요리에서 FBS 없이 DMEM 293 피트 셀 문화. 293 피트 셀 수 1 x 107 셀 카운터를 사용 하 여 있는지 확인 합니다.</li>
	<li>Transfection 293 피트 셀의 매체에 위의 준비 솔루션의 1 mL를 추가 합니다. 참고: 293 피트 셀 라인 293F 셀 라인에서 파생 되 고 안정적으로 SV40 큰 T 항 원을 표현 한다. 따라서, 그것은 lentiviral 생산을 위한 적합 한 호스트입니다.</li>
	<li>10% 포함 된 DMEM 문화 매체를 바꿉니다 6 h 후 FBS.</li>
	<li>Transfection 후 48 h에는 피 펫을 사용 하 여 미디어를 수집 합니다. 참고: 10% 포함 된 DMEM에 존재 하는 바이러스 FBS. 죽은 세포는 매체에 부동. 사용 하 여 0.45 μ m 살 균 막 죽은 세포 및 불순물 필터링. 일반적으로, 감염 (MOI)의 다양성을 확인할 필요가 있다. 이것은 안정 된 세포 선 확립 하입니다. 마지막 단계에서 성공적인 감염 없이 모든 살아있는 세포 puromycin에 의해 죽을 것 이다. ShScramble 그룹 및 HUVEC 세포는 제어 그룹. 모든 HUVEC 셀 72 h 사용된 puromycin 농도로 죽을 확인 합니다. 모든 잘 동일한 셀 수가 있다.</li>
	<li>HUVEC 셀 72 h lentiviral 미디어에 문화. 그런 다음 컨트롤 그룹으로 치료 없이 24 h. 사용 HUVEC 셀 2 µ g/mL의 농도에서 HUVEC 셀의 미디어를 puromycin를 추가 합니다. 모든이 시간 셀 다 제어를 확인 합니다. 참고: 살아있는 세포 VHL 최저의 세포와 shSramble 세포의 안정적인 셀 라인을 나타냅니다. 도금 밀도가입니다 96 잘 접시에 5000/잘.</li>
</ol>3입니다. 세대 내 피 세포 Spheroids의
<ol><li>HUVECs 셀 trypsinize 및 10 %DMEM 매체에 resuspend FBS. 10 cm 문화 접시에 있는 세포의 적당 한 수, typsin-EDTA의 1 mL를 추가 합니다.</li>
	<li>셀 셀 밀도 1 × 103 셀/3D 라운드 아래 96 잘 접시에 씨앗 회전 타원 체를 일시 중단 하려면 0.50 µ L의 회전 타원 체를 수용할 수 있는 우물을 사용 합니다. 제조업체의 지침에 따라 셀 카운터 시스템을 사용 하 여 셀을 계산 합니다.</li>
	<li>37 ℃에서 72 h에 대 한 지속적으로 5% CO2 셀을 품 어. 이러한 조건에서 일시 중단 된 세포 형성 자동으로 셀 spheroids 확인 합니다. 36 h 후 문화 매체의 절반을 교체 합니다.</li>
</ol>4. 체 외에서 신생 분석 결과
<ol><li>4 ° C에서 젤 솔루션을 해 동 하 고 희석 비율 1: 5의에 감소 된 혈 청 매체와 그것을 희석.</li>
	<li>Spheroids는 micropipette와 DMEM 배양에서 빨 아. 세척 후 감소 된 혈 청 매체의 5 mL와 함께 spheroids 일시 중지는 spheroids 부드럽게 그리고 조심 스럽게 희석된 젤에서. 없음 기포 확인 합니다.</li>
	<li>15-잘 접시에 혼합된 액체의 300 µ L를 포함 합니다. 37 ° C, 5% CO2 1 h에서 부 화, 후 각 우물에 400 µ L 감소 된 혈 청 매체를 추가 합니다. 메 마른 물 증발을 방해 하는 습도 환경 생성 우물 주위를 작성 합니다.</li>
	<li>그 후, 5% CO2 1 h 100% 습도에서 37 ° C에서 격판덮개 문화.</li>
	<li>신중 하 게 오래 된 매체를 발음 하 고 감소 된 혈 청 매체에 각 잘 1% 내 피 세포 성장 보충제와의 600 µ L로 합니다.</li>
	<li>12 시간 또는 24 시간 후 거꾸로 가벼운 현미경 이미지를 받아 (40 *).</li>
</ol>5. 데이터 분석
<ol><li>새싹 길이 데이터 (테이블의 재료)를 얻기 위해 온라인 이미지 분석 플랫폼에는 이미지를 업로드.</li>
	<li>웹 페이지에 전자 메일 계정을 만듭니다.</li>
	<li>다음 업로드 버튼을 클릭 하 여 이미지를 업로드 합니다.</li>
	<li>다운로드 버튼을 클릭 하 여 결과 다운로드 합니다. 참고: 소프트웨어 처리 이미지와 데이터를 생성 합니다. 5 부분을 포함 하는 데이터: 누적 새싹 길이, 평균 새싹 길이 길이 새싹, 새싹 영역 및 회전 타원 체 지역의 표준 편차. 처리 된 이미지에서 각 매개 변수 처리 이미지에서 식별을 쉽게 하기 위해 다른 색상으로 설명 하는: 빨간 나타냅니다 해골 콩나물, 콩나물의 수 노란, 파란 새싹 구조, 백색 새싹 끝, 및 오렌지 회전 타원 체.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

저자는 공개 없다.

최근, 혈관 생물학 연구의 여러 분야는 신생 endothelium15의 연구에 의해 자극 되었다. 이 문서에서는, 우리는 내 피 회전 타원 체의 소설 후보 분자 식별 하 조작 내 피 세포에서 기능의 VHL 유전자의 손실에서 유래 혈관 형성을 연구 하는 실험 모델 기법을 돋 아 개발에 신생 캐스케이드입니다. 우리의 지식 최선을이 endogenic 수정 된 내 피 세포의 신생 효과 검사 하는 첫 번째 보고서 ...

Hemangioblastomas (HBs)는 독점적으로 인간 중앙 신경 시스템 (CNS) 내에서 발견 되는 양성 혈관 종양. 그들은 폰 Hippel Lindau (VHL) 질병 또는 산발적 병 변 환자에서 개발. VHL HBs 빈번한 재발으로 인해 수술 치료를 통해 치료 하기 어려운 고 발생이 유전자 여러 병 변 장애1. VHL 종양 억제기 유전자의 비활성화 VHL HBs tumorigenesis의 근본 원인을 고려 하고있다, 비록 HBs의 진화 과정과 cytological 근원 (를 포함 하 여 neovascularization) 크게 논란이2남아 있다. 따라서, HB-신생 생물 학적 메커니즘의 더 나은 이해 VHL HBs에 대 한 가장 유망한 항 혈관 전략에 유용한 통찰력을 제공할 수 있습니다.
최근 연구는 건의 HB neovascularization가 vasculogenesis3,,45와 비슷합니다. 고전적인 혈관 내 피 성장 인자 (VEGF)-중재 신생 혈관 내 피에서 유래 하 고 그 기능의 VHL 손실에 의해 구동 됩니다 확산 귀착되 고 신생 형성 되었습니다 도전6. 1965 년, Cancilla와 짐머만, 전자 현미경 검사 법, HBs endothelium7에서 유래를 사용 하 여. 나중 stromal 세포 vasoformative 요소8에서 파생 됩니다 발견 했다. 1982 년에, Jurco 그 외 여러분 발견 stromal 세포 내 피 기원9. 따라서, 우리는 인간의 혈관 내 피 세포는 HB neovascularization10의 원래 세포 가설. HB 셀 VHL 환자 수술에서 파생 된에서 기본 문화권을 사용 하는 것이 낫다, 비록 우리의 이전 연구 표시는 HB에서 주 문화는, 셀 라인 설립된3수 없습니다. 또한, 3D 환경에서 주 문화는 HB 혈관 재료10,11의 창시자를 포함 하기 때문 HB neovascularization cytological 원산지를 식별 하지 수 없습니다. 따라서, 내 피 세포의 원시적이 고 고전적인 모델 인간의 혈관 내 피 세포 (HUVEC) 대체 세포 모델 HBs에 대 한 될 수 있습니다.
회전 타원 체 돋 아 분석 결과 조직 공학12,13에 새로운 모델입니다. 이 문서에는 3D 콜라겐 기반의 coculture 시스템에서 생체 외에서 분석 결과 돋 아 회전 타원 체를 사용 하 여 개발 되었다, 고전적인 종양 신생 HBs, HBs의 역할에 있는지 여부를 평가 하는 전반적인 목표.

<table><tbody><tr><td>human umbilical vein endothelial cell</td><td>Fudan IBS Cell Center</td><td>FDCC-HXN180</td><td></td></tr><tr><td>dulbecco&amp;rsquo;s modified eagle&amp;rsquo;s medium&amp;nbsp;</td><td>Gibco</td><td>11995040</td><td></td></tr><tr><td>fetal bovine serum</td><td>Gibco</td><td>&amp;nbsp;26400044</td><td></td></tr><tr><td>PLKO.1-puro vector</td><td>Addgene</td><td>#8453</td><td></td></tr><tr><td>packing plasmid psPAX2&amp;nbsp;</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>3D round-bottom 96-well plates</td><td>S-Bio</td><td>MS-9096M</td><td></td></tr><tr><td>matrigel</td><td>BD Biosciences</td><td>354234</td><td></td></tr><tr><td>Opti-MEM medium</td><td>Gibco</td><td>31985-070</td><td>reduced serum medium&amp;nbsp;</td></tr><tr><td>15-well plate</td><td>Ibidi</td><td>81501</td><td>Air bubbles in the gel can be reduced by equilibrating the &amp;mu;&amp;ndash;Slide angiogenesis before usage inside the incubator overnight</td></tr><tr><td>endothelial cell growth supplements</td><td>Sciencell</td><td>#1052</td><td></td></tr><tr><td>10-cm culture dish</td><td>Corning</td><td>Scipu000813</td><td></td></tr><tr><td>Puromycin</td><td>Gibco</td><td>A1113802</td><td></td></tr><tr><td>typsin-EDTA</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Automated Cell Counter System &amp;nbsp;</td><td>BioTech</td><td></td><td></td></tr><tr><td>Image Analysis software&amp;nbsp;</td><td>Winmasis</td><td></td><td>http://mywim.wimasis.com&amp;nbsp;</td></tr></tbody></table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

폰 Hippel Lindau (VHL) 종양 억제기 유전자의 비활성화 인간 중앙 신경 시스템 (CNS) 내에서 hemangioblastomas (HBs)의 개발에 중요 한 역할을 하고있다. 그러나, cytological 근원 그리고 HBs (neovascularization 포함)의 진화 과정 남아 논란, 그리고 안티-신생 VHL-HBs, 고전적인 HB 신생에 기반에 대 한 임상 시험에서 실망 스러운 결과 생산 했습니다. 반대로 혈관 치료의 성공적인 임상 번역 한 주요 장애물이 neovascularization 혈관이 종양에의 한 철저 한 이해의 부족 이다. 이 문서에서는, 우리가 여부를 평가 체 외에 고전적인 종양 신생 HBs, HBs의 역할에 있는 포괄적인 절차 제시. 이 절차와 연구원 수 정확 하 게 HB neovascularization의 복잡성을 이해 하 고이 일반적인 형태의 HBs에 신생의 함수를 식별. 이러한 프로토콜 있는 잠재력이 높은 변환 종양 치료 또는 HBs에 대 한 안티-신생 치료의 최적화에 돕고 미래에 번역에 대 한 종양을 위한 가장 유망한 항 혈관 치료를 평가 하기 위해 사용할 수 있습니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 양식 신생 HB neovascularization만 보완 메커니즘.

거꾸로 가벼운 현미경에 의해 원래 이미지를 가져옵니다. VHL 그룹과 컨트롤 그룹의 전형적인 이미지는 그림 2에 표시 됩니다-A1 및 그림 2-A2. 컨트롤 그룹의 돋 아 길이 VHL 그룹 보다 짧습니다.
이미지를 업로드 후 온라인 플랫폼 직접 분석 결과 제공 합니다....

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

분석 결과 돋 아 회전 타원 체를 사용 하 여 상 상속 Hemangioblastoma Neovascularization의 생체 외에서 성능을 평가 하는 포괄적인 절차

이 종이 여부를 평가 체 외에 고전적인 종양 신생 hemangioblastomas (HBs)와 HBs에서의 역할에 있는 포괄적인 절차를 제공 합니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 형태의 신생 HB neovascularization만 보완 메커니즘.

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Universidad San Sebastian

Research

JoVE Journal

Cancer Research

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

7.9K 조회수.  Fudan University. 이 종이 여부를 평가 체 외에 고전적인 종양 신생 hemangioblastomas (HBs)와 HBs에서의 역할에 있는 포괄적인 절차를 제공 합니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 형태의 신생 HB neovascularization만 보완 메커니즘.

비디오: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

A 3D Spheroid Model as a More Physiological System for Cancer-Associated Fibroblasts Differentiation and Invasion In Vitro Studies

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor stroma, host fibroblasts are stimulated by cancer cells to differentiate. Thus, they acquire a phenotype that contributes to the tumor microenvironment and supports tumor progression. By using the spheroid model, we have set up such a 3D in vitro model system, in which we analyzed the role of laminin-332 and its receptor integrin &#945;3&#946;1 in this differentiation process. This spheroid model system not only reproduces the tumor microenvironment conditions in a more accurate way, but also is a very versatile model since it allows different downstream studies, such as immunofluorescent staining of both intra- and extracellular markers, as well as deposited extracellular matrix proteins. Moreover, transcriptional analyses by qPCR, flow cytometry and cellular invasion can be studied with this model. Here, we describe a protocol of a spheroid model to assess the role of CAFs&#39; integrin &#945;3&#946;1 and its ectopically deposited ligand, laminin-332, in differentiation and in supporting the invasion of pancreatic cancer cells.

The goal of this protocol is to establish a 3D in vitro model to study the differentiation of cancer-associated fibroblasts (CAFs) in a tumor bulk-like environment, which can be addressed in different analysis systems, such as immunofluorescence, transcriptional analysis and life cell imaging.

3D 스페로이드 모델은 시험관 내 암 관련 섬유아세포 분화 및 침입을 위한 보다 생리적 시스템으로

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor ...

연구

암 연구학

A 3D Spheroid Model for Glioblastoma

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were developed. These models may be particularly important in the field of neuro-oncology. Indeed, brain tumors have the tendency to invade the healthy brain environment. We describe herein an ideal 3D glioblastoma spheroid-based assay that we developed to study tumor invasion. We provide all technical details and analytical tools to successfully perform this assay.

Here, we describe an easy-to-use invasion assay for glioblastoma. This assay is suitable for glioblastoma stem-like cells. A Fiji macro for easy quantification of invasion, migration, and proliferation is also described.

교모세포종을 위한 3D 스페로이드 모형

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were ...

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including embryogenesis and development, wound healing, tumor growth and metastasis, and ocular and cardiovascular diseases. Effective in vitro models that recapitulate the biology of angiogenesis are needed to appropriately study this process and identify mechanisms of regulation that can be ultimately targeted for novel therapeutic strategies. The bead angiogenesis assay has been previously demonstrated to recapitulate the multiple stages of endothelial sprouting in vitro. However, a limitation of this assay is a lack of endothelial &#8211; mural cell interactions, which are key to the molecular and phenotypic regulation of endothelial cell function in vivo. The protocol given here presents a methodology for the incorporation of mural cells into the bead angiogenesis assay and demonstrates a tight association of endothelial cells and pericytes during sprouting in vitro. The protocol also details a methodology for effective silencing of target genes using siRNA in endothelial cells for mechanistic studies. Altogether, this protocol provides an in vitro assay that more appropriately models the diverse cell types involved in sprouting angiogenesis, and provides a more physiologically-relevant platform for therapeutic assessment and novel discovery of mechanisms of angiogenesis regulation.

This protocol presents a novel in vitro bead assay that more appropriately models the process of in vivo sprouting angiogenesis by incorporating pericytes. This modification enables the bead assay to more faithfully recapitulate the heterotypic cellular interactions between endothelial cells and mural cells that are critical for angiogenesis.

분석 결과 돋 아 내 피 세포 구슬 Pericytes 통합

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including ...

발생학

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more than 50 different pathological conditions, such as rheumatoid arthritis, oculopathy, cardiovascular diseases, and tumor metastasis. During angiogenesis drug development, it is crucial to use in vitro assay systems with appropriate cell types and proper conditions to reflect the physiologic angiogenesis process. To overcome limitations of current in vitro angiogenesis assay systems using mainly endothelial cells, we developed a 3-dimensional (3D) co-culture spheroid sprouting assay system. Co-culture spheroids were produced by two human vascular cell precursors, endothelial colony forming cells (ECFCs) and mesenchymal stem cells (MSCs) with a ratio of 5 to 1. ECFCs+MSCs spheroids were embedded into type I collagen matrix to mimic the in vivo extracellular environment. A real-time cell recorder was utilized to continuously observe the progression of angiogenic sprouting from spheroids for 24 h. Live cell fluorescent labeling technique was also applied to tract the localization of each cell type during sprout formation. Angiogenic potential was quantified by counting the number of sprouts and measuring the cumulative length of sprouts generated from the individual spheroids. Five randomly-selected spheroids were analyzed per experimental group. Comparison experiments demonstrated that ECFCs+MSCs spheroids showed greater sprout number and cumulative sprout length compared with ECFCs-only spheroids. Bevacizumab, an FDA-approved angiogenesis inhibitor, was tested with the newly-developed co-culture spheroid assay system to verify its potential to screen anti-angiogenic drugs. The IC50 value for ECFCs+MSCs spheroids compared to the ECFCs-only spheroids was closer to the effective plasma concentration of bevacizumab obtained from the xenograft tumor mouse model. The present study suggests that the 3D ECFCs+MSCs spheroid angiogenesis assay system is relevant to physiologic angiogenesis, and can predict an effective plasma concentration in advance of animal experiments.

Three-dimensional co-culture spheroid angiogenesis assay system is designed to mimic the physiologic angiogenesis. Co-culture spheroids are formed by two human vascular cell precursors, ECFCs and MSCs, and embedded in collagen gel. The new system is effective for evaluating angiogenic modulators, and provides more relevant information to the in vivo study.

내피 콜로니 형성 세포및 중간엽 줄기 세포에 의해 형성된 공동 배양 스페로이드를 이용한 3차원 혈관신생 분석 시스템

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more ...

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens are performed on cells grown in a monolayer. However, these two-dimensional (2D) models are considered less accurate compared to three-dimensional (3D) spheroid cell models; this is especially true for glioma stem cell lines. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening of spheroid lines; mouse and human glioma stem cell lines are used as an example. This protocol describes a 3D spheroid drug sensitivity and synergy assay that can be used to determine if a drug or drug combination induces cell death and if two drugs synergize. Glioma stem cell lines are&#160;modified to express RFP. Cells are plated in low attachment round well bottom 96 plates, and spheres are allowed to form overnight. Drugs are added, and the growth is monitored by measuring the RFP signal over time using the Incucyte live imaging system,&#160;a fluorescence microscope embedded in the tissue culture incubator. Half maximal inhibitory concentration (IC50), median lethal dose (LD50), and synergy score are subsequently calculated to evaluate sensitivities to drugs alone or in combination. The three-dimensional nature of this assay&#160;provides a more accurate reflection of tumor growth, behavior, and drug sensitivities in vivo, thus forming the basis for further preclinical investigation.

In vitro drug sensitivity screens are important tools for discovering anti-cancer drug combinations. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening for spheroid lines.

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens ...

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in particular (e.g., brain tumors such as glioblastoma multiforme and squamous cell carcinoma of the head and neck &#8211; SCCHN) it is a cause of severe morbidity and can be life-threatening even in the absence of distant metastases. In addition, cancers which have relapsed following treatment unfortunately often present with a more aggressive phenotype. Therefore, there is an opportunity to target the process of invasion to provide novel therapies that could be complementary to standard anti-proliferative agents. Until now, this strategy has been hampered by the lack of robust, reproducible assays suitable for a detailed analysis of invasion and for drug screening. Here we provide a simple micro-plate method (based on uniform, self-assembling 3D tumor spheroids) which has great potential for such studies. We exemplify the assay platform using a human glioblastoma cell line and also an SCCHN model where the development of resistance against targeted epidermal growth factor receptor (EGFR) inhibitors is associated with enhanced matrix-invasive potential. We also provide two alternative methods of semi-automated quantification: one using an imaging cytometer and a second which simply requires standard microscopy and image capture with digital image analysis.

Three-Dimensional 3D Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is a defining characteristic of malignant tumors. We provide here a simple, semi-automated micro-plate assay of invasion into a natural 3D biomatrix that has been exemplified with a number of models of advanced human cancers.

3 차원 (3D) 종양 회전 타원체 침공 분석

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in ...

의학

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the spheroid cultures, a perfusable vascular network in the spheroids remains a critical challenge for long-term culture required to maintain and develop their functions, such as protein expressions and morphogenesis. The protocol presents a novel method to integrate a perfusable vascular network within the spheroid in a microfluidic device. To induce a perfusable vascular network in the spheroid, angiogenic sprouts connected to microchannels were guided to the spheroid by utilizing angiogenic factors from human lung fibroblasts cultured in the spheroid. The angiogenic sprouts reached the spheroid, merged with the endothelial cells co-cultured in the spheroid, and formed a continuous vascular network. The vascular network could perfuse the interior of the spheroid without any leakage. The constructed vascular network may be further used as a route for supply of nutrients and removal of waste products, mimicking blood circulation in vivo. The method provides a new platform in spheroid culture toward better recapitulation of living tissues.

The protocol describes how to engineer a perfusable vascular network in a spheroid. The spheroid's surrounding microenvironment is devised to induce angiogenesis and connect the spheroid to the microchannels in a microfluidic device. The method allows the perfusion of the spheroid, which is a long-awaited technique in three-dimensional cultures.

미세 소자에서 조직 모델 perfusable 혈관 네트워크

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the ...

생체공학

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current in vitro screening models that have sufficient throughput only have limited physiological relevance, which hinders the translation of findings from in vitro to in vivo. On the other hand, microfluidic cell culture platforms have shown unparalleled physiological relevancy in vitro, but often lack the required throughput, scalability and standardization. We demonstrate a robust platform to study angiogenesis of endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) in a physiological relevant cellular microenvironment, including perfusion and gradients. The iPSC-ECs are cultured as 40 perfused 3D microvessels against a patterned collagen-1 scaffold. Upon the application of a gradient of angiogenic factors, important hallmarks of angiogenesis can be studied, including the differentiation into tip- and stalk cell and the formation of perfusable lumen. Perfusion with fluorescent tracer dyes enables the study of permeability during and after anastomosis of the angiogenic sprouts. In conclusion, this method shows the feasibility of iPSC-derived ECs in a standardized and scalable 3D angiogenic assay that combines physiological relevant culture conditions in a platform that has the required robustness and scalability to be integrated within the drug screening infrastructure.

This method describes the culture of iPSC-derived endothelial cells as 40 perfused 3D microvessels in a standardized microfluidic platform. This platform enables the study of gradient-driven angiogenic sprouting in 3D, including anastomosis and stabilization of the angiogenic sprouts in a scalable and high-throughput manner.

iPSC 유래 내피 세포의 퍼퓨비드 3D 혈관신생 발아연구를 위한 표준화 및 확장 성 분석

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current ...

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell (EC) proliferation assays using human retinal microvascular endothelial cells (HRMECs) or isolated primary retinal ECs are widely used in vitro models to study retinal angiogenesis. However, isolating pure murine retinal endothelial cells is technically challenging and retinal ECs may have different proliferation responses than choroidal endothelial cells and different cell/cell interactions. A highly reproducible ex vivo choroidal sprouting assay as a model of choroidal microvascular proliferation was developed. This model includes the interaction between choroid vasculature (EC, macrophages, pericytes) and retinal pigment epithelium (RPE). Mouse RPE/choroid/scleral explants are isolated and incubated in growth-factor-reduced basal membrane extract (BME) (day 0). Medium is changed every other day and choroid sprouting is quantified at day 6. The images of individual choroid explant are taken with an inverted phase microscope and the sprouting area is quantified using a semi-automated macro plug-in to the ImageJ software developed in this lab. This reproducible ex vivo choroidal sprouting assay can be used to assess compounds for potential treatment and for microvascular disease research to assess pathways involved in choroidal micro vessel proliferation using wild type and genetically modified mouse tissue.

This protocol presents choroid sprouting assay, an ex vivo model of microvascular proliferation. This assay can be used to assess pathways involved in proliferating choroidal micro vessels and assess drug treatments using wild type and genetically modified mouse tissue.

안구 미세 혈관 신생의 전 비보 코로이드 발아 분석

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell ...

생물학

Scratch Wound Migration 및 Spheroid Srouting Assay를 이용한 혈관신생 연구

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

저자 스포트라이트: Investigating Angiogenesis Through Challenges and Innovations in Assay Development(분석 개발의 과제와 혁신을 통한 혈관신생 조사)

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Scratch Wound Migration Assay와 Spheroid Sprouting Assay를 활용하여 기능적, 분자적 수준에서 혈관신생을 조사합니다.

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...