Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00.000+00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

우리 감사 Alessandro Cellerino, 타이론 Genade, 앤 검은 머리, 사 브리 나 샤 프, 미키 파월, 시몬 Keil, 김 유미, 패트릭 스미스, 카이 Mathar 및 Valenzano 연구소의 모든 구성원 막스 플랑크 연구소에서 노화의 생물학에 대 한 다양 한 측면에 기여 년 동안 현재 송사리 축산 프로토콜.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

모든 저자는 아무 경쟁 금융 및 비 금융 관심사를 선언합니다.

우리 실험실 청록색 송사리, 성인 물고기 주택 뿐만 아니라 태아 컬렉션, 부 화, 등의 재배에 대 한 프로토콜을 설명, 사육 및 먹이. 우리의 프로토콜 노화와 수명에 대 한 실험 연구에 대 한 특히 성인 물고기에 초점을 맞춘 연구 실험실을 구체적으로 타겟팅 됩니다. 청록색 송사리 표준 zebrafish 시설;에 올려질 수 있다 그러나, 송사리 농업의 중요 한 측면에서 표준 zebrafish 케어16다. 이러한 배아 부 화, 액체와 건조 부 화 단계 구성의 특정 단계 뿐 아니라 단백질이 풍부한 혈액 벌레, 보충 다이어트 소금물 새우만 다이어트에서 초기 전환 포함 됩니다.
프로토콜 내에서 중요 한 단계 8-30 ° C의 온도 범위 내에서 운송 배아를 포함합니다. 번 식, 경우 통치 주파수 및 식품 품질; 먹이에 따라 달라 집니다. 따라서, 배아 수율 (참조 섹션 5.6.) 인상 탱크 사육 당 하루 두 개 이상 feedings를 좋습니다. 태아는 표백, 동안 표백 솔루션에서 태아 외피를 확장 하지 않습니다. 이 계란 chorion 및 증가 태아 사망률에 손상을 일으킬 수 있습니다. 메 틸 렌 블루와 배아를 배양 할 때로 그들의 생존 능력을 극적으로 감소 될 것 이다 2 주에 이상에 대 한 준비-해치 배아의 부 화를 연장 하지 마십시오. 청록색 송사리를 부 화, 대 한 humic 산 성 솔루션의 낮은 온도 향상 부 화 하며 솔루션에 배아의 완전 한 침수 동기화 된 해칭 가스 방광을 채울 수 없는 튀김의 높은 가격에 부 화 결과 동안 충분 한 통 기 통풍 ("배꼽-슬라이더" 표현 형, 섹션 5.1 참조 하십시오).
번 식에 대 한 프로토콜의 한계는 포즈에 여과 시스템을 중앙 집중식 도전과 미래에 다른 방법으로 대체 한다 모래 기판의 사용을 포함. 가능한 대안 zebrafish 사육 탱크의 사용 될 수 있습니다. 배아 표백 변경된 chorion 생리학 및 부 화 성공 귀 착될 수 있는 계란 chorion에 주요 물리 화학 변화를 일으킬 수 있습니다. Methylene 청색에 배아의 지속적인 노출 성인 물고기 생리학에 장기적인 변화 유도 수 있습니다. 성인 물고기 생존 코 호트 연구에 대 한 개별 탱크에서 높이 생선 행동과 건강을 부정적인 영향을 수 있습니다. 그러나, 생존 코 호트 연구 그룹 주택 엄격한 사회 계층으로 이어지는 사회 지배와 남성 영토의 설립으로 인해 상당한 혼란 요소를 추가 합니다. 따라서, 우리는 생존 연구에 대 한 남성 생선의 절연은 합리적인 타협 판단. 취소 제어 소스에서 라이브 음식 먹이 실험실 송사리 식민지는 기생충과 잠재적으로 병원 성 미생물 지역 사회에서 외부 오염에 대 한 위험을 추가합니다. 미래에 ad hoc 메 마른 물고기 피드 개발 되어야 한다.
이 프로토콜에 미래 개선 여전히 3-4 주 이내 성적 성숙 완료 리드 제어, 비-라이브 다이어트에 집중할 것 이다. 요약 하자면, 우리의 프로토콜 넓은 과학계에 청록색 송사리 실험실 경작에 대 한 접근을 제공 합니다.

그들의 짧은 생애 경 간 및 빠른 라이프 사이클을 감안할 때, 청록색 송사리를 유망한 새로운 모델 유기 체 생물학1,2,3로 급속 하 게 성장 하고있다. 이 종 한 teleost, 미 발달 diapause, 급속 한 성적인 성숙, 및 post-reproductive 수명 연장된 단계4,5의 구성에 대 한 고유한 라이프 사이클에 의해 특징입니다. 최근 작품은 포로 야생6,7에서이 종의 생물학 elucidating에 기여 했다. 청록색 송사리 짐바브웨, 모잠비크는 아프리카 사바나에 우기 동안 양식 계절 신선한 물 시체에 살고 있습니다. 건조 한 계절, 태아 건조 진흙 물 diapause 이라는 스트레스 저항 생활 단계 미 덕의 부재에 남아 있다.
이 종족에 대 한 유전자 지도 생성 된8,9, 그리고 최근에 그들의 게놈 시퀀스 및 조립10,11되었습니다. 여러 가지 타고 난된 실험실 물고기 종자를 개발 하 고 transgenesis 및 CRISPR/Cas9를 통해 편집 하는 게놈이이 종, 사실상 경쟁 실험실 척추 모델 유기 체 로 청록색 송사리를 홍보에 제공 되 12,,1314.
실험실 프로토콜 이미이 종15게시 되었습니다, 비록 현재 프로토콜에서 우리 개발 특히 노화 및 생존을 조사 연구 목적으로 실험 실험실 지침의 포괄적인 목록. 현재 프로토콜 연구원은 제 브라와 메 다카 축산에 이미 익숙한 키 조정의 최소 수를 채택 하 여 청록색 송사리 축산에 조예가 될 수 있습니다. 동시에이 프로토콜 번성 청록색 송사리 식민지를 필수 도구로 생선 농업에 사전 경험 없이 연구를 제공 합니다.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

실험적인 목적을 위해 사용 하는 비 모델 실험실 물고기에서 농업 관행의 개발은 크게 혜택 참조 물고기의 설립에서 모델 시스템, 제 브라와 메 다카. 최근 몇 년 동안, 신흥 물고기-청록색 송사리 (Nothobranchius furzeri)-노화와 생태의 생물학의 분야에서 연구 그룹의 성장 수에 의해 채택 되었습니다. 4-8 개월의 포로 생활 스팬,이 종 감 금에서 발생 하는 shortest-lived 척추 이며 노화 속도와 수명이 변경으로 이어질 수 있는--짧은 시간에에서 테스트 실험 개입을 과학적으로 지역 사회를 수 있습니다. 이 종, 미 발달 diapause, 특징의 독특한 생물학 주어 폭발적인 성적 성숙, 표시 형태학과 행동 성적인이 형태 성-그리고 그들의 상대적으로 짧은 성인 수명- 임시 농업 관행은 긴급 수요입니다. 이 프로토콜 허용 최적의 청록색 송사리 실험실 관리, 강력한 실험실 동물 모델로이 종 채택 하 사회 과학을 사용 하는 주요 축산 측정값 집합을 보고 합니다.

청록색 송사리 적절 한 농업 메디아 생존 GRZ 변형 (예: 그림 4A)에 12-18 주 사이에 발생 합니다. 메디아 생존의 다이어트, 주파수, 수 유 및 주택 온도 조건에 따라 달라 집니다. 불 쌍 한 축산 결과 제시 하는 생존 곡선에서 초기 사망률 및 반복, 갑자기 여러 굴절 포인트 (그림 4B) 특징, 시간에 걸쳐 생존의 증가.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> 그림 1: 각 인큐베이션 기판 대표 배아 발달 단계. (A) 갓 배아, 28 ° c.에 인큐베이터에서 메 틸 렌 블루 솔루션에서 incubated 수집 (B) 고체 매체를 전송할 준비가 배아 중 종이 또는 코코넛 섬유 필터. (C) 배아 준비가 해치 할 일반적인 황금 홍 채를 표시 합니다. 눈금 막대는 1 mm.에 <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> 그림 2: 청록색 송사리 후 부 화 개발의 단계. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> 그림 3: 3 단계 이후에서 물고기에 대 한 대표적인 물고기 ID 태그. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> 그림 4: 70 남성 청록색 송사리에 대 한 대표적인 생존 곡선. (A) 실험실 제기 청록색 송사리에 대 한 일반적인 생존 곡선. (B) 생존 곡선의 비교는 최적의 농업 조건 (블랙)에서 발생 하는 물고기에서 얻은 고 가난한 농업 (빨간색과 파란색). 수평 빨간색 파선 50% 생존, 평균 수명 (x 축에 표시)에 교차 생존 곡선을 나타냅니다. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">앞으로 뇌관</td>
			<td colspan="2">반전 뇌관</td>
			<td>크기 범위 (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166-214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220-272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209-240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198-238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164-226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196-197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252-295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216-248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174-205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355-373</td>
		</tr>
<tr>
<td colspan="6">*-섹스 결정 마커</td>
		</tr>
</tbody></table>표 1: 스트레인 식별 유전형 뇌관입니다.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

실험실 주택 터키석 송사리 집 고 효율적으로 개별 물고기의 수천 고용 표준 zebrafish 시설에 사용 하는 동일한 인프라는 중앙 집중식된 물 여과 시스템에서 확장할 수 있습니다. 여기 우리가 유지 보수 효율적 송사리 수 있도록 표준화 된 절차의 목록을 자세하게.

실험실 주택의 청록색 송사리 (Nothobranchius furzeri)에 대 한 프로토콜

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Universidad San Sebastian

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.8K 조회수.  Max Planck Institute for the Biology of Ageing. 실험실 주택 터키석 송사리 집 고 효율적으로 개별 물고기의 수천 고용 표준 zebrafish 시설에 사용 하는 동일한 인프라는 중앙 집중식된 물 여과 시스템에서 확장할 수 있습니다. 여기 우리가 유지 보수 효율적 송사리 수 있도록 표준화 된 절차의 목록을 자세하게.

비디오: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

급성 및 만성 Ecotoxicity 청록색 송사리 Nothobranchius furzeri 의 테스트에 대 한 프로토콜

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

연구

환경과학

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol for performing in situ juvenile exposure tests within oligotrophic river catchments over one-month and three-month periods. Two methods (in both modifications) are presented to evaluate the juvenile growth and survival rate. The methods and modifications differ in value for the locality bioindication and each has its benefits as well as limitations. The sandy cage method works with a large set of individuals, but only some of the individuals are measured and the results are evaluated in bulk. In the mesh cage method, the individuals are kept and measured separately, but a low individual number is evaluated. The open water exposure modification is relatively easy to apply; it shows the juvenile growth potential of sites and can also be effective for water toxicity testing. The within-bed exposure modification needs a high workload but is closer to the conditions of a natural juvenile environment and it is better for reporting the real suitability of localities. On the other hand, more replications are needed in this modification due to its high-hyporheic environment variability.

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

In situ bioindications enable determination of the suitability of an environment for endangered mussel species. We describe two methods based on the juvenile exposure of freshwater pearl mussels in cages to oligotrophic river habitats. Both methods are implemented in variants for open water and hyporheic water environments.

Bioindication 영 민물 진주 홍합에 현장 노출 방법을 사용 하 여에 대 한 스트림 환경 적합성의 테스트

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

Post-larval 고기 분석 및 전체 마운트 Immunohistochemistry 멕시코 Tetra Astyanax mexicanus 를 높이

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

유전학

Behavioral Tracking and Neuromast Imaging of Mexican Cavefish

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among these traits, foraging behavior is one of the useful windows into functional advantages of behavioral trait evolution. Presented herein are updated methods for analyzing vibration attraction behavior (VAB: an adaptive foraging behavior) and imaging of associated mechanosensors of cave-adapted tetra, Astyanax mexicanus. In addition, methods are presented for high-throughput tracking of a series of additional cavefish behaviors including hyperactivity and sleep-loss. Cavefish also show asociality, repetitive behavior and higher anxiety. Therefore, cavefish serve as an animal model for evolved behaviors. These methods use free-software and custom-made scripts that can be applied to other types of behavior. These methods provide practical and cost-effective alternatives to commercially available tracking software.

Here, we present methods for high-throughput study of a series of the Mexican cavefish behaviors and vital staining of a mechanosensory system. These methods use free-software and custom-made scripts, providing a practical and cost-effective method for the studies of behaviors.

행동 추적 및 멕시코 Cavefish의 Neuromast 이미징

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among ...

행동분석학

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

생선 복지 를 평가하기 위한 선호도 테스트를 위한 표준화된 프로토콜

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

호스트 표현형의 시험에<em&gt; Gambusia의 affinis입니다</em&gt; 다음은 항생제 치료

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

면역학 및 감염병학

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

Zebrafish의 일반 관리 및 유지 관리 (<em&gt; Danio rerio</em&gt;) 실험실 : 소개

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

생물학

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

저렴하고 간편한 구축 Zebrafish의 시설의 건설

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

성인 아프리카 청록색 Killifish의 뇌 조직에서 핵의 부드러운 분리, 노화 연구를위한 자연적으로 수명이 짧은 모델

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we ...

신경과학

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

Health monitoring systems are developed and used in zebrafish research facilities because pathogens of Danio rerio such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa have the potential to impair animal welfare and research. The fish are typically analyzed post mortem to detect microbes. The use of sentinels is a suggested way to improve the sensitivity of the surveillance and to reduce the number of animals to sample. The setting of a pre-filtration sentinel tank out of a recirculating system is described. The technique is developed to prevent water pollution and to represent the fish population by a careful selection of age, gender, and strains. In order to use the minimum number of animals, techniques to screen the environment are also detailed. Polymerase Chain Reaction (PCR) on surface sump swabs is used to significantly improve the detection of some prevalent and pathogenic mycobacterial species such as Mycobacterium fortuitum, Mycobacterium haemophilum, and Mycobacterium chelonae. Another environmental method consists of processing the sludge at the bottom of a holding tank or sump to look for P. tomentosa eggs. This is a cheap and fast technique that can be applied in quarantine where a breeding device is submerged into the holding tank of imported animals. Finally, PCR is applied to the sludge sample and A. hydrophila is detected at the sump&#39;s bottom and surface. Generally, these environmental screening techniques applied to these specific pathogens have led to an increased sensitivity compared to the testing of pre-filtration sentinels.

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

This protocol describes the use of sump swabs and sludge analysis of zebrafish systems, which leads to increased detection compared to the sole use of sentinels to detect pathogens such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa. A system to monitor P. tomentosa eggs in quarantine is also proposed.

실험실 주택의 청록색 송사리 (Nothobranchius furzeri)에 대 한 프로토콜

요약

더 많은 비디오 탐색

이 비디오의 챕터