Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00.000+00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Vi ringraziamo Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar e tutti i membri del laboratorio Valenzano presso l'Istituto Max Planck per la biologia dell'invecchiamento per contribuire a diversi aspetti del protocollo attuale Killi allevamento nel corso degli anni.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Tutti gli autori non dichiarano concorrenti interessi finanziari e non finanziari.

Descriviamo un protocollo per la coltura di laboratorio di killifish turchese, tra cui la raccolta degli embrioni, incubazione, come pure la custodia di pesci adulti, allevamento e alimentazione. Il nostro protocollo destinato specificamente ai laboratori che effettuano ricerca incentrata su pesci adulti, in particolare per gli studi sperimentali su invecchiamento e durata. Killifish turchese può essere generato su un impianto di zebrafish standard; Tuttavia, importanti aspetti di allevamento killifish differiscono da standard zebrafish cura16. Queste modifiche includono una transizione precoce da una dieta di Artemia solo ad una dieta completata con verme di sangue ricco di proteine, come pure i passaggi specifici dell'incubazione di embrione, costituito da una fase di incubazione liquidi ed asciutti.
Fasi critiche all'interno del protocollo includono spedizioni embrioni intervallo di temperatura di 8-30 ° C. In caso di allevamento, fecondità dipende dall'alimentazione di frequenza e la qualità del cibo; Pertanto, si consiglia almeno due poppate al giorno per allevamento serbatoio per aumentare la resa di embrioni (vedere paragrafo 5.6.). Durante lo sbiancamento dell'embrione, non si estendono incubazione dell'embrione nella soluzione sbianca. Ciò potrebbe causare danni al corion dell'uovo e dell'embrione aumentata mortalità. Quando incubando gli embrioni con blu di metilene, non prolungare la incubazione di pronto-a-tratteggio embrioni per più di 2 settimane in quanto riducono drammaticamente la loro sopravvivenza. Da cova killifish turchese, bassa temperatura della soluzione di acido umico migliora schiusa e completa immersione degli embrioni nella soluzione consente schiusa sincronizzato. Non sufficiente areazione durante i risultati di incubazione in elevati tassi di fry non in grado di riempire la vescica gassosa (fenotipo "pancia-slider", vedere le note nella sezione 5.1).
Limitazione del protocollo per l'allevamento comprende l'uso del substrato sabbia che pone sfide ai sistemi di filtrazione centralizzati e dovrebbero essere sostituiti in futuro da metodi alternativi. Possibili alternative potrebbero essere l'uso di zebrafish allevamento serbatoi. Candeggio embrione potrebbe causare grandi cambiamenti chimico-fisici in corion dell'uovo che potrebbe tradursi in fisiologia alterata corion e da cova di successo. L'esposizione costante degli embrioni al blu di metilene può indurre cambiamenti a lungo termine in fisiologia di pesci adulti. Allevamento dei pesci adulti in singoli serbatoi per studi di coorte di sopravvivenza può influenzare negativamente il comportamento dei pesci e salute. Tuttavia, la stabulazione in gruppo per studi di coorte di sopravvivenza aggiunge significativi fattori di confusione dovuto all'istituzione di dominanza sociale e territori maschi, portando a rigorose gerarchie sociali. Di conseguenza, noi giudichiamo che l'isolamento dei pesci maschi per studi di sopravvivenza è un compromesso ragionevole. Colonie di killifish laboratorio d'alimentazione con cibo vivo da fonti non controllate aggiungere un rischio di contaminazioni esterne da parassiti e comunità microbiche potenzialmente patogene. In futuro, dovrebbe essere sviluppato un feed pesce sterile ad hoc.
Futuri miglioramenti al presente protocollo si concentreranno su una dieta controllata, non-live, che conduce ancora a completare la maturazione sessuale entro 3-4 settimane. In sintesi, il nostro protocollo offre accessibilità alla turchese killifish laboratorio coltura ad una comunità ampia scientifica.

Data la loro vita breve e rapido ciclo di vita, turchese killifish sono in rapida crescita come un promettente nuovo organismo modello in biologia1,2,3. Questa specie è caratterizzata da un unico ciclo di vita per un teleosteo, comprensivi di diapausa embrionale, rapida maturazione sessuale e una lunga durata sui fase4,5. Lavoro recente ha contribuito a delucidare la biologia di questa specie sia in cattività che in selvatici6,7. Killifish turchese vivono in corpi di acqua dolce stagionale che si formano durante la stagione delle piogge nella savana africana in Zimbabwe e Mozambico. Durante la stagione secca, gli embrioni sopravvivono nel fango secco in assenza di acqua in virtù di una fase della vita resistente alle sollecitazioni chiamata diapausa.
Mappe genetiche per questa specie sono stati generati8,9, e recentemente il loro genoma è stato sequenziato e assemblato10,11. Sono stati sviluppati diversi ceppi di pesce inbred laboratorio e transgenesi e genoma editing tramite CRISPR/Cas9 si sono resi disponibili in questa specie, di fatto promuovere killifish turchese come organismo vertebrato modello competitivo laboratorio 12,13,14.
Anche se un protocollo di laboratorio è già stato pubblicato per questa specie15, nel presente protocollo sviluppiamo un elenco completo delle linee guida di laboratorio sperimentale che mirano in particolare a studi che indagano l'invecchiamento e la sopravvivenza. Il presente protocollo consente ai ricercatori già familiari con zebrafish e medaka nell'allevamento di diventare esperti in allevamento turchese killifish adottando un numero minimo di regolazioni chiave. Allo stesso tempo, questo protocollo fornisce ai ricercatori senza precedente esperienza in allevamento di pesce con gli strumenti essenziali per generare una fiorente colonia di killifish turchese.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Lo sviluppo di pratiche di allevamento in laboratorio non-modello pesci utilizzati a fini sperimentali ha notevolmente beneficiato l'istituzione dei pesci di riferimento sistemi modello, come zebrafish e medaka. Negli ultimi anni, un pesce emergente – il turchese killifish (Nothobranchius furzeri) – è stato adottato da un numero crescente di gruppi di ricerca nei campi della biologia di invecchiamento ed ecologia. Con una durata di vita in cattività di 4-8 mesi, questa specie è il più breve durato vertebrato allevato in cattività e consente alla comunità scientifica di prova – in tempi brevi – interventi sperimentali che possono portare ad alterazioni del tasso di invecchiamento e l'aspettativa di vita. Dato l'unica biologia di questa specie, caratterizzata dalla diapausa embrionale, maturazione sessuale esplosiva, contrassegnato morfologica e comportamento dimorfismo sessuale - e loro relativamente breve durata adulto - allevamento ad hoc pratiche sono in urgente domanda. Questo protocollo segnala un insieme di misure di allevamento chiave che consentono ottimali killifish turchese cura di laboratorio, che consente alla comunità scientifica di adottare questa specie come un modello animale di laboratorio potente.

Allevamento corretto killifish turchese si traduce in sopravvivenza mediana compresa tra 12-18 settimane nel ceppo GRZ (ad es. la Figura 4A). Variazioni di sopravvivenza mediana dipendono dalla dieta, alimentazione frequenza e temperatura condizioni abitative. Risultati di allevamento poveri in curve di sopravvivenza che presenta aumentato mortalità precoce e ripetitivi, improvvisi gocce di sopravvivenza nel corso del tempo, caratterizzata da diversi punti di flesso (Figura 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Figura 1: rappresentante stadi di sviluppo embrionale con substrato incubazione rispettivi. (A) appena raccolti embrioni, incubati in soluzione di blu di metilene nell'incubatore a 28 ° C. (B) gli embrioni pronti per essere trasferito al mezzo solido, filtrare fibra di carta o di cocco. (C) embrioni pronto a schiudersi, visualizzazione tipiche dorate iridi. La barra della scala è pari a 1 mm. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">per favore clicca qui per visualizzare una versione più grande di questa figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Figura 2: fasi del turchese killifish post-schiusa sviluppo. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Clicca qui per visualizzare una versione più grande di questa figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Figura 3: tag ID pesce rappresentativo per pesce fin dalla fase 3. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Clicca qui per visualizzare una versione più grande di questa figura.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Figura 4: curva di sopravvivenza rappresentativo per 70 Killi turchese maschi. (A) curva di sopravvivenza tipico per laboratorio-generato turchese killifish. (B) confronto delle curve di sopravvivenza ottenuti da pesci allevati in condizioni ottimali di allevamento (nero) e allevamento povero (rosso e blu). La linea orizzontale rossa tratteggiata indica 50% sopravvivenza, curva di sopravvivenza che si intersecano a durata mediana (indicata sull'asse x). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Clicca qui per visualizzare una versione più grande di questa figura.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Reverse primer</td>
			<td>Intervallo di grandezza (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - marcatori di determinazione del sesso</td>
		</tr>
</tbody></table>Tabella 1: Gli iniettori di genotipizzazione per l'identificazione del ceppo.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Alloggiamento di laboratorio di turchese killifish può essere scalato a casa e in modo efficiente generare migliaia di singoli pesci in un sistema di filtrazione di acqua centralizzata, impiegando la stessa infrastruttura utilizzata per strutture standard zebrafish. Qui dettagliamo un elenco di procedure standardizzate che consentono killifish efficiente manutenzione.

Un protocollo per laboratorio Housing di turchese Killifish (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Universidad San Sebastian

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.8K Views.  Max Planck Institute for the Biology of Ageing. Alloggiamento di laboratorio di turchese killifish può essere scalato a casa e in modo efficiente generare migliaia di singoli pesci in un sistema di filtrazione di acqua centralizzata, impiegando la stessa infrastruttura utilizzata per strutture standard zebrafish. Qui dettagliamo un elenco di procedure standardizzate che consentono killifish efficiente manutenzione.

Video: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocollo per acuto e prove di ecotossicità cronica del turchese Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Ricerca

Ambiente

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol for performing in situ juvenile exposure tests within oligotrophic river catchments over one-month and three-month periods. Two methods (in both modifications) are presented to evaluate the juvenile growth and survival rate. The methods and modifications differ in value for the locality bioindication and each has its benefits as well as limitations. The sandy cage method works with a large set of individuals, but only some of the individuals are measured and the results are evaluated in bulk. In the mesh cage method, the individuals are kept and measured separately, but a low individual number is evaluated. The open water exposure modification is relatively easy to apply; it shows the juvenile growth potential of sites and can also be effective for water toxicity testing. The within-bed exposure modification needs a high workload but is closer to the conditions of a natural juvenile environment and it is better for reporting the real suitability of localities. On the other hand, more replications are needed in this modification due to its high-hyporheic environment variability.

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

In situ bioindications enable determination of the suitability of an environment for endangered mussel species. We describe two methods based on the juvenile exposure of freshwater pearl mussels in cages to oligotrophic river habitats. Both methods are implemented in variants for open water and hyporheic water environments.

Bioindicazione test di idoneità ambiente Stream per giovani d'acqua dolce perla cozze utilizzando metodi di esposizione In Situ

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

Alzando la Tetra messicano Astyanax mexicanus per analisi di Post-larval fenotipi e Immunohistochemistry intero-monta

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genetica

Behavioral Tracking and Neuromast Imaging of Mexican Cavefish

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among these traits, foraging behavior is one of the useful windows into functional advantages of behavioral trait evolution. Presented herein are updated methods for analyzing vibration attraction behavior (VAB: an adaptive foraging behavior) and imaging of associated mechanosensors of cave-adapted tetra, Astyanax mexicanus. In addition, methods are presented for high-throughput tracking of a series of additional cavefish behaviors including hyperactivity and sleep-loss. Cavefish also show asociality, repetitive behavior and higher anxiety. Therefore, cavefish serve as an animal model for evolved behaviors. These methods use free-software and custom-made scripts that can be applied to other types of behavior. These methods provide practical and cost-effective alternatives to commercially available tracking software.

Here, we present methods for high-throughput study of a series of the Mexican cavefish behaviors and vital staining of a mechanosensory system. These methods use free-software and custom-made scripts, providing a practical and cost-effective method for the studies of behaviors.

Rilevamento comportamentale e formazione immagine di Neuromast della caverna messicano

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among ...

Comportamento

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

Un protocollo standardizzato per i test delle preferenze per valutare il benessere dei pesci

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

L&#39;esame dei fenotipi host in<em&gt; affinis Gambusia</em&gt; In seguito a trattamento antibiotico

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

Immunologia e infezioni

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

Cura e manutenzione periodiche di Zebrafish (<em&gt; Danio rerio</em&gt;) Laboratorio: Introduzione

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

Biologia

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

Costruzione di una build di facile strumento Zebrafish Affordable e

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

Delicato isolamento dei nuclei dal tessuto cerebrale del killifish turchese africano adulto, un modello naturalmente di breve durata per la ricerca sull'invecchiamento

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we ...

Neuroscienze

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

Health monitoring systems are developed and used in zebrafish research facilities because pathogens of Danio rerio such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa have the potential to impair animal welfare and research. The fish are typically analyzed post mortem to detect microbes. The use of sentinels is a suggested way to improve the sensitivity of the surveillance and to reduce the number of animals to sample. The setting of a pre-filtration sentinel tank out of a recirculating system is described. The technique is developed to prevent water pollution and to represent the fish population by a careful selection of age, gender, and strains. In order to use the minimum number of animals, techniques to screen the environment are also detailed. Polymerase Chain Reaction (PCR) on surface sump swabs is used to significantly improve the detection of some prevalent and pathogenic mycobacterial species such as Mycobacterium fortuitum, Mycobacterium haemophilum, and Mycobacterium chelonae. Another environmental method consists of processing the sludge at the bottom of a holding tank or sump to look for P. tomentosa eggs. This is a cheap and fast technique that can be applied in quarantine where a breeding device is submerged into the holding tank of imported animals. Finally, PCR is applied to the sludge sample and A. hydrophila is detected at the sump&#39;s bottom and surface. Generally, these environmental screening techniques applied to these specific pathogens have led to an increased sensitivity compared to the testing of pre-filtration sentinels.

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

This protocol describes the use of sump swabs and sludge analysis of zebrafish systems, which leads to increased detection compared to the sole use of sentinels to detect pathogens such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa. A system to monitor P. tomentosa eggs in quarantine is also proposed.

Un protocollo per laboratorio Housing di turchese Killifish (Nothobranchius furzeri)

Riepilogo

Esplora Altri Video

Capitoli in questo video