Name: techniques to induce and quantify cellular senescence
Uploaded: 2017-05-01T11:30:00.000+00:00
Duration: 6 min 51 s
Description: Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

이 연구는 국립 보건원 (National Institutes of Health)의 교내 연구 프로그램, 노화에 국립 연구소에 의해 지원되었다. 저자는 또한 비판적 원고를 읽기위한 노화 및 Kotb Abdelmohsen에 대해 많은 도움이 토론 미리암 고로스페 및 Kotb Abdelmohsen을 감사드립니다. 우리는 또한 비판적 원고를 읽기 위해, 특히 더글러스 Dluzen 우리의 실험실 구성원 감사합니다.

저자가 공개하는 게 없다.

여기에서는 인간의 배수체 섬유 아세포를 이용하여 복제 성 및 DNA 손상 - ​​유도 노화에 대한 방법을 설명 하였다. 또한, 다양한 단백질 및 노화 관련 단백질의 mRNA 수준을 정량화하기위한 기술이 포함될뿐만 아니라, 염색 SA-β-gal을위한 상기 DNA 손상 - ​​마커 γ-H2AX위한 것이다. 많은주의가 생체 (20)에 노화의 특성이 존재하지만,이 프로토콜은 널리 생체 외 및 생체 내에서 모두 노화 표현형을 평가하는 데 사용할 수 있습니다. 다른 세포들이 노화 된 세포없는 경우에도, 노화 마커를 표현할 수 있습니다. 예를 들면, 파골 세포 및 대 식세포와 같은 세포는 β-gal을 활성 (32, 33)보다 높은 수준을 갖는다. 또한, 많은 암 세포는 P16의 INK4A (34)을 상향 조절했다. 세포는 DNA 손상 (예를 들면, γ-H2AX의 초점) 및 노화하지를 축적 할 수있다. SASP 요인도에 의해 상향 조절 될 수있다각종 정상 생리 학적 또는 또는 노화 된 세포를 포함하지 않을 수있다 병적 상태. 생체의 노화를 평가할 때 특히 따라서 여러 노화 마커가 이용되어야한다. 노화 세포는 20 년 전 4 정상 노화 조직에서 증가하는 것으로 확인되었지만, 그것은 단지 지금 우리가 완전히 노화 된 세포가 모두 정상 조직의 항상성과 병적 인 상태에서 재생하는 것이 역할의 과다를 감상하는 것입니다. P16의 INK4A 양성 노화 세포를 제거하기 위해 마우스 모델의 최근 고용은 연구자 더 명확를 허용하고 정확하게 조직 및 기관 35, 36, 37에서 노화 세포의 역할에 감사하고있다. 이 모델은 노화 세포가 노화 관련 병리, 종양의 군중에 기여하는 것을 발견하고, 마우스 수명 35 한 &lt;/ SUP&gt;, 36, 37. 이러한 최근의 발견과 생리학에 노화 세포의 중요성의 검증을 감안할 때, 시간이 특정 세포에 대한 연구 익은이다. 예를 들어, 치료 적 연구는 세포 노화를 제거하거나 노화 모두 healthspan 및 수명 연구에 도움이 될 수있는 지연 전략을 채용. 최근, 우리 연구소는 메트포르민, 일반적으로 제 2 형 당뇨병을 치료하는 데 사용 약물, 세포 노화 (38)를 감소를 발견했다. 메트포르민은 현재 노화 방지 요법으로 제안 및 안티 - 암 속성 (39), (40)이되고,이 약 또는 다른 노화 개입, 세포 노화를 조절함으로써 건강 결과에 영향을 미치는 여부를 조사하기 위해 미래에 흥미로운 일이 될 것이다. 우리가 여기서 논의 프로토콜은 널리 일반적이고있다ccepted 기술은 노화 표현형을 평가합니다. 시험 관내에서 세포 성장을 위해, 상기 세포를 (도 1 및 2 참조) 노화 것을 보장하기 위해 편평한 형태로 스핀들 형으로부터 셀 변경을 모니터링하는 것이 중요하다. 세포는 SA-β-gal을 또는 여기에 설명 된 다른 마커 양성 아닌 경우 (복제 성 노화) 또는 DNA 손상 - ​​유도 노화 후 증가시의 PDL 높은 세포에서 노화를 평가한다. 또한, 이러한 프로토콜은 서로 다른 세포 유형에 맞게 최적화해야 할 수 있습니다. SASP 단백질 수준을 평가하기 위해,이는 ELISA 또는 단백질 어레이에서 높은 배경 수준의 원인이됩니다, 셀 매체로부터 혈청을 제거하는 것이 중요합니다. 실험을 설계 할 때 동시에 여러 마커를 평가하기에 적합하지 않을 수 있습니다 따라서,이 점을 명심. 여기에 기술 된 바와 같이 SA-β-gal을위한 염색, 그것은 세포의 고정을 필요로한다는 사실에 의해 제한된다.또한, 세포의 합류는 SA-β-gal을 활성에 영향을 미치는 것으로 밝혀졌다. 프로토콜 41, 42, 43를 사용하여 유세포 생균이 마커의 정량을 허용 β-gal을 작동하는 형광 기질을 사용하여 SA-β-갈 활성을 평가하기 위해 개발되어왔다. SA-β-gal을 활성은 또한 화학 발광 법 (44)을 사용하여 세포 용 해물에서 측정 할 수있다. 또한, γ-H2AX는 유동 세포 계측법 또는 세포 용 해물 (45)의 면역을 포함하는 다양한 다른 방법을 사용하여 측정 할 수있다. SAHF 형성이 세포주 의존적임을 주목해야한다 대체로과 연관된 종양 유전자 - 유도 노화 20, 30, 46. 따라서, SAHF 모든 노화의 모델에 존재하지 않을 수 있습니다. 의 유틸리티마우스 모델에서 노화 마커 SAHF SAHF 또한 일반적으로 마우스의 노화 세포를 30, 46, 47에서 관찰되지 않는다는 사실에 의해 제한 될 수있다. 여기서, H3K9Me2에 대한 항체가 사용되었지만 SAHF 다른 분자 마커 macroH2A 높은 이동성 그룹 A (HMGA) 단백질, 및 트라이 메틸화 라이신 9 히스톤 H3 (H3K9Me3)와 결합 HP1 단백질을 포함하여 사용될 수있다. 또한, 염색질 면역 침전 분석은 히스톤 마크 또는 E2F 표적 유전자에 결합 단백질 염색질의 관계를 평가하기 위해 사용될 수있다. 하나는 마커에 대한 이질성 이러한 마커 노화 세포에서만 발현되지 않는다는 사실을 포함하여, 노화의 특성에 대한 다양한 제한이 있다는 것을 알고 있어야합니다. 다수의 (일반적으로 1 - 2 3) 마커는 설명을 생략 마커를 포함하여 노화를 평가하기 위해 사용한다. 예를 들면, DNA-흉터 텔로미어손상 및 / 또는 DNA 손상 신호는 정량화 될 수있다. 또한, 노화 및, 특히, SASP 표현형 같이, 최근 노화 11, 12, 13 유도 특정 스트레스 나 손상 영향을받는 것으로 밝혀졌다, 각 실험 패러다임에서 여러 마커를 평가하는 것이 중요하다.

반 세기 이상 전 헤이 플릭와 동료들은 문화 확산 방법 변형되지 않은 세포를 설명하지만, 시간이 1 만 한정된 기간 동안. 인간의 섬유 아 세포의 장기 배양이 확산 막을 수있는 세포를 발생; 그러나, 그들은 대사 활동했고, 이것은 세포 노화라고했다. 노화 종양 억제에 도움이 될 수 있지만,이 에이징 (2, 3)에 발생하는 회생 용량의 감소에 기여하는 것으로 생각된다으로도 불리 할 수있다. 노화 세포는 4 세를 인간과 배아 발달, 상처 치료, 조직 복구 및 나이와 관련된 염증이 포함 생물학적 과정의 숫자에 연루되어있다으로 조직에 축적하는 것으로 나타났다. 문화에 세포의 지속적인 계대이 연결되었습니다 복제 성 노화를 유도마찰과 게놈의 불안정성을 텔로미어합니다. DNA 손상과 암 유전자를 포함한 다양한 세포 스트레스는 또한 노화 3가 발생할 수 있습니다. 텔로미어 (telomere)의 감소가 아닌 다른 요인에 의한 노화는 종종 스트레스 유발 또는 조기 노화라고 일반적으로 P16의 INK4A / Rb는 경로 (5)에 따라 결정된다. 증식 있지만, 형질 전환되지 않은 세포는 일반적으로 형상 스핀들 표시, 노화 세포는 특정 특성을 갖는 평평하고 넓은 형태 증가 노화 관련 β 갈 락토시다 제 활성 (SA-β-gal을) (도 1 및 2)를 포함하는 것으로 식별 될 수있다. 노화 세포는 γ-H2AX (도 3) (6), 및 잠재적으로 노화 관련 이질 병소 (SAHF) (도 4) (7)을 포함하여, DNA 손상 마커 축적된다. 노화 세포는 P를 포함하는 세포주기 규제의 높은 수준을 가지고<html> 16 (P16의 INK4A) 및 / 또는 (P21) 및 p53의 (도 5) (8, 9). 또한, 최근의 데이터는 노화 세포는 염증성 사이토 카인 및 케모카인 중 다수를 분비하여 비 - 자율적 인 영향을 미칠 수있는 노화 - 관련 분비 표현형 (SASP) 10이라고 나타났다. 이 SASP 현상이 셀 타입에 세포 유형에 따라 다를 수 있지만, 일반적으로는 인터류킨 -6 (IL-6), IL-8, 과립구 - 대 식세포 콜로니 자극 인자 (GM-CSF), 성장 -의 증가에 의해 증명된다 종양 유전자의 조절 α (GRO-α), 및 β-GRO, 그 중에서도 (도 6). 노화를 유도 특정 응력이나 손상도 분비 표현형 11, 12, 13에 영향을 미칠 수있다. SASP는 ELISA를 카인 / 단백질 어레이를 사용하는 분비 단백질의 수준을 측정함으로써 검출 될 수있다S = &quot;외부 참조&quot;&gt; 10, 14. 전사 후 메커니즘 SASP 단백질 농도 11 조절할 수 있지만, 15, 16, 17 mRNA 수준의 변화 또한 많은 경우에 검출 될 수있다. 이러한 변화는 일반적으로 더 민감하고 단백질 수준 측정보다 정량화하기 쉽다. 기타 노화 마커는 영속 DNA 손상 병소 핵 노화 (DNA-SCARS) (18)을 보강 염색질 변형 불려 DNA 세그먼트, 및 다양한 다른 마커 3, 19, 20을 포함하여 평가할 수있다. 여기서는 SA-β-갈, γ-H2AX, SAHF 포함한 노화 여러 마커를 측정하는 또 배양 세포에서 노화를 유도하고 공통 기술을 설명하고 senesce의 단백질 및 mRNA를NCE 분자가 회합.

<table><tbody><tr><td>16% Tris-glycine gels</td><td>Invitrogen</td><td>XP00160BOX</td><td></td></tr><tr><td>Acid-Phenol ChCl&lt;sub&gt;3&lt;/sub&gt;</td><td>Ambion</td><td>AM9720</td><td></td></tr><tr><td>Alexa-Fluor 568 goat anti-mouse antibody</td><td>Invitrogen</td><td>A11031</td><td>1:300 dilution</td></tr><tr><td>Cell lifters</td><td>Corning Inc.</td><td>3008</td><td>Cell scraper</td></tr><tr><td>ECL anti-mouse HRP linked antibody</td><td>Amersham</td><td>NA931V</td><td></td></tr><tr><td>ECL Plus Western Blotting Substrate</td><td>Pierce</td><td>32132</td><td>ECL</td></tr><tr><td>DAPI</td><td>Molecular Probes</td><td>MP01306</td><td>stock 5 mg/mL in dH&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>GAPDH antibody</td><td>Santa Cruz</td><td>sc-32233</td><td>1:1,000 - 5,000 dilution</td></tr><tr><td>GlycoBlue</td><td>Ambion</td><td>AM9515</td><td></td></tr><tr><td>Histone H3 dimethyl K9 monoclonal antibody</td><td>Abcam</td><td>1220</td><td>1:500 dilution</td></tr><tr><td>Human IL-6 Quantikine ELISA assay</td><td>R&amp;amp;D systems</td><td>D6050</td><td></td></tr><tr><td>Human IL-8 Quantikine ELISA assay</td><td>R&amp;amp;D systems</td><td>D8000C</td><td></td></tr><tr><td>Human GROa Quantikine ELISA assay</td><td>R&amp;amp;D systems</td><td>DRG00</td><td></td></tr><tr><td>N-N-dimethylformamide&amp;nbsp;</td><td>Sigma</td><td>D4551</td><td>DMF</td></tr><tr><td>p16 monoclonal antibody</td><td>BD Biosciences</td><td>51-1325gr</td><td>1:500 dilution</td></tr><tr><td>p21 monoclonal antibody</td><td>Millipore</td><td>05-345</td><td>1:750 dilution</td></tr><tr><td>p53 monoclonal antibody</td><td>Santa Cruz</td><td>sc-126</td><td>1:500 dilution clone DO-1</td></tr><tr><td>phospho-H2AX (Ser139) FITC conjugate antibody</td><td>Cell Signaling</td><td>9719</td><td>1:2,000 dilution</td></tr><tr><td>&lt;em&gt;POWER&lt;/em&gt; SYBR-green PCR master mix&amp;nbsp;</td><td>Applied Biosystems</td><td>4367659</td><td></td></tr><tr><td>Pre-stained molecular weight markers</td><td>Biorad</td><td>161-0374</td><td></td></tr><tr><td>ProLong Gold Antifade&amp;nbsp;</td><td>Invitrogen</td><td>P36930</td><td></td></tr><tr><td>PVDF membrane&amp;nbsp;</td><td>Thermo Scientific</td><td>88518</td><td></td></tr><tr><td>Senescence &amp;beta;-Galactosidase Staining Kit</td><td>Cell Signaling</td><td>9860</td><td></td></tr><tr><td>TRIzol</td><td>Ambion/Life Tech</td><td>10296028</td><td></td></tr></tbody></table>

techniques to induce and quantify cellular senescence

세포 스트레스 또는 손상에 대한 응답으로 증식하는 세포는 세포 노화이라고 장기 세포주기 정지의 상태를 개시하는 특정 프로그램을 유도 할 수 있습니다. 노화 세포의 축적은 생명체의 노화와 체외에서 계속 배양을 통해 발생합니다. 노화 세포는 배아 발달, 조직 복구 및 재생, 종양 억제, 노화 등 많은 생물학적 과정을, 영향을 미친다. 노화 세포의 특징을 포함하지만, 증가 된 노화 - 관련 β 갈 락토시다 제 활성 (SA-β-gal을)에 한정되지 않는다; P16의 INK4A, p53의, 그리고 P21 수준; γ-H2AX을 포함하여 DNA 손상의 높은 수준; 노화 관련 이질 병소 (SAHF)의 형성; 및 노화 관련 분비 표현형 (SASP), 염증성 사이토 카인 시그널링 분자의 수 분비를 특징으로하는 현상 획득. 여기, 우리가 모두 복제 성을위한 프로토콜을 설명하고DNA의 배양 세포에 노화를 유발 손상. 또, SA-β-gal을, γ-H2AX 및 SAHF 얼룩 등 여러 노화 - 관련 마커를 이용한 노화의 표현형을 모니터링하고, 세포주기 조절제 및 SASP 인자 단백질의 mRNA 수준을 정량화하는 방법을 강조. 이 방법은 다양한 모델과 조직에서 노화의 평가에 적용 할 수 있습니다.

6 SA-β-gal을 염색에서 대표적인 결과를 보여준다 - 2도 γ-H2AX 및 SAHF위한 염색; P16의 INK4A, P21 및 p53의 단백질 수준의 평가; 및 mRNA의 노화와 관련된 분자의 단백질 수준. 증가 된 SA-β-gal을 염색 및 복제 성 DNA 손상 - ​​유도 노화 발생. 또한, 노화와 함께 일어나는 형태 학적 변화를 관찰한다. 세포는 섬유 아세포 증식 스핀들 외관에 비해 확대 된 평면이된다. 본 실험 패러다임, 세포를 염색하고, RNA / 단백질 IR 노광 후 7 (D)를 분리 하였다. 더 강력한 결과는 IR 노출 (예 : 10 D) 후 이상 대기에 의해 발생할 수 있습니다. 조건은 각 조건 및 실험 장치에 대해 결정해야합니다. 이들 결과는 대표적인 노화 및 다른 방법을 사용하여 유도 될 때 이러한 마커는 검출 할 수있다. 도 6 her.within 페이지 = &quot;1&quot;&gt; 유전자 이름을 나열하고 CXCL1 (GROα) CXCL2 (GROβ) 및 CSF2 (GM-CSF)에 해당된다. SASP 요인의 일부의 mRNA 수준의 상향 조절, 전부는 아니지만은, WI-38 세포에서 IR에 의한 노화 후 관찰되었다. CDKN1A (P21 인코딩) 및 CDKN2A (P16의 INK4A을 인코딩)을 포함하여 기타 노화 관련의 mRNA는 상향 조절했다. 기타의 mRNA (EDN1 및 ANKRD1)도 포함되어 있고 이미 노화 된 세포 15 높게 나타났다. 프라이머는 표 1에 나열되어 있습니다. <img alt="그림 1" src="/files/ftp_upload/55533/55533fig1.jpg" /> 그림 1 : 증식 및 노화 섬유 아세포. 증식 (왼쪽)과 노화 (오른쪽) 섬유 아세포의 개략도. 노화 유도제의 예로는 너희에 나타낸다llow 상자. 노화가 표시된 마커의 높은 수준과 연관되어 있습니다. SA-β-gal을 노화 관련 β 갈 락토시다 제 활성; SASP, 노화 관련 분비 표현형; SAHF, 노화 관련 이질 염색질의 초점; DDR, DNA-손상 응답. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오</a> <img alt="그림 2" src="/files/ftp_upload/55533/55533fig2.jpg" /> 그림 2. 형태 학적 특성 및 노화 세포의 증가 SA-β-gal을 활동은. WI-38 세포, &quot;젊은&quot;(PDL 27), 복제 성 노화 (PDL 40), 또는 전리 방사선 (IR)에 노출 된 사람들, SA-β-gal을 활동을 위해 염색 확산 중. IMR-90 세포 증식 중 &quot;젊은&quot;(PDL 30), 복제 성 노화 (PDL 52) 또는 방사 (IR)를 이온화 방사선에 노출 것과 STA이었다SA-β-갤런 활동 이네. 섹션 (가) 1 - 2 및 복제 성 DNA 손상 - ​​유도 노화를 유도 기술 및 제 3 SA-β-gal을위한 염색을 설명한다. 세포 IR 후 7 일 이내를 염색 하였다. 콘, 제어 할 수 있습니다. 스케일 바는 50 μm의 =. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55533/55533fig3.jpg" /> 그림 3. 노화 세포에서 γ-H2AX 초점을 증가. WI-38 세포 증식 중 &quot;젊은&quot;(PDL 30) 또는 복제 성 노화 (PDL 53)와 고정 반 γ-H2AX 항체 및 DAPI 염색 하였다. 노화 세포에서 γ-H2AX의 병소의 수의 증가를합니다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 그 최대 강도 투영 모든 detec 시각화 단일 평면 화상을 얻기 위해 사용 된테이블 초점. 스케일 바는 20 μm의 =. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/55533/55533fig4.jpg" /> 그림 노화 세포의 SAHF 4. 형광 염색. (A) 증식 WI-38 세포 (PDL 27) 미처리 또는 이온화 방사선 (IR)에 노출시켰다. 십일 후, 세포 SAHF (IR 처리 된 세포 밀도 / 점상 DAPI 염색 주) (B) IDH4는 덱사메타손의 존재하에 배양 하였다 (확산) 또는 노화를 유도하는 숯불 박탈 FBS하여 (시각화 DAPI 염색 하였다 늙은). 10 D 후, 세포 H3K9Me2 및 DAPI에 대한 항체로 염색 하였다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 최대 강도의 투영은 단일 평면을 수득 하였다영상. 노화 세포 DAPI 염색 반점이있는 반면 (A) 및 (B)에서 증식 세포 확산 DAPI 염색있다. H3K9Me2 염색보다 견고하고 노화 세포 DAPI 염색으로 초점 colocalizes 반면 (B)에서, 제어 셀들은 H3K9Me2 대한 확산, 매우 가벼운 오염을 갖는다. 스케일 바는 20 μm의 =. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/55533/55533fig5.jpg" /> 노화 관련 단백질의 그림 5. 정량화. 전리 방사선의 10 Gy의 (IR)에 노출 또는 IMR-90 세포 (-) 단백질 확산 &quot;젊은&quot;(PDL 30) IMR-90 세포 하나에서 분리 하였다. 매체는 48 시간마다 변화시키고, 세포 IR 후 7 (D)을 용해시켰다. 샘플 안티 P16의 INK4A의 antibo와 immunoblotted, SDS-PAGE로 분석 하였다다이 안티 P21하고 항 p53의 항체로 재 프로빙. GAPDH는 단백질 로딩 대조군으로 사용 하였다. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/55533/55533fig6.jpg" /> 노화와 관련된 mRNA를 SASP 단백질의 정량도 6. (-) 이온화 방사선 (IR)의 10 Gy의 노출되었다 또는 WI-38 세포 (A) RNA 중 하나 확산 &quot;젊은&quot;(PDL 27 또는 34) WI-38 세포에서 분리 하였다. 매체는 48 시간마다 변화시키고, RNA를 분리 한 후 IR 7 D를 실시 하였다. RT-qPCR에 표 1에 기재된 유전자 특이 적 프라이머를 사용하여 표시된 노화 관련의 mRNA 수준을 정량화 하였다. 18S 수준은 정상화를 위해 사용되었다. 히스토그램의 평균을 나타내는 정규화 t5 개 독립적 실험 O 미처리 ± SEM. (B) WI-38 세포 (PDL 26)의 IR 10 Gy를 노출시켰다; 10 D 후, 배지를 무 혈청 배지로 변경 함. 24 시간 후, 배양 상청을 회수하고, IL-6, IL-8, GROα 및 수준은 ELISA 어 세이를 사용하여 정량화 하였다. 히스토그램은 세 실험으로부터 평균 ± SEM을 나타낸다. * 학생의 t 검정에 의한 P &lt;0.05 *** P &lt;0.001. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 인간 프라이머 </td><td> 앞으로 </td><td> 역 </td></tr><tr><td> 18S </td><td> CCCTATCAACTTTCGATGGTAGTCG </td><td> CCAATGGATCCTCGTTAAAGGATTT </td></tr><tr><td> ANKRD1 </td><td> AGT AGA GGA ACT GGT의 CACTGG </td><td> TGG GCT AGA AGT GTCTTC AGA T </td></tr><tr><td> CDKN1A (P21) </td><td> GAC ACCACT GGA GGG TGA CT </td><td> CAGGTC CAC ATG GTC TTC CT </td></tr><tr><td> CDKN2A (P16) </td><td> CCAACGCACCGAATAGTTACG </td><td> GCGCTGCCCATCATCATG </td></tr><tr><td> CSF2 (GM-CSF) </td><td> GGCCCCTTGACCATGATG </td><td> TCTGGGTTGCACAGGAAGTTT </td></tr><tr><td> CXCL1 </td><td> GAAAGCTTGCCTCAATCCTG </td><td> CACCAGTGAGCTTCCTCCTC </td></tr><tr><td> CXCL2 </td><td> AACTGCGCTGCCAGTGCT </td><td> CCCATTCTTGAGTGTGGCTA </td></tr><tr><td> EDN1 </td><td> CAG의 CAGTCT의 TAG GCG CTG AG </td><td> ACTCTT TAT CCA TCA GGG ACG AG </td></tr><tr><td> IL-6 </td><td> CCGGGAACGAAAGAGAAGCT </td><td> GCGCTTGTGGAGAAGGAGTT </td></tr><tr><td> IL7 </td><td> CTCCAGTTGCGGTCATCATG </td><td> GAGGAAGTCCAAAGATATACCTAAAAGAA </tD&gt; </tr><tr><td> IL8 </td><td> CTTTCCACCCCAAATTTATCAAAG </td><td> CAGACAGAGCTCTCTTCCATCAGA </td></tr></tbody></table> 표 1 : 노화 관련 mRNA에 대한 RT-qPCR에 프라이머. RT-qPCR에가 SYBR 녹색 기술을 사용하기위한 순방향 및 역방향 프라이머가 표시됩니다.

Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

Techniques to Induce and Quantify Cellular Senescence

세포 노화, 세포주기 정지의 비가역적인 상태는 다양한 세포 스트레스에 의해 유도 될 수있다. 여기, 우리는 노화의 마커를 평가하기 위해 세포 노화 및 방법을 유도 프로토콜을 설명합니다.

기술은 유도 및 정량화 세포 노화하기

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

techniques-to-induce-and-quantify-cellular-senescence

Universidad San Sebastian

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Cell Proliferation

SCIENTISTS IN ACTION

33.0K 조회수.  National Institute on Aging, National Institutes of Health.  세포 노화, 세포주기 정지의 비가역적인 상태는 다양한 세포 스트레스에 의해 유도 될 수있다. 여기, 우리는 노화의 마커를 평가하기 위해 세포 노화 및 방법을 유도 프로토콜을 설명합니다. 

비디오: Techniques to Induce and Quantify Cellular Senescence

BioMEMS and Cellular Biology: Perspectives and Applications

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in drug screening, toxicology, and clinical assays, and is increasingly used in regenerative medicine. However, the traditional cell culture methodology   essentially consisting of the immersion of a large population of cells in a homogeneous fluid medium and on a homogeneous flat substrate   has become increasingly limiting both from a fundamental and practical perspective. Microfabrication technologies have enabled researchers to design, with micrometer control, the biochemical composition and topology of the substrate, and the medium composition, as well as the neighboring cell type in the surrounding cellular microenvironment. Additionally, microtechnology is conceptually well-suited for the development of fast, low-cost in vitro systems that allow for high-throughput culturing and analysis of cells under large numbers of conditions. In this interview, Albert Folch explains these limitations, how they can be overcome with soft lithography and microfluidics, and describes some relevant examples of research in his lab and future directions.

BioMEMS 및 세포 생물학 : 관점 및 응용 프로그램

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in ...

연구

생물학

Evaluation of Injury-induced Senescence and In Vivo Reprogramming in the Skeletal Muscle

Cellular senescence is a stress response that is characterized by a stable cellular growth arrest, which is important for many physiological and pathological processes, such as cancer and ageing. Recently, senescence has also been implicated in tissue repair and regeneration. Therefore, it has become increasingly critical to identify senescent cells in vivo. Senescence-associated &#946;-galactosidase (SA-&#946;-Gal) assay is the most widely used assay to detect senescent cells both in culture and in vivo. This assay is based on the increased lysosomal contents in the senescent cells, which allows the histochemical detection of lysosomal &#946;-galactosidase activity at suboptimum pH (6 or 5.5). In comparison with other assays, such as flow cytometry, this allows the identification of senescent cells in their resident environment, which offers valuable information such as the location relating to the tissue architecture, the morphology, and the possibility of coupling with other markers via immunohistochemistry&#160;(IHC). The major limitation of the SA-&#946;-Gal assay is the requirement of fresh or frozen samples.
Here, we present a detailed protocol to understand how cellular senescence promotes cellular plasticity and tissue regeneration in vivo. We use SA-&#946;-Gal to detect senescent cells in the skeletal muscle upon injury, which is a well-established system to study tissue regeneration. Moreover, we use&#160;IHC to detect Nanog, a marker of pluripotent stem cells, in a transgenic mouse model. This protocol enables us to examine and quantify cellular senescence in the context of induced cellular plasticity and in vivo reprogramming.

Evaluation of Injury-induced Senescence and In Vivo Reprogramming in the Skeletal Muscle

Here we present a detailed protocol to detect both senescent and pluripotent stem cells in the skeletal muscle upon injury while inducing in vivo reprogramming. This method is suitable for evaluating the role of cellular senescence during tissue regeneration and reprogramming in vivo.

부상-유도 노화 및 골격 근육에서 프로그래밍을 Vivo에서 의 평가

Cellular senescence is a stress response that is characterized by a stable cellular growth arrest, which is important for many physiological and ...

발생학

A Sensitive Method to Quantify Senescent Cancer Cells

Human cells do not indefinitely proliferate. Upon external and/or intrinsic cues, cells might die or enter a stable cell cycle arrest called senescence. Several cellular mechanisms, such as telomere shortening and abnormal expression of mitogenic oncogenes, have been shown to cause senescence. Senescence is not restricted to normal cells; cancer cells have also been reported to senesce.
	Chemotherapeutical drugs have been shown to induce senescence in cancer cells. However, it remains controversial whether senescence prevents or promotes tumorigenesis. As it might eventually be patient-specific, a rapid and sensitive method to assess senescence in cancer cell will soon be required.
	To this end, the standard &beta;-galactosidase assay, the currently used method, presents major drawbacks: it is time consuming and not sensitive. We propose here a flow cytometry-based assay to study senescence on live cells. This assay offers the advantage of being rapid, sensitive, and can be coupled to the immunolabeling of various cellular markers.

Whether senescence prevents or promotes tumorigenesis remains controversial. Since chemotherapeutical drugs can induce cancer cells to senesce, studying senescence is essential for proposing new therapies. However, the standard and broadly used &beta;-galactosidase assay presents major drawbacks. We propose here a rapid and sensitive flow cytometry-based assay to quantify senescence.

노화 암 세포를 정량화하는 민감한 방법

Human cells do not indefinitely proliferate. Upon external and/or intrinsic  cues, cells might die or enter a stable cell cycle arrest called senescence. ...

의학

Induction and Validation of Cellular Senescence in Primary Human Cells

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a hallmark of various pathophysiological conditions including tumor suppression, tissue remodeling and aging. The inducers of cellular senescence in vivo are still poorly characterized. However, a number of stimuli can be used to promote cellular senescence ex vivo. Among them, most common senescence-inducers are replicative exhaustion, ionizing and non-ionizing radiation, genotoxic drugs, oxidative stress, and demethylating and acetylating agents. Here, we will provide detailed instructions on how to use these stimuli to induce fibroblasts into senescence. This protocol can easily be adapted for different types of primary cells and cell lines, including cancer cells. We also describe different methods for the validation of senescence induction. In particular, we focus on measuring the activity of the lysosomal enzyme Senescence-Associated &#946;-galactosidase (SA-&#946;-gal), the rate of DNA synthesis using 5-ethynyl-2&#39;-deoxyuridine (EdU) incorporation assay, the levels of expression of the cell cycle inhibitors p16 and p21, and the expression and secretion of members of the Senescence-Associated Secretory Phenotype (SASP). Finally, we provide example results and discuss further applications of these protocols.

Here, we discuss a series of protocols for induction and validation of cellular senescence in cultured cells. We focus on different senescence-inducing stimuli and describe the quantification of common senescence-associated markers. We provide technical details using fibroblasts as a model, but the protocols can be adapted to various cellular models.

유도 및 기본 인간 세포에서 세포 노화의 유효성 검사

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

A Quantitative Measurement of Reactive Oxygen Species and Senescence-associated Secretory Phenotype in Normal Human Fibroblasts During Oncogene-induced Senescence

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. Recent studies have extended the role of cellular senescence to various physiological processes, including development, wound healing, immune surveillance, and age-related tissue dysfunction. Although cell cycle arrest is a critical hallmark of cellular senescence, an increased intracellular reactive oxygen species (ROS) production has also been demonstrated to play an important role in the induction of cellular senescence. In addition, recent studies revealed that senescent cells exhibit potent paracrine activities on neighboring cells and tissues through a senescence-associated secretory phenotype (SASP). The sharp increase in interest regarding therapeutic strategies against cellular senescence emphasizes the need for a precise understanding of senescence mechanisms, including intracellular ROS and the SASP. Here, we describe protocols for quantitatively assessing intracellular ROS levels during H-Ras-induced cellular senescence using ROS-sensitive fluorescent dye and flow cytometry. In addition, we introduce sensitive techniques for the analysis of the induction of mRNA expression and secretion of SASP factors. These protocols can be applied to various cellular senescence models.

Intracellular ROS has been shown to play an important role in the induction of cellular senescence. Here, we describe a sensitive assay for quantifying ROS levels during cellular senescence. We also provide protocols for assessing the senescence-associated secretory phenotype, which reportedly contributes to various age-related dysfunctions.

Oncogene 유도 노화 중 반응성 산소 종 및 정상적인 인간 섬유 아 세포에서 분 비 형 노화 관련의 정량적 측정

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. ...

Simultaneous Imaging and Flow-Cytometry-based Detection of Multiple Fluorescent Senescence Markers in Therapy-Induced Senescent Cancer Cells

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, senescence is a fundamentally different machinery restraining&#160;propagation of cancer cells. Decades of scientific studies have revealed the complex pathological effects of senescent cancer cells in tumors and microenvironments that modulate cancer cells and stromal cells. New evidence suggests that senescence is a potent prognostic factor during cancer treatment, and therefore rapid and accurate detection of senescent cells in cancer samples is essential. This paper presents a method to visualize and detect therapy-induced senescence (TIS) in cancer cells. Diffuse large B-cell lymphoma (DLBCL) cell lines were treated with mafosfamide (MAF) or daunorubicin (DN) and examined for the senescence marker, senescence-associated &#946;-galactosidase (SA-&#946;-gal), the DNA synthesis marker 5-ethynyl-2&#8242;-deoxyuridine (EdU), and the DNA damage marker gamma-H2AX (&#947;H2AX). Flow cytometer imaging can help generate high-resolution single-cell images in a short period of time to simultaneously visualize and quantify the three markers in cancer cells.

Here we present a flow cytometry-based method for visualization and quantification of multiple senescence-associated markers in single cells.

치료 유도 노인성 암 세포에서 다중 형광 노화 마커의 동시 이미징 및 유동 세포 측정 기반 검출

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, ...

암 연구학

Far-Red Fluorescent Senescence-Associated &#946;-Galactosidase Probe for Identification and Enrichment of Senescent Tumor Cells by Flow Cytometry

Cellular senescence is a state of proliferative arrest induced by biological damage that normally accrues over years in aging cells but may also emerge rapidly in tumor cells as a response to damage induced by various cancer treatments. Tumor cell senescence is generally considered undesirable, as senescent cells become resistant to death and block tumor remission while exacerbating tumor malignancy and treatment resistance. Therefore, the identification of senescent tumor cells is of ongoing interest to the cancer research community. Various senescence assays exist, many based on the activity of the well-known senescence marker, senescence-associated beta-galactosidase (SA-&#946;-Gal). 
Typically, the SA-&#946;-Gal assay is performed using a chromogenic substrate (X-Gal) on fixed cells, with the slow and subjective enumeration of "blue" senescent cells by light microscopy. Improved assays using cell-permeant, fluorescent SA-&#946;-Gal substrates, including C12-FDG (green) and DDAO-Galactoside (DDAOG; far-red), have enabled the analysis of living cells and allowed the use of high-throughput fluorescent analysis platforms, including flow cytometers. C12-FDG is a well-documented probe for SA-&#946;-Gal, but its green fluorescent emission overlaps with intrinsic cellular autofluorescence (AF) that arises during senescence due to the accumulation of lipofuscin aggregates. By utilizing the far-red SA-&#946;-Gal probe DDAOG, green cellular autofluorescence can be used as a secondary parameter to confirm senescence, adding reliability to the assay. The remaining fluorescence channels can be used for cell viability staining or optional fluorescent immunolabeling.
Using flow cytometry, we demonstrate the use of DDAOG and lipofuscin autofluorescence as a dual-parameter assay for the identification of senescent tumor cells. Quantitation of the percentage of viable senescent cells is performed. If desired, an optional immunolabeling step may be included to evaluate cell surface antigens of interest. Identified senescent cells can also be flow cytometrically sorted and collected for downstream analysis. Collected senescent cells can be immediately lysed (e.g., for immunoassays or 'omics analysis) or further cultured.

A protocol for fluorescent, flow cytometric quantification of senescent cancer cells induced by chemotherapy drugs in cell culture or in murine tumor models is presented. Optional procedures include co-immunostaining, sample fixation to facilitate large batch or time point analysis, and the enrichment of viable senescent cells by flow cytometric sorting.

유세포분석을 통한 노화 종양 세포의 식별 및 농축을 위한 원적색 형광 노화 관련 β-갈락토시다아제 프로브

Cellular senescence is a state of proliferative arrest induced by biological damage that normally accrues over years in aging cells but may also emerge ...

Measurement of Protein Turnover Rates in Senescent and Non-Dividing Cultured Cells with Metabolic Labeling and Mass Spectrometry

Mounting evidence has shown that the accumulation of senescent cells in the central nervous system contributes to neurodegenerative disorders such as Alzheimer&#39;s and Parkinson&#39;s diseases. Cellular senescence is a state of permanent cell cycle arrest that typically occurs in response to exposure to sub-lethal stresses. However, like other non-dividing cells, senescent cells remain metabolically active and carry out many functions that require unique transcriptional and translational demands and widespread changes in the intracellular and secreted proteomes. Understanding how protein synthesis and decay rates change during senescence can illuminate the underlying mechanisms of cellular senescence and find potential therapeutic avenues for diseases exacerbated by senescent cells. This paper describes a method for proteome-scale evaluation of protein half-lives in non-dividing cells using pulsed stable isotope labeling by amino acids in cell culture (pSILAC) in combination with mass spectrometry. pSILAC involves metabolic labeling of cells with stable heavy isotope-containing versions of amino acids. Coupled with modern mass spectrometry approaches, pSILAC enables the measurement of protein turnover of hundreds or thousands of proteins in complex mixtures. After metabolic labeling, the turnover dynamics of proteins can be determined based on the relative enrichment of heavy isotopes in peptides detected by mass spectrometry. In this protocol, a workflow is described for the generation of senescent fibroblast cultures and similarly arrested quiescent fibroblasts, as well as a simplified, single-time point pSILAC labeling time-course that maximizes coverage of anticipated protein turnover rates. Further, a pipeline is presented for the analysis of pSILAC mass spectrometry data and user-friendly calculation of protein degradation rates using spreadsheets. The application of this protocol can be extended beyond senescent cells to any non-dividing cultured cells such as neurons.

This protocol describes the workflow for metabolic labeling of senescent and non-dividing cells with pulsed SILAC, untargeted mass spectrometry analysis, and a streamlined calculation of protein half-lives.

대사 표지 및 질량 분광법으로 노화 및 비분할 배양된 세포에서의 단백질 회전율 측정

Mounting evidence has shown that the accumulation of senescent cells in the central nervous system contributes to neurodegenerative disorders such as ...

생화학

SA-&#946;-Galactosidase-Based Screening Assay for the Identification of Senotherapeutic Drugs

Cell senescence is one of the hallmarks of aging known to negatively influence a healthy lifespan. Drugs able to kill senescent cells specifically in cell culture, termed senolytics, can reduce the senescent cell burden in vivo and extend healthspan. Multiple classes of senolytics have been identified to date including HSP90 inhibitors, Bcl-2 family inhibitors, piperlongumine, a FOXO4 inhibitory peptide and the combination of Dasatinib/Quercetin. Detection of SA-&#946;-Gal at an increased lysosomal pH is one of the best characterized markers for the detection of senescent cells. Live cell measurements of senescence-associated &#946;-galactosidase (SA-&#946;-Gal) activity using the fluorescent substrate C12FDG in combination with the determination of the total cell number using a DNA intercalating Hoechst dye opens the possibility to screen for senotherapeutic drugs that either reduce overall SA-&#946;-Gal activity by killing of senescent cells (senolytics) or by suppressing SA-&#946;-Gal and other phenotypes of senescent cells (senomorphics). Use of a high content fluorescent image acquisition and analysis platform allows for the rapid, high throughput screening of drug libraries for effects on SA-&#946;-Gal, cell morphology and cell number.

Cellular senescence is the key factor in the development of chronic age-related pathologies. Identification of therapeutics that target senescent cells show promise for extending healthy aging. Here, we present a novel assay to screen for the identification of senotherapeutics based on measurement of senescence associated &#946;-Galactosidase activity in single cells.

SA-β-갈락토시다아제 계 선별 분석법

Cell senescence is one of the hallmarks of aging known to negatively influence a healthy lifespan. Drugs able to kill senescent cells specifically in cell ...

Flow Cytometry-Based Quantification of Therapy-Induced Senescent Cancer Cells

Source: Flor, A., et al. <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/64176">Far-Red Fluorescent Senescence-Associated &#946;-Galactosidase Probe for Identification and Enrichment of Senescent Tumor Cells by Flow Cytometry.</a> J. Vis. Exp. (2022)
This video illustrates a flow cytometry-based assay for quantifying therapy-induced senescent cancer cells with dual senescence markers. The detection and quantification of senescent cells involve using a &#946;-galactosidase substrate. The substrate is cleaved by active lysosomal &#946;-galactosidase within the senescent cells, producing a fluorescent product that, in conjunction with autofluorescent lipofuscin granules, marks the senescent cancer cells.

therapy-induced senescent cancer cells의 유세포 분석 기반 정량화

1. Induction of senescence by chemotherapy drugs in cultured cancer cells
NOTE: All cell manipulation steps in this section should be performed in a ...