(-, 15분의 2,010 9,980 5 밀레 N 당. 특별 프로그램 분자 임상 종양)와, 대학 수업의 이탈리아 교육부에서 MF (MFAG 11676)에 암 연구를위한 이탈리아 협회 (AIRC)로부터 MN에 자금을 지원하는 MN에 대한 연구 FIRB 2011 (프로젝트 RBAPIIBYNP).

혈장 또는 혈청에서 마이크로 RNA 분리 참고 : 플라즈마 및 혈청 준비의 miRNA 정량 순환에 중요한 단계이다. 플라즈마 및 혈청 준비를위한 기본 절차는 없습니다. 고려해야 만 중요한 것은 동일한 실험에서 모든 샘플은 동일 흐름을 사용하여 처리 할 수​​ 있어야한다는 것이다. 200 μL의 혈청 또는 혈장에서 시작합니다. 총 RNA를 상업적으로 이용 가능한 키트를 사용하여 혈청 또는 혈장으로부터 분리 될 수있다. 1. (miRNA를 포함) 총 RNA를위한 프로토콜 절연 <ol><li> 얼음에 해동 혈청 / 혈장 샘플. </li><li> 200 μL 혈청 / 플라즈마에 용해 시약 (예., QIAzol)의 1 ML을 추가합니다. </li><li> 텍싱하여 혼합하고 5 분 동안 실온에서 벤치에 균질를 포함하는 튜브를 배치합니다. </li><li> C.에서 합성의 miRNA CEL-은 miR-39-3p의 4.16 nM의 용액 3 μl를 추가 간스. </li><li> 클로로포름 200 μl를 추가합니다. 15 초 동안 적극적으로 튜브를 흔들어. 장소 일2 분 동안 실온에서 벤치에 전자 튜브. </li><li> 4 ° C에서 12,000 XG에 15 분 동안 원심 분리 단계 분리를 구하는 : 위 수성 단계는 RNA가 포함되어 있습니다. </li><li> , 새로운 튜브에 700 μl를 수성 상을 이동하는 흰색 계면 물질의 이동을 피하십시오. </li><li> 100 % 에탄올 1 ML을 추가하고 반전으로 섞는다. </li><li> 피펫은 최대 미니 스핀 컬럼에 시료 700 μL은 2 ㎖의 포집 관에 배치합니다. 15 초 동안 12,000 XG에 뚜껑 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. </li><li> 나머지 샘플을 사용하여이 단계를 반복합니다. </li><li> 미니 스핀 컬럼에 700 ㎕의 버퍼 RWT 추가 열을 씻어 12,000 XG에 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. </li><li> 미니 스핀 열에 피펫 500 μL 버퍼 RPE. 12,000 rpm에서 15 초 동안 뚜껑과 원심 분리기를 닫습니다. 흐름 -을 통해 폐기하십시오. 다시이 단계를 반복합니다. </li><li> 스핀 열을 건조 2 분 동안 전속력으로 미니 스핀 컬럼을 원심 분리기잔류 에탄올에서 막. </li><li> 컬럼의 막에 새로운 1.5 ml의 수집 관 및 피펫 35 μL의 RNA 분해 효소가없는 물을에 미니​​ 스핀 컬럼을 전송합니다. </li><li> RNA의를 용출 12,000 XG에서 1 분 동안 원심 분리기. </li><li> -80 ° C에서 RNA를 저장합니다. 주 : RNA의 농도를 정확하게 측정 할 수 없기 때문에, 입력 된 금액에 대한 척도로서 고정 볼륨을 사용한다. </li></ol> 2. 마이크로 RNA 역전사 <ol><li> 배 반응 완충액 클레아없는 물 : 역전사 (RT) 시약을 혼합 성분을 해동. 믹스 부드럽게 얼음에 튜브와 장소를 반전. 즉시 사용하기 전에, 냉동고에서 효소 믹스를 제거하고 얼음에 배치합니다. 모든 시약을 스핀. </li><li> 표 1에 설명 된 바와 같이 얼음의 RT 시약 혼합물을 준비한다. 적어도 10 %를 초과하는 조합을 준비한다. </li><li> 피펫으로 반응을 혼합 한 다음 스핀 다운. </li><li> 42 ℃에서 60 분 동안 품어. </li><li> 되돌리기를 열 - 불 활성화95 ℃에서 5 분 자체의 효소. </li><li> 즉시 4 ℃로 냉각. </li><li> -20 ° C에서 cDNA를 저장합니다. </li></ol> 3. cDNA를 희석 <ol><li> 클레아없는 물에서 계획된 ddPCR 반응에 필요한 서식하는 cDNA의 양을 희석. 1:50 1 사이의 cDNA의 반응을 희석 : (500)을 물에 대상 miRNA의 풍부에 따라 다릅니다. -20 ° C에서 희석 된 cDNA를 저장합니다. 희석 된 cDNA는 -20 ° C에서 3 개월 이상 안정한 것으로 판명되었다. </li></ol> 4. 물방울 생성 및 PCR 주 : 액적 생성 한 번에 8 개의 샘플들에 대해 수행되어야한다. 기술 복제로 인해 12,15 .A 아니 템플릿 컨트롤 (NTC) 샘플은 모든 판에서 실행되어야합니다이 기술의 높은 재현성에 각각 다른 ddPCR 조건에 대해, 필요하지 않습니다. <ol><li> 해동 마스터 믹스를 평형 (예., EvaGreen 마스터 믹스) 실온에서, 마이크로 RNA 프라이머 세트와 cDNA를. </li><li> 마스터 믹스 번째 믹스oroughly 튜브를 수회 반전. 모든 시약을 스핀 다운. </li><li> 표 2에 기재된 바와 같이 ddPCR 혼합물을 준비한다. 여러 ddPCR 반응이 수행되는 경우, 작동 ddPCR-용액을 섞어 제조. 10 % 이상 초과 믹스를 준비합니다. </li><li> 조립 후 잘 혼합하고 ddPCR 믹스를 스핀 다운. </li><li> ddPCR 12 μL를 96- 웰 PCR 플레이트 또는 PCR 튜브에 혼입 분배. </li><li> 잘 / 각각의 튜브로 희석 cDNA를 템플릿의 8 μl를 추가합니다. </li><li> 홀더에 방울 생성기 카트리지를 삽입합니다. </li><li> 전송 공기를 피하는 웰의 바닥에 기포 조심하면서 방울 생성기 카트리지의 샘플 웰 (중간 행)에 각각 준비된 샘플 20 μL. </li><li> 방울 생성기 오일의 70 μl를 각 유정 (아랫 줄)을 입력합니다. </li><li> 카트리지 홀더 위에 개스킷 후크 및 방울 생성기 삽입. </li><li> 제조 업체의 홍보에 따른 액적 생성을 시작하기 위해 덮개를 닫습니다otocol. 액적 생성이 완료되면, 뚜껑을 열고 일회용 가스켓을 제거합니다. 카트리지의 상단 우물은 물방울이 포함되어 있습니다. </li><li> 96 웰 PCR 플레이트의 한 칼럼에 팔 상부 웰 (액적)의 내용 피펫 천천히 부드럽게 40 μL. </li><li> 즉시 증발을 방지하기 위해 물방울 전사 후 호일 PCR 플레이트를 밀봉. 액적 리더의 바늘과 호환되는 천 공식 박 플레이트 씰을 사용합니다. </li><li> 플레이트를 밀봉 30 분 이내에 열 사이클링 (PCR)를 시작합니다. </li><li> 표 3에 따른 순환 프로토콜을 수행합니다. </li></ol> 5. 물방울 읽기 <ol><li> 액적 리더의 전원을 켭니다. </li><li> 액적 리더에 열 자전거 타는 사람에서 접시를 이동합니다. </li><li> 판 홀더의베이스로 후 PCR 방울을 함유하는 96 웰 PCR 플레이트를 놓는다. </li><li> PCR을 접시에 판 홀더의 상부를 놓습니다. 단단히 모두 분리 탭을 눌러아래 홀더에 PCR 플레이트를 고정합니다. </li><li> 시스템 PC에서 소프트웨어를 시작합니다. <ol><li> 실험 (절대 정량)를 정의하는 설정을 클릭 한 다음 방울​​ 독서를 시작하려면 실행을 클릭합니다. </li><li> 액적 판독이 완료되면, 열기를 클릭하여 데이터를 분석하는 버튼 &quot;분석&quot;. </li><li> 양의 물방울 (올가미 도구) (그림 1B)를 선택하는 분석 소프트웨어에서 2D 진폭 플롯을 사용합니다. </li><li> 긍정적이고 총 방울의 수를 확인하기 위해 이벤트 탭을 사용합니다. 18,000의 총 - 21,000 방울은 일반적으로 probeless ddPCR 달성된다. </li><li> 양의 물방울이 선택되면, 농도 탭에서 수출 .CSV 옵션을 사용하여 miRNA의 농도 값을 내보낼 수 있습니다. </li></ol></li></ol>

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

The authors have nothing to disclose.

순환의 miRNAs는 매우 낮은 농도에서 혈액 내 존재하는 혈장 및 혈청 샘플에서 추출 할 수있는 RNA의 양이 적다. 이 때문에, 그것들은 마이크로 어레이 및 RNA 서열 분석과 같은 다른 기술을 정량화하기 어렵다. 또한, 데이터의 정규화 계약 일반화 부족 혈중 내인성 &quot;참조&quot;의 miRNAs의 존재가있다. 이러한 맥락에서, 혈청 또는 혈장해도 매우 낮은 1 ㎖ 당 miRNA의 매수를 카운트 할 수있는 액적 디지털 PCR과 같은 중요한 기술은 매우 매력적이다. 우리는-역의 사본을 만듭니다 때문에 시간을 절약하고, 가장 중요한, RNA 소재 하나의 반응에있는 모든 순환의 miRNAs를 보편적 인 cDNA를 시스템에이 기술을 쌍. 우리의 접근에서, 특이도는 다른 솔루션에 비해 16 miRNA의 정량화 매우 잘 수행 LNA 프라이머의 사용에 고유하다. 작은 물방울디지털 PCR은 표적 유전자의 농도를 산출 절대 허용하는 종점 분석법이다. 정량 PCR과는 달리, 부적절한 증폭 효율이 최종 ddPCR 정량에 영향을주지 않습니다. 따라서, 혈액 샘플에서 예를 들어, 본 PCR 억제제의 양을 고려 ddPCR 핵산 평가를 순환시키기위한 강력한 도구를 제공한다. 그것의 높은 감도로,이 기술에도 출발 물질이 제한된 양으로도 풍부한 이하의 miRNAs 적절한 정량화를 제공한다. 또한, 각각의 miRNA 분자는 되감기의 cDNA 분자 전사된다고 가정하면, 우리는 희석 계수 (145.83)에 대해 ddPCR 반응 값의 획득 된 농도를 곱하여 1 ㎕의 혈장 / 혈청 절대 복사본을 계산할 수있다. 제시된 플로 쉽게 따라서 Clinica는 마이크로 RNA의 정량 신뢰성 및 시간 효율적인 툴을 제공하는 시점에서 8-96 샘플들에 수행 될 수있다리터 샘플. 디지털 PCR은 핵산을위한 필수적인 도구가되어 침대 옆에 벤치에서 액체 생검을 가져, 진단 설정에서 평가를 바이오 마커가 될 수있는 잠재력을 가지고 방울입니다.

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table><tbody><tr><td>miRNeasy Mini Kit</td><td>Qiagen</td><td>217004</td><td>Columns for total RNA, including miRNA, extraction from serum/plasma</td></tr><tr><td>100 nmole RNA oligo Cel-miR-39-3p</td><td>Integrated DNA Technologies</td><td>Custom</td><td>Sequence: UCACCGGGUGUAAAUCAGCUUG</td></tr><tr><td>Universal cDNA synthesis kit II, 8-64 rxns</td><td>Exiqon</td><td>203301</td><td>Kit for microRNA reverse transcription</td></tr><tr><td>MicroRNA LNA PCR primer set&amp;nbsp;</td><td>Exiqon</td><td>204000-206xxx and 2100000-21xxxxx</td><td>Primers for miRNA amplification inside droplets</td></tr><tr><td>QX200 droplet generator</td><td>BioRad</td><td>186-4002</td><td>Instrument used for droplet reading</td></tr><tr><td>QX200 droplet reader</td><td>BioRad</td><td>186-4003</td><td>Instrument used for droplet generation</td></tr><tr><td>QuantaSoft software</td><td>BioRad</td><td>186-3007</td><td>Software for data collection and analysis</td></tr><tr><td>PX1 PCR plate sealer</td><td>BioRad</td><td>181-4000</td><td>Plate sealer</td></tr><tr><td>DG8 droplet generator cartridges and gaskets</td><td>BioRad</td><td>186-4008</td><td>Cartridges used to mix sample and oil to generate droplets</td></tr><tr><td>QX200 ddPCR EvaGreen supermix</td><td>BioRad</td><td>186-4033/36</td><td>PCR supermix</td></tr><tr><td>QX200 droplet generator oil for EvaGreen dye</td><td>BioRad</td><td>186-4005</td><td>Oil for droplet generation</td></tr></tbody></table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

마이크로 RNA (miRNA가) (무 세포들)은 순환 혈류로 세포로부터 방출된다. 순환 특정 마이크로 RNA의 양은 질병 상태에 연결된 질병 표지자로서 사용될 수있는 잠재력을 가지고있다. 디지털 PCR 기술 염료 계 화학 제를 사용하여 액적 마이크로 RNA 정량화를 순환 민감하고 정확한 방법이 최근 개발되고있다. 구체적으로, 핵산 (LNA)을 그 고유의 miRNA의 절대 정량을 얻을 수있다 호환 액적 디지털 PCR 시스템에서 녹색 형광 DNA 결합 염료 miRNA에 특이 적 프라이머를 사용하여 잠김 기반. 여기, 우리는이 기술을 수행하는 플라즈마 및 혈청 등의 생물학적 유체에서 miRNA의 양을 평가하는 방법을 설명, 가능하고 효과적이다.

혈장 또는 혈청 1 ㎖ 당 특정의 miRNAs의 절대량 디지털 PCR 기술을 녹색 형광 DNA 결합 염료를 사용하여 액적으로 결정될 수있다. (1)가 최종 miRNA의 농도를 결정하는 포지티브 방울 선택의 과정을 제시 도면 (그 사본 / μL ) 분석 소프트웨어에 의해 계산 된 증폭 반응이다. 혈액의 각 miRNA의 양은 다른 것들보다 일부의 miRNA 종 더 풍부되고, 매우 상이하다. ddPCR 반응의 1:50 희석 된 cDNA를 사용하여이 양 및 음 적의 적절한 수를 얻을 수있다. 양 액적 포화 (예., 남아있는 네거티브 방울)의 경우의 cDNA 샘플의 추가 희석이 필요할 수있다. 모든 LNA 프라이머 세트는 방울 디지털 PCR 시스템에서 제대로 작동하도록 최적화되어야한다. 은 miR-181a-5P의 최적화 과정이다도 2에 나타낸 즉, (일반적으로 0.25의 범위 - ddPCR 반응 당 1 μL) 프라이머의 변화량.와 (보통 56의 범위 - 60 ° C) 어닐링 온도, 상기 조합을 선택할 수있다 즉, 양극과 음극 방울 사이의 더 나은 분리를 결정합니다. 은 miR-181a-5P, 60 ℃ 어닐링 온도가 모두 0.5 내지 1 μL 프라이머 량의 경우에, 액적 크기의 측면에서 더 좋은 결과를 제공한다. 이 프라이머 세트가 형성-이량 체의 프라이머 아마도 몇 가지 비특이적 증폭을 준다 발생할 수 있습니다. 의 miRNAs 순환 작업 할 때, 샘플에서 긍정적 인 신호는 매우 낮은 비 특정 신호에 따라서 유사 할 수있다. 비특이적 표적 증폭의 &quot;클라우드&quot;참 신호 (도 1C)과 중첩되지 않는 경우,이 miRNA를 여전히 참 선택 정량화 할 수있다<html> 긍정적 인 방울. 이 경우, NTC 샘플 액적 선택을 위해 필수적이다. 동일한 분석에 포함되는 모든 샘플은 동일한 방법론과 동일한 ddPCR 조건을 사용하여 처리 할 필요가있다. <img alt="그림 1" src="/files/ftp_upload/54102/54102fig1.jpg" /> 그림 1. 긍정적 인 물방울 선택. 포지티브 방울 수동 1D 플롯 (A) 또는 2D 플롯 (B)의 양의 클라우드 액적 주위에 원을 수행하는 음극 액 적을 상기 임계치를 이용한 분석에서 선택된다. 일부 프라이머 세트는 비특이적 증폭을 제공하는 경우, 이것은 음성 대조군 (없음 템플릿 관리, NTC) 샘플 (C)에 나타납니다 긍정적 인 방울의 두 번째 구름에 의해 입증된다. 은 &quot;true&quot;로 양성은 여전히​​ 2D 플롯의 비특이적 신호 제외 선택할 수 있습니다.e.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 2" src="/files/ftp_upload/54102/54102fig2.jpg" /> Probeless ddPCR와 세포 무료 miRNA의 정량화 그림 2. 프라이머 최적화 상단 패널 :. 4 가지 ddPCR 조건을 사용하여 두 개의 혈장 샘플 (S1 및 S2)에서은 miR-181a-5P의 정량화. MIR-181a-5P LNA 프라이머 농도 (0.5 내지 1 μL) 및 소둔 온도 (58 ~ 60 ° C)의 DNA-인터 염료 ddPCR의 양 (청색)의 진폭 및 음 (블랙) 방울에 영향을 미친다. 이 miRNA를위한 더 나은 분리는 60 ° C에서 PCR을 수행하고, 0.5 μL 어느 한 프라이머를 사용하여 얻을 수있다. 예상대로 제​​어 샘플 (NTC, 아니 템플릿 컨트롤), 더 긍정적 인 물방울이 없습니다. 중앙 패널 : 상기 언급 된 조건은 miR-181-5p의 최종 농도. 결과는 전기 Ampli에서 마이크로 리터 당 사본으로 표시하고 있습니다문법을 없애는 반응. 오차 막대는 포아송 95 % 신뢰 구간을 나타낸다. 낮은 패널 :. 물방울 (녹색)의 총 수에 긍정적 인 물방울 (파란색)의 수 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54102/54102fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table fo:keep-together.within-page="1"><tbody><tr><td> 시약 </td><td> 볼륨 (μL) </td></tr><tr><td> 5 배 반응 버퍼 </td><td> 4 </td></tr><tr><td> 클레아없는 물 </td><td> (11) </td></tr><tr><td> 효소 믹스 </td><td> 이 </td></tr><tr><td> 템플릿 총 RNA </td><td> 삼 </td></tr><tr><td> 총 볼륨 </td><td> (20) </td></tr></tbody></table> 표 1 - 역전사 시약 믹스 구성 요소 <table fo:keep-together.within-p나이 = &quot;1&quot;&gt; <tbody><tr><td> 시약 </td><td> 볼륨 (μL) </td></tr><tr><td> 배 염료 수퍼 믹스를 DNA 결합 </td><td> (10) </td></tr><tr><td> LNA의 프라이머 세트 </td><td> 변수 (0.5 - 1)의 * </td></tr><tr><td> 클레아없는 물 </td><td> 변하기 쉬운 </td></tr><tr><td> 희석 cDNA를 템플릿 </td><td> 8 </td></tr><tr><td> 총 볼륨 </td><td> (20) </td></tr><tr><td></td><td></td></tr><tr><td colspan="2"> * 제 ddPCR 반응은 프라이머의 최고의 작업 양을 설정하는 몇 가지 샘플을 수행해야한다 </td></tr></tbody></table> 표 2 - ddPCR 시약 믹스 구성 요소 <table fo:keep-together.within-page="1"><tbody><tr><td> 사이클링 단계 </td><td> 온도 </td><td> 시각</td><td> 램핑 속도 </td><td> 사이클 </td></tr><tr><td> 효소 활성화 </td><td> 95 ° C </td><td> 5 분 </td><td rowspan="6"> ~ 2 ° C / 초 </td><td> 1 </td></tr><tr><td> 변성 </td><td> 95 ° C </td><td> 30 초 </td><td rowspan="2"> (40) </td></tr><tr><td> 소둔 / 확장 </td><td> 60 ° C </td><td> 1 분 </td></tr><tr><td rowspan="2"> 신호 안정화 </td><td> 4 ° C </td><td> 5 분 </td><td> 1 </td></tr><tr><td> 90 ° C </td><td> 5 분 </td><td> 1 </td></tr><tr><td> 홀드 (선택 사항) </td><td> 4 ° C </td><td> 무한의 </td><td> 1 </td></tr><tr><td></td><td></td><td></td><td></td><td></td></tr><tr><td colspan="4"> 105 ° C로 설정 가열 뚜껑을 사용하여 40 μL로 샘플 볼륨을 설정합니다. </td><td></td></tr></tbody></table>표 3 - 물방울 디지털 PCR을위한 열 사이클링 조건

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

마이크로 RNA 정량는 DNA 결합 염료 화학, 물방울 디지털 PCR을 사용하여 순환

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

8.5K 조회수.  University of Bologna. A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

비디오: Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

높은 처리량 MicroRNA의 프로파일 : 최적 멀티 플렉스 플루 동적 ArrayTM의 IFCs에 Nanoliter의 규모 qRT - PCR

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

연구

생체공학

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular ...

암 연구학

Enrichment of Native Lipoprotein Particles with microRNA and Subsequent Determination of Their Absolute/Relative microRNA Content and Their Cellular Transfer Rate

Lipoprotein particles are predominately transporters of lipids and cholesterol in the bloodstream. Furthermore, they contain small amounts of strands of noncoding microRNA (miRNA). In general, miRNA alters the protein expression profile due to interactions with messenger-RNA (mRNA). Thus, knowledge of the relative and absolute miRNA content of lipoprotein particles is essential to estimate the biological effect of cellular particle uptake. Here, a quantitative real-time polymerase chain reaction (qPCR)-based protocol is presented to determine the absolute miRNA content of lipoprotein particles&#8212;exemplified shown for native and miRNA-enriched lipoprotein particles. The relative miRNA content is quantified using multiwell microfluidic array cards. Furthermore, this protocol allows scientists to estimate the cellular miRNA and, thus, the lipoprotein particle uptake rate. A significant increase of the cellular miRNA level is observable when using high-density lipoprotein (HDL) particles artificially loaded with miRNA, whereas incubation with native HDL particles yields no significant effect due to their rather low miRNA content. In contrast, the cellular uptake of low-density lipoprotein (LDL) particles&#8212;neither with native miRNA nor artificially loaded with it&#8212;did not alter the cellular miRNA level.

Here, a quantitative real-time polymerase chain reaction-based protocol is presented for the determination of the native micro-RNA content (absolute/relative) of lipoprotein particles. In addition, a method for increasing the micro-RNA level, as well as a method for determining the cellular uptake rate of lipoprotein particles, is demonstrated.

마이크로 로르 나를 사용한 네이티브 단백 입자의 농축과 그에 따른 절대/상대 미세 유 변 함량 및 셀룰러 전송 속도의 후속 측정

Lipoprotein particles are predominately transporters of lipids and cholesterol in the bloodstream. Furthermore, they contain small amounts of strands of ...

생화학

Digital PCR for Quantifying Circulating MicroRNAs in Acute Myocardial Infarction and Cardiovascular Disease

Circulating serum microRNAs (miRNAs) have shown promise as biomarkers for the cardiovascular disease and acute myocardial infarction (AMI), being released from the cardiovascular cells into the circulation. Circulating miRNAs are highly stable and can be quantified. The quantitative expression of specific miRNAs can be linked to the pathology, and some miRNAs show high tissue and disease specificity. Finding novel biomarkers for cardiovascular diseases is of importance for medical research. Quite recently, digital polymerase chain reaction (dPCR) has been invented. dPCR, combined with fluorescent hydrolysis probes, enables specific direct absolute quantification. dPCR exhibits superior technical qualities, including a low variability, high linearity, and high sensitivity compared to the quantitative polymerase chain reaction (qPCR). Thus, dPCR is a more accurate and reproducible method for directly quantifying miRNAs, particularly for the use in large multi-center cardiovascular clinical trials. In this publication, we describe how to effectively perform digital PCR in order to assess the absolute copy number in serum samples.

Circulating microRNAs have shown promise as biomarkers for cardiovascular diseases and acute myocardial infarctions. In this study, we describe a protocol for miRNA extraction, reverse transcription, and digital PCR for the absolute quantification of miRNAs in the serum of patients with cardiovascular disease.

급성 심근 경색 및 심혈 관 질환 MicroRNAs 순환 측정을 위한 디지털 PCR

Circulating serum microRNAs (miRNAs) have shown promise as biomarkers for the cardiovascular disease and acute myocardial infarction (AMI), being released ...

의학

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

높은 처리량 시퀀싱에 의한 마이크로 RNA 정량을위한 작은 RNA 분자의 고효율 내고

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

생물학

Probe-based Real-time PCR Approaches for Quantitative Measurement of microRNAs

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that provides an accurate and reproducible analysis. Probe-based chemistry offers the least background fluorescence as compared to other (dye-based) chemistries. Presently, there are several platforms available that use probe-based chemistry to quantitate transcript abundance. qPCR in a 96 well plate is the most routinely used method, however only a maximum of 96 samples or miRNAs can be tested in a single run. This is time-consuming and tedious if a large number of samples/miRNAs are to be analyzed. High-throughput probe-based platforms such as microfluidics (e.g. TaqMan Array Card) and nanofluidics arrays (e.g. OpenArray) offer ease to reproducibly and efficiently detect the abundance of multiple microRNAs in a large number of samples in a short time. Here, we demonstrate the experimental setup and protocol for miRNA quantitation from serum or plasma-EDTA samples, using probe-based chemistry and three different platforms (96 well plate, microfluidics and nanofluidics arrays) offering increasing levels of throughput.

Circulating microRNAs have recently emerged as promising and novel biomarkers for various cancers and other diseases. The goal of this article is to discuss three different probe-based real-time PCR platforms and methods that are available to quantify and determine the abundance of circulating microRNAs.

프로브 기반의 실시간 PCR은 마이크로 RNA의 정량 측정을위한 접근 방법

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that ...

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays.
We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method&#160;applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout.
Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

디지털 핵산 정량 분석​​ 실험의 단순 대량 판독

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are ...

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron transport chain. Unlike the diploid nuclear genome, most cells contain many more copies of mtDNA, ranging from less than 100 to over 200,000 copies depending on cell type. MtDNA copy number is increasingly used as a biomarker for a number of age-related degenerative conditions and diseases, and thus, accurate measurement of the mtDNA copy number is becoming a key tool in both research and diagnostic settings. Mutations in the mtDNA, often occurring as single nucleotide polymorphisms (SNPs) or deletions, can either exist in all copies of the mtDNA within the cell (termed homoplasmy) or as a mixture of mutated and WT mtDNA copies (termed heteroplasmy). Heteroplasmic mtDNA mutations are a major cause of clinical mitochondrial pathology, either in rare diseases or in a growing number of common late-onset diseases such as Parkinson's disease. Determining the level of heteroplasmy present in cells is a critical step in the diagnosis of rare mitochondrial diseases and in research aimed at understanding common late-onset disorders where mitochondria may play a role. MtDNA copy number and heteroplasmy have traditionally been measured by quantitative (q)PCR-based assays or deep sequencing. However, the recent introduction of ddPCR technology has provided an alternative method for measuring both parameters. It offers several advantages over existing methods, including the ability to measure absolute mtDNA copy number and sufficient sensitivity to make accurate measurements from single cells even at low copy numbers. Presented here is a detailed protocol describing the measurement of mtDNA copy number in single cells using ddPCR, referred to as droplet generation PCR henceforth, with the option for simultaneous measurement of heteroplasmy in cells with mtDNA deletions. The possibility of expanding this method to measure heteroplasmy in cells with mtDNA SNPs is also discussed.

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

디지털 액적 중합효소 연쇄반응을 이용한 단세포 미토콘드리아 DNA 복제 수 및 이형질 측정

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron ...

Absolute Quantification of Plasma MicroRNA Levels in Cynomolgus Monkeys, Using Quantitative Real-time Reverse Transcription PCR

RT-qPCR is one of the most common methods to assess individual target miRNAs. MiRNAs levels are generally measured relative to a reference sample. This approach is appropriate for examining physiological changes in target gene expression levels. However, absolute quantification using better statistical analysis is preferable for a comprehensive assessment of gene expression levels. Absolute quantification is still not in common use. This report describes a protocol for measuring the absolute levels of plasma miRNA, using RT-qPCR with or without pre-amplification.
A fixed volume (200 &#181;L) of EDTA-plasma was prepared from the blood collected from the femoral vein of conscious cynomolgus monkeys (n = 50). Total RNA was extracted using commercially available system. Plasma miRNAs were quantified by probe-based RT-qPCR assays which contains miRNA-specific forward/reverse PCR primer and probe. Standard curves for absolute quantification were generated using commercially available synthetic RNA oligonucleotides. A synthetic cel-miR-238 was used as an external control for normalization and quality assessment. The miRNAs that showed quantification cycle (Cq) values above 35 were pre-amplified prior to the qPCR step.
Among the 8 miRNAs examined, miR-122, miR-133a, and miR-192 were detectable without pre-amplification, whereas miR-1, miR-206, and miR-499a required pre-amplification because of their low expression levels. MiR-208a and miR-208b were not detectable even after pre-amplification. Sample processing efficiency was evaluated by the Cq values of the spiked cel-miR-238. In this assay method, technical variation was estimated to be less than 3-fold and the lower limit of quantification (LLOQ) was 102 copy/&#181;L, for most of the examined miRNAs.
This protocol provides a better estimate of the quantity of plasma miRNAs, and allows quality assessment of corresponding data from different studies. Considering the low number of miRNAs in body fluids, pre-amplification is useful to enhance detection of poorly expressed miRNAs.

This report describes a protocol for measuring the absolute levels of plasma miRNA, using quantitative real-time reverse transcription PCR with or without pre-amplification. This protocol affords better understanding of the quantity of plasma miRNAs and allows qualitative assessment of corresponding data from different studies or laboratories.

Cynomolgus 원숭이, 양적 실시간 반전 녹음 방송 PCR를 사용 하 여 플라즈마 예측에 관한 레벨의 절대 정량화

RT-qPCR is one of the most common methods to assess individual target miRNAs. MiRNAs levels are generally measured relative to a reference sample. This ...

Quantification of Circular RNAs Using Digital Droplet PCR

Digital droplet polymerase chain reaction (dd-PCR) is one of the most sensitive quantification methods; it fractionates the reaction into nearly 20,000 water-in-oil droplets, and the PCR occurs in the individual droplets. The dd-PCR has several advantages over conventional real-time qPCR, including increased accuracy in detecting low-abundance targets, omitting reference genes for quantification, eliminating technical replicates for samples, and showing high resilience to inhibitors in the samples. Recently, dd-PCR has become one of the most popular methods for accurately quantifying target DNA or RNA for gene expression analysis and diagnostics. Circular RNAs (circRNAs) are a large family of recently discovered covalently closed RNA molecules lacking 5' and 3' ends. They have been shown to regulate gene expression by acting as sponges for RNA-binding proteins and microRNAs. Furthermore, circRNAs are secreted into body fluids, and their resistance to exonucleases makes them serve as biomarkers for disease diagnosis. This article aims to show how to perform divergent primer design, RNA extraction, cDNA synthesis, and dd-PCR analysis to accurately quantify specific circular RNA (circRNA) levels in cells. In conclusion, we demonstrate the precise quantification of circRNAs using dd-PCR.

This protocol describes the detailed method of digital droplet PCR (dd-PCR) for precise quantification of circular RNA (circRNA) levels in cells using divergent primers.

디지털 액적 PCR을 사용한 원형 RNA의 정량화

Digital droplet polymerase chain reaction (dd-PCR) is one of the most sensitive quantification methods; it fractionates the reaction into nearly 20,000 ...

마이크로 RNA 정량는 DNA 결합 염료 화학, 물방울 디지털 PCR을 사용하여 순환

요약

더 많은 비디오 탐색

이 비디오의 챕터

높은 처리량 MicroRNA의 프로파일 : 최적 멀티 플렉스 플루 동적 ArrayTM의 IFCs에 Nanoliter의 규모 qRT - PCR

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

마이크로 로르 나를 사용한 네이티브 단백 입자의 농축과 그에 따른 절대/상대 미세 유 변 함량 및 셀룰러 전송 속도의 후속 측정

급성 심근 경색 및 심혈 관 질환 MicroRNAs 순환 측정을 위한 디지털 PCR

높은 처리량 시퀀싱에 의한 마이크로 RNA 정량을위한 작은 RNA 분자의 고효율 내고

프로브 기반의 실시간 PCR은 마이크로 RNA의 정량 측정을위한 접근 방법

디지털 핵산 정량 분석 실험의 단순 대량 판독

디지털 액적 중합효소 연쇄반응을 이용한 단세포 미토콘드리아 DNA 복제 수 및 이형질 측정

Cynomolgus 원숭이, 양적 실시간 반전 녹음 방송 PCR를 사용 하 여 플라즈마 예측에 관한 레벨의 절대 정량화

디지털 액적 PCR을 사용한 원형 RNA의 정량화

마이크로 RNA 정량는 DNA 결합 염료 화학, 물방울 디지털 PCR을 사용하여 순환

요약

더 많은 비디오 탐색

이 비디오의 챕터

높은 처리량 MicroRNA의 프로파일 : 최적 멀티 플렉스 플루 동적 ArrayTM의 IFCs에 Nanoliter의 규모 qRT - PCR

환자 생체 유체에서 종양 관련 순환 DNA의 검출 및 모니터링

마이크로 로르 나를 사용한 네이티브 단백 입자의 농축과 그에 따른 절대/상대 미세 유 변 함량 및 셀룰러 전송 속도의 후속 측정

급성 심근 경색 및 심혈 관 질환 MicroRNAs 순환 측정을 위한 디지털 PCR

높은 처리량 시퀀싱에 의한 마이크로 RNA 정량을위한 작은 RNA 분자의 고효율 내고

프로브 기반의 실시간 PCR은 마이크로 RNA의 정량 측정을위한 접근 방법

디지털 핵산 정량 분석​​ 실험의 단순 대량 판독

디지털 액적 중합효소 연쇄반응을 이용한 단세포 미토콘드리아 DNA 복제 수 및 이형질 측정

Cynomolgus 원숭이, 양적 실시간 반전 녹음 방송 PCR를 사용 하 여 플라즈마 예측에 관한 레벨의 절대 정량화

디지털 액적 PCR을 사용한 원형 RNA의 정량화

디지털 핵산 정량 분석 실험의 단순 대량 판독