Name: identification of kinesin-1 cargos using fluorescence microscopy
Uploaded: 2016-02-14T15:00:00.000+00:00
Duration: 8 min 6 s
Description: Watch this Scientific Journal Video about Identification of Kinesin-1 Cargos Using Fluorescence Microscopy at JoVE.com

Roche's Publication Grant covered the Free Access publication and production of this article. The author also thanks E. Premkumar Reddy, Richard V. Mettus, Stephen C. Cosenza, Sau Ying Yip and Sol D. Gloria for their support and critical reading of the manuscript.

tdTomato-태그 야생 형 및 모터리스 KIF5B 단백질 1. 복제 <ol><li> 표 1의 프라이머를 사용하여 인간 야생형 및 모터리스 KIF5B의 단백질의 cDNA를 증폭의 Taq DNA 중합 효소 (100 ㎕를 5 대)의 dNTP 혼합물 (각 옥시 뉴클레오티드 2 mM)을 30 사이클의 10X 버퍼. 각 사이클은 변성 단계 (30 초 동안 95 ° C), 어닐링 단계 (30 초 동안 45 ° C) 및 확장 단계 (3 분 동안 72 ° C)로 구성된다. </li><li> 페놀 / 클로로포름을 동량 증폭 된 DNA 생성물을 추출물 (1 : 1). 주 : 페놀은 가연성이며 화상을 입을 수 있습니다. 클로로포름은 위험합니다. 그들과의 직접적인 접촉을 피하고 화학 흄 후드를 사용합니다. 대안으로, PCR 생성물은 다양한 장비에 의해 정제 할 수있다. <ol><li> 1 분 동안 실온에서 마이크로 원심 18,000 XG 스핀. 새로운 튜브에 수용액을 옮기고 클로로포름 동일 부피로 추출한다. </li><li> 회전0.5 분 동안 실온에서 마이크로 원심 18,000 XG에. 새로운 튜브를 수용액을 전송합니다. </li><li> 3 M 나트륨 아세테이트의 10 볼륨과 무수 에탄올의 두 볼륨이있는 수용액을 섞는다. </li><li> 5 분 동안 실온에서 마이크로 원심 18,000 XG 스핀. 수용액을 폐기하십시오. </li><li> 75 % 에탄올의 두 볼륨 DNA 펠렛을 씻으십시오. 수용액을 버리고 공기를 실온에서 5 분간 DNA 펠렛을 건조. 34 μl의 물에서 DNA 펠렛을 재현 탁. </li></ol></li><li> 제한 40 μL의 최종 부피에서 증폭 된 제품을 소화하는 것은 SalI로 (10 대)과의 BamHI (10 대)와 두 시간 동안 37 ° C에서 자신의 10X 버퍼의 4 μl를 효소. 에티 디움 브로마이드 (0.2 μg의 / ㎖)을 함유하는 아가로 오스 겔에서 분해 제품 (100 V에서 1.0 %)을 해결. 주 : 에티 디움 브로마이드 강력한 돌연변이이며 피부를 통해 흡수 될 수있다. 따라서 w 직접 또는 간접 접촉을 방지하는 것이 중요i 번째 에티 디움 브로마이드. </li><li> 열에 의해 정화에 대한 올바른 밴드를 잘라. DNA 절편을 함유하는 아가로 오스 겔을 단다. 이어서 약 20 분 동안 37 ℃에서 용해 완충액 (0.1 g, 300 μL)에 용해. </li><li> 5 초 동안 실온에서의 microcentrifuge의 열 스핀에 생성 된 솔루션을 추가합니다. 흐름을 통해 폐기하십시오. </li><li> 단계 1.5를 반복하여 0.5 ㎖의 가용화 버퍼와 컬럼을 씻으십시오. 단계 1.5를 반복하여 0.75 ml의 세척 버퍼 다시 열을 씻으십시오. 2 분 나머지 세척 버퍼를 제거하기위한 열을 스핀. </li><li> 150 단계를 반복하여 50 ㎕의 물과 DNA 단편을 용리시킨다. 에티 디움 브로마이드 (0.2 μg의 / ㎖)을 함유하는 아가로 오스 겔 (100 V에서 1.0 %)의 DNA 사이즈 래더 대조의 분취 량을 실행하여 DNA 단편의 농도를 추정한다. </li><li> 이전 번째로 분해 ptdTomato-C1 벡터 (17) (100 NG)로 정제 된 제품 (약 100 NG)를 결찰즉 동일한 제한이 16 시간 동안 실온에서 T4 DNA 리가 제 (000 단위) 및 1 ㎕의 10X 결찰 완충액을 사용하여 10 ㎕의 효소. 참고 : 야생 형 및 모터리스 돌연변이가 각각 2에서 963에 963과 584에 아미노산이 포함되어 있습니다. 이전에, 더 큰 모터리스 KIF5B 변이체는 그 기능 (9)를 식별하는 데 사용 하였다. 작은 모터리스 KIF5B 돌연변이는 발현 수준을 증가시키기 위해, 본 연구에 사용 하였다. </li></ol> 2. 면역 형광 현미경 <ol><li> 살아있는 세포 또는 또는 40 배 이하의 배율 간접 형광 이미징, 1 ml의 완전 배지에서 0.2-0300000 HeLa 세포를 시드의 각 웰에 [둘 베코 변형 이글 중간 10 % 소 태아 혈청 (DMEM) (FBS)] 여섯 잘 플레이트. 5 % CO 2와 37 ° C에서 성장. </li><li> 40X 이상 배율 간접 면역 형광 연구, 커버 유리를 세척를 들어, 무수 에탄올 짧게과의 (18mm X 18mm 1.5 두께)에서 그들을 공기 건조바이오 안전성 캐비닛 내부 여섯 웰 플레이트의 우물은 오염을 방지 할 수 있습니다. <ol><li> 1 종 0.2-0300000 셀은 6 웰 플레이트의 각 웰에 DMEM 배지를 완료 ㎖로. </li></ol></li><li> 형질 단지의 제조 <ol><li> 다음날, 바이오 캐비닛 내부화물 후보 단백질 발현 플라스미드의 존재 또는 부재 tdTomato 태깅 야생형 또는 모터리스 KIF5B위한 발현 플라스미드 0.6 μg의 (총) 희석 (pTagCFP-C-MYC 5 ) 1.6 ml의 마이크로 원심 튜브에 0.1 ㎖의 트랜 스펙 션 배지. 참고 : 벡터 pTagCFP-C-MYC는 TagCFP - 태그 C-MYC을 표현한다. </li><li> 또 다른 1.6 ml의 microcentrifuge 관에 0.1 ml의 형질 매체에 형질 전환 시약 1.8 μl를 추가합니다. 일반적으로 12 샘플 충분히 희석 형질 전환 시약의 마스터 믹스를 준비합니다. </li><li> 실온에서 5 분 동안 인큐베이션. </li><li> 희석 된 0.1 ml의 DNA를로 희석하여 0.1 ml의 형질 전환 시약을 추가합니다. 미튜브 반전 내용 X. 마이크로 원심 5 초 동안 튜브를 스핀. </li><li> 실온에서 45 분 동안 인큐베이션. </li></ol></li><li> 세포의 세척 <ol><li> 형질 감염 복합체의 형성을위한 배양 기간 동안 세포를 시딩 인산염 완충 식염수 (PBS)로 3 번 씻는다. </li><li> 각 시드의 세포 배지를 교체 아니라 0.8 ml의 예열 형질 매체. 37 ° C에서 인큐베이터에 접시를 돌려줍니다. </li></ol></li><li> 세포의 형질 <ol><li> 45 분의 인큐베이션 후, 플레이트의 각 웰에 DNA / 형질 전환 시약 (단계 2.3에서 제조) 착체 0.2 mL를 적하 추가. </li><li> 그들은 37 ° C에서 인큐베이터에 반환되기 전에 5 초 동안 부드럽게 6 잘 판 바위. </li><li> 6-8 시간 후, 전체 DMEM 배지로 배지를 교체한다. </li></ol></li><li> 라이브 셀 형광 이미징 (18) <ol><li> 배양의 부가 16 시간 후t는 37 ° C, 1 μM의 최종 농도로 배지에 DNA에 인터 훽스트 33342 염색을 추가한다. 참고 훽스트 33342이 세포 핵 얼룩 세포 투과성 DNA의 삽입 성 염료이다. </li><li> 40X 대물 렌즈를 이용하여 형광 현미경으로 형광 단백질의 발현을 조사하기 전에 37 ° C의 배양기에서 10 분 동안 형질 감염된 세포를 인큐베이션. DAPI, CFP, FITC와 Cy3에 대한 필터 설정은 각각 (Ex350에 ㎚ / Em460에 ㎚) (Ex436에 ㎚ / Em480에 ㎚) (Ex470에 ㎚ / Em525 수 (NM)) 및 (Ex545에 ㎚ / Em605에 ㎚)이다. 주 : 배경 인해 완전 DMEM 배지 자동 형광으로 높으면 페놀 레드없는 배지가 사용된다. </li></ol></li></ol> 간접 면역 형광 연구 3. <ol><li> 파라 포름 알데히드 용액의 조제 <ol><li> 파라 포름 알데히드 분말 (100 ml의 PBS 당 4 g)을 달아 PBS에 추가합니다. 참고 : 파라 포름 알데히드는 가연성 고체 및 잠재적 인 암 해저드입니다디. 그것은 눈, 호흡계 및 피부를 자극. 따라서, 파라 포름 알데히드와의 접촉 또는 흡입을 방지하는 것이 중요하다. </li><li> 용액 (150 ㎕를 10 N의 NaOH / 100 ㎖)에 NaOH를 추가합니다. </li><li> 가끔 흔들어 2-3 시간 동안 42 ° C에 37에서 솔루션을 유지합니다. </li><li> 용해 후, 파라 포름 알데히드 분말 용액 (75 μL / 100 ㎖)에 빙초산을 첨가하여 pH를 7.0으로 조정합니다. </li></ol></li><li> 대상 단백질 염색 <ol><li> 37 ° C에서 16 시간 동안 더 배양 한 후, 5 초 동안 6 웰 플레이트 소용돌이하여 PBS로 한번 실온에서 형질 감염된 세포를 씻는다. </li><li> 웰당 갓 제조 한 4 % 파라 포름 알데히드 용액을 1 ㎖로 세포를 고정한다. 실온에서 30 분 동안 인큐베이션. </li><li> 한 번에 5 초 6 웰 플레이트에 대해 소용돌이에 의해 PBS로 세포를 씻으십시오. 솔루션을 폐기하십시오. </li><li> 30 분 동안 실온에서 0.1 % (PBS)에서 트리톤 X-100 1 ㎖로 세포를 인큐베이션. DET이들 세포 표적에 대한 항체의 접근을 허용하는 세포막 Permeabilize 하시려면 것이다 트리톤 X-100 ergent. </li><li> 5 초 때마다 6 웰 플레이트 소용돌이하여 PBS로 4 회 세포를 씻으십시오. 각 세척 후 솔루션을 폐기하십시오. </li><li> 4 시간 동안 흔들어 실온에서 PBS 용액에 10 %의 FBS (0.1 μg의 / ㎖ C-MYC 토끼 항체 또는 p53의 마우스 항체) 일차 항체 1 ㎖로 세포를 인큐베이션. </li><li> 5 초 때마다 6 웰 플레이트 소용돌이하여 PBS로 4 회를 씻으십시오. 각 세척 후 솔루션을 폐기하십시오. </li><li> 2 시간 동안 흔들어 어둠 속에서 실온에서 PBS에 10 % FBS에서, (0.5 μg의 / ㎖ 알렉사 형석 488 - 공액 안티 - 토끼 또는 항 - 마우스 IgG 항체) 형광 염료 접합 이차 항체에 1 ㎖의 인큐베이션. </li><li> 5 초 때마다 6 웰 플레이트 소용돌이하여 PBS로 4 회를 씻으십시오. 각 세척 후 솔루션을 폐기하십시오. </li></ol></li><li> 핵 염색 및 장착 <ol><l10 분간 어둠 속에서 실온에서의 PBS (0.5 μg의 / ㎖ DAPI) 내가&gt; DNA에 인터 염료 4 &#39;, 6-diamidino -2- 페닐 인돌의 1ml를 가진 세포를 인큐베이션. 더 커버 유리가 사용되지 않은 경우 3.4 단계로 진행합니다. 주의 : DAPI는 세포핵 얼룩 DNA에 인터 염료이다. </li><li> 각 현미경 슬라이드에 장착 용액 10 μl를 적용합니다. 현미경 슬라이드에 장착 솔루션을 통해 각각의 커버 유리를 탑재합니다. </li><li> 어두운 밤새 실온에서 인큐베이션. </li><li> 매니큐어와 커버 유리의 가장자리를 밀봉합니다. 밤새 매니큐어 가스를 제거하기 위해 연기 후드 내부의 어둠 속에서 놓습니다. </li></ol></li><li> 형광 현미경 (19) <ol><li> 다음 날, 40X 목표를 사용하여 형광 현미경으로 세포를 검사합니다. DAPI, CFP, FITC와 Cy3에 대한 필터 설정은 각각 (Ex350에 ㎚ / Em460에 ㎚) (Ex436에 ㎚ / Em480에 ㎚) (Ex470에 ㎚ / Em525 수 (NM)) 및 (Ex545에 ㎚ / Em605에 ㎚)이다. </li></ol></li></ol>

<ol>
	<li>Hirokawa, N., Niwa, S., Tanaka, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+motors+in+neurons:+transport+mechanisms+and+roles+in+brain+function,+development,+and+disease.">Molecular motors in neurons: transport mechanisms and roles in brain function, development, and disease.</a> Neuron. 68, 610-638 (2010).</li><li>Yu, Y., Feng, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+kinesin+family+proteins+in+tumorigenesis+and+progression:+potential+biomarkers+and+molecular+targets+for+cancer+therapy.">The role of kinesin family proteins in tumorigenesis and progression: potential biomarkers and molecular targets for cancer therapy.</a> Cancer. 116, 5150-5160 (2010).</li><li>Verhey, K. J., Hammond, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Traffic+control:+regulation+of+kinesin+motors.">Traffic control: regulation of kinesin motors.</a> Nat Rev Mol Cell Biol. 10, 765-777 (2009).</li><li>Hirokawa, N., Noda, Y., Tanaka, Y., Niwa, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinesin+superfamily+motor+proteins+and+intracellular+transport.">Kinesin superfamily motor proteins and intracellular transport.</a> Nat Rev Mol Cell Biol. 10, 682-696 (2009).</li><li>Lee, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transport+of+c-MYC+by+Kinesin-1+for+proteasomal+degradation+in+the+cytoplasm.">Transport of c-MYC by Kinesin-1 for proteasomal degradation in the cytoplasm.</a> Biochim Biophys Acta. 1843, 2027-2036 (2014).</li><li>Bittins, C. M., Eichler, T. W., Hammer, J. A., Gerdes, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant-negative+myosin+Va+impairs+retrograde+but+not+anterograde+axonal+transport+of+large+dense+core+vesicles.">Dominant-negative myosin Va impairs retrograde but not anterograde axonal transport of large dense core vesicles.</a> Cell Mol Neurobiol. 30, 369-379 (2010).</li><li>Kimura, T., Watanabe, H., Iwamatsu, A., Kaibuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tubulin+and+CRMP-2+complex+is+transported+via+Kinesin-1.">Tubulin and CRMP-2 complex is transported via Kinesin-1.</a> J Neurochem. 93, 1371-1382 (2005).</li><li>Lindsay, A. J., McCaffrey, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myosin+Va+is+required+for+the+transport+of+fragile+X+mental+retardation+protein+(FMRP)+granules.">Myosin Va is required for the transport of fragile X mental retardation protein (FMRP) granules.</a> Biol Cell. 106, 57-71 (2014).</li><li>Rivera, J., Chu, P. J., Lewis, T. L., Arnold, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+Kif5B+in+axonal+localization+of+Kv1+K(+)+channels.">The role of Kif5B in axonal localization of Kv1 K(+) channels.</a> Eur J Neurosci. 25, 136-146 (2007).</li><li>Roland, J. T., Kenworthy, A. K., Peranen, J., Caplan, S., Goldenring, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myosin+Vb+interacts+with+Rab8a+on+a+tubular+network+containing+EHD1+and+EHD3.">Myosin Vb interacts with Rab8a on a tubular network containing EHD1 and EHD3.</a> Mol Biol Cell. 18, 2828-2837 (2007).</li><li>Uchida, A., Alami, N. H., Brown, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tight+functional+coupling+of+kinesin-1A+and+dynein+motors+in+the+bidirectional+transport+of+neurofilaments.">Tight functional coupling of kinesin-1A and dynein motors in the bidirectional transport of neurofilaments.</a> Mol Biol Cell. 20, 4997-5006 (2009).</li><li>Zadeh, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kif5b+is+an+essential+forward+trafficking+motor+for+the+Kv1.5+cardiac+potassium+channel.">Kif5b is an essential forward trafficking motor for the Kv1.5 cardiac potassium channel.</a> J Physiol. 587, 4565-4574 (2009).</li><li>Su, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KIF5B+promotes+the+forward+transport+and+axonal+function+of+the+voltage-gated+sodium+channel+Nav1.8.">KIF5B promotes the forward transport and axonal function of the voltage-gated sodium channel Nav1.8.</a> J Neurosci. 33, 17884-17896 (2013).</li><li>Lalioti, V. S., Vergarajauregui, S., Tsuchiya, Y., Hernandez-Tiedra, S., Sandoval, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daxx+functions+as+a+scaffold+of+a+protein+assembly+constituted+by+GLUT4,+JNK1+and+KIF5B.">Daxx functions as a scaffold of a protein assembly constituted by GLUT4, JNK1 and KIF5B.</a> . J Cell Physiol. 218, 416-426 (2009).</li><li>Cho, K. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+the+kinesin-binding+domain+of+RanBP2+to+KIF5B+and+KIF5C+determines+mitochondria+localization+and+function.">Association of the kinesin-binding domain of RanBP2 to KIF5B and KIF5C determines mitochondria localization and function.</a> Traffic. 8, 1722-1735 (2007).</li><li>Diefenbach, R. J., Diefenbach, E., Douglas, M. W., Cunningham, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ribosome+receptor,+p180,+interacts+with+kinesin+heavy+chain,+KIF5B.">The ribosome receptor, p180, interacts with kinesin heavy chain, KIF5B.</a> Biochem Biophys Res Commun. 319, 987-992 (2004).</li><li>Shaner, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+monomeric+red,+orange+and+yellow+fluorescent+proteins+derived+from+Discosoma+sp.+red+fluorescent+protein.">Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein.</a> Nat Biotechnol. 22, 1567-1572 (2004).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live-cell+fluorescence+imaging.">Live-cell fluorescence imaging.</a> Methods Cell Biol. 114, 125-150 (2013).</li><li>Sanderson, M. J., Smith, I., Parker, I., Bootman, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+microscopy.">Fluorescence microscopy.</a> Cold Spring Harb Protoc. 2014, (2014).</li><li>Hopkins, S. C., Vale, R. D., Kuntz, I. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibitors+of+kinesin+activity+from+structure-based+computer+screening.">Inhibitors of kinesin activity from structure-based computer screening.</a> Biochemistry. 39, 2805-2814 (2000).</li><li>Zhang, Y., Xiong, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+p53+ubiquitination+and+nuclear+export+by+MDM2+and+ARF.">Control of p53 ubiquitination and nuclear export by MDM2 and ARF.</a> Cell Growth Differ. 12, 175-186 (2001).</li><li>Michael, D., Oren, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+p53-Mdm2+module+and+the+ubiquitin+system.">The p53-Mdm2 module and the ubiquitin system.</a> Semin Cancer Biol. 13, 49-58 (2003).</li><li>Kneussel, M., Wagner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myosin+motors+at+neuronal+synapses:+drivers+of+membrane+transport+and+actin+dynamics.">Myosin motors at neuronal synapses: drivers of membrane transport and actin dynamics.</a> Nat Rev Neurosci. 14, 233-247 (2013).</li><li>Maravillas-Montero, J. L., Santos-Argumedo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+myosin+family:+unconventional+roles+of+actin-dependent+molecular+motors+in+immune+cells.">The myosin family: unconventional roles of actin-dependent molecular motors in immune cells.</a> J Leukoc Biol. 91, 35-46 (2012).</li></ol>

이 문서의 무료 액세스 출판 및 생산 로슈에 의해 지급됩니다.

기재된 방법은 미세 소관을 따라 이동할 수있는 능력이 결여 모터리스 KIF5B 변이체의 특성을 이용하지만 동일한화물 단백질과 상호 작용하는 테트라 머 단백질을 야생형 KIF5B와 다이머를 형성하고, 이에 따라, 허용 할 수있는 능력을 보유 야생형 KIF5B있다. 모터리스 KIF5B 따라서, 그화물로 집계 mislocalized 지배적 인 부정적인 돌연변이 및 양식 역할을합니다. 이 방법은 (그림 1) 5에게 키네신-1화물 C-MYC를 식별하기 위해 입증된다. 이 기사에서는 동일한 모터리스 KIF5B 돌연변이는 키네신-1의 또 다른 잠재적 인화물 (그림 2)로 p53의를 식별하는 데 사용되었다. 이 방법론은 키네신 -1- 다른화물을 식별 가능한 것을 나타낸다. 또한, 돌연변이의 특성은 대조군 단백질에 Fos-C (도 3)에 대한 돌연변이의 효과의 부족에 의해 제공된다. 이 프로토콜에서는 야생 타이를 tdTomato-태그퍼가기 또는 모터리스 KIF5B 단백질은 다른 형광 단백질 태그 후보화물 단백질과 동시 발현된다. 이 경우에, 살아있는 세포의 형광 현미경 및 이미징이 수행된다. 응집체의 형성은 저속 촬상으로 추적 될 수있다. 이와 달리, 태깅 tdTomato 단백질 단독 발현 및 생리적 수준에서 후보화물 단백질 특이 적 항체를 이용하여 간접 면역 형광 현미경 검사에 의해 가시화된다. 형광 단백질 tdTomato는 밝기와 광 안정성 (17)에 대해 선택된다. 배경 완전한 DMEM 배지 자동 형광에 의한 높으면 페놀 레드없는 배지가 사용된다. 모터리스 KIF5B 돌연변이 화학량 야생형 KIF5B와 이합체를 형성한다. 따라서, 그 기능을 억제하고, 응집체를 형성하도록 야생형 카운터 파트와 이합체를 형성하도록 모터리스 KIF5B 변이체의 충분한 양을 표현하는 것이 중요하다. , EXPR의 최적화를이 문제를 해결하려면모터리스 돌연변이의 ession이 필수적이다. 이는 이량 체화 도메인을 포함하는 소형 모터리스 돌연변이를 사용하여 달성된다. 또한, 적절한 형질 전환 시약 및 프로토콜의 최적화도 필요하다. DNA / 형질 전환 시약과 HeLa 세포의 배양 기간은 외래 단백질 및 세포 생존의 발현 HeLa 세포에서 최적화되었다. 배양 시간은 기타 세포주에 대해 최적화 될 필요가있다. 40X에 4 배 사이의 배율의 경우, 커버 안경이 필요하지 않습니다. 세포를 직접 웰에서 검사 될 수있다. 따라서,이 경우, 프로토콜은 저렴하고 편리하다. 40X 이상 배율의 경우, 세포를 염색 한 후, 오일 침지 목표 아래 검사에 대한 현미경 슬라이드에 장착되어, 우물에 커버 유리에 성장하고있다. 모터리스 KIF5B 단백질 응집체의 관찰 세포질의 크기에 의해 제한된다. 을 감지하기 쉽습니다많은 포유 동물 세포의 집합체. 그러나, 세포질 부피의 핵 주위의 신경 돌기 작은 경우 신경 세포의 응집체를 관찰 비교적 어렵다. 프로토콜은 생체 효모 두 하이브리드 생화학 풀다운 분석 13-16 이외에 KIF5B화물과의 연관성을 표시하기 위해 사용된다. 이러한 모든 분석은 서로 다른 물리적 조건 관계를 결정하고 그 결과를 서로 보완 할 수있다. 또 다른 분석을 통해이 형광 분석의 장점은 KIF5B 의해화물의 세포 내 편재 규제를 표시 할 수 있다는 점이다 (도 1 및도 2). 프로토콜 KIF5B에 한정되지 않고, 다른 키네신 모터 (3) 및 (3)의 세포 내화물 운송에 사용 미오신 모터 (23, 24)의 일부로서 다른 모터 단백질의화물을 식별하는데 사용될 수있다. 이 모터 단백질은 또한 올리고머에 대한 키네신 모터와 마이 오신 모터 용 미세 섬유 및 코일 코일 세그먼트에 대한 미세 소관을 따라 이동을 위해 모터 도메인이 포함되어 있습니다. 그들 대부분은 동종이 량체 3,23를 형성한다. 따라서, 유사한 전략은화물을 식별하기 위해 자신의 모터리스 우성 네거티브 돌연변이를 생성하여 이들에인가 될 수있다.

키네신-1은 선행 성 1,2화물 수송을 매개 모터 단백질이다. 그것은 키네신 빛 체인 1 (KLC1) 및 키네신 무거운 체인의 두 서브 유닛 (KHCs)의 두 개의 서브 유닛의 heterotetramer이다. KIF5B 1, KHC는 자사의 N 말단, ATP를 가수 분해 및 미세 소관을 따라 이동을 위해 기계적 에너지를 화학 에너지로 변환에서 모터 도메인이 포함되어 있습니다. 그것의 C- 말단 지역은화물과 연관 KLC1와 상호 작용 이합체 도메인이 포함되어 있습니다. 키네신-1은 소포, 세포 기관과의 mRNA 3,4 등의화물을 수송한다. 최근 KIF5B는 세포질 5 proteosomal 저하에 대한 핵 전사 인자 C-MYC 수송을 보였다. 세 가지 방법 (화학적 억제제의 siRNA / shRNA를 지배적 네거티브 체)은 키네신 - 1 기능을 억제하기 위해 사용 하였다. 그들 모두는 세포질에서 C-MYC의 응집을 유도. 마지막 방법의 경우, C-MYC은 지배적 인 negat에 의해 영향을 받았다돌연변이는 일반적으로 (미세 소관 중단 등) 세포 내 구성 요소에 대한 영향이나 단백질 응집에를주지 않는 것을 건의, 다른 관련 KIF5A 모터 단백질의에 의해 KIF5B의 돌연변이를 필자는 아니지만. KIF5B 지배적 네거티브 체는 또한 전사 인자에 대한 일반적인 영향을주지 않는다는 것을 시사 다른 전사 인자에 영향을 미치지 않았다. 오히려 우성 네거티브 체는화물에 대한 특정 효과를 발휘하는 것을 시사한다. 우성 네거티브 변이체의 사용은 모터 단백질의 분야에서 일반적이다. 키네신과 myosins의 유사 모터리스 돌연변이는 이전에 사용되었다. 이들은 주로 자신의화물의 세포 내 지역화 또는 세포 기능에 6-12 돌연변이의 효과를 입증하기 위해 사용되었다. 덜 강조 돌연변이와 그들에 의해 영향을받는화물 사이의 공간 관계에 넣었다. 그러나, 어떤 빈도로, 돌연변이는 CA와 공동 지역화 관찰rgos 6,10. KIF5B 및 관련 단백질 간의 상호 작용은 이전에 생체 효모 두 하이브리드 분석법 및 면역 침전과 같은 공동 체외 풀다운 분석 생화학 13-16에서 풀다운 검정에 의해 확인 하였다. 이 기사에서는 추가로 시각적 방법을 사용하여 형광 현미경은 KIF5B화물 단백질을 식별하기 위해 설명되어 있습니다. 방법 우성 네거티브 체로서 작용하는 모터리스 KIF5B 변이체를 사용한다. 그것은 세포질에 집계 및화물의 응집을 유도한다. 17 tdTomato 형광 단백질 야생 형 및 모터리스 KIF5B 돌연변이의 태그는 형광 현미경으로 자신의 시각화를 가능하게한다. 태그 KIF5B 단백질 적절 KIF5B 태그로부터 분리 된 스펙트럼 특성을 갖는 다른 형광 단백질을 융합 단백질 후보와 공동 발현 될 수있다. 태그 단백질 생균 직접 관찰형광 현미경 하에서. 모터리스 KIF5B 돌연변이에 의해 후보 단백질 응집 유도 후보 단백질 KIF5B의 생체화물인지 확인한다. 또한 tdTomato 태깅 KIF5B 단백질은 내인성화물 단백질에 미치는 영향을 연구하는 세포만을 표현할 수있다. 나중에, 면역 형광 현미경이 형광 염료와 접합 적절한 이차 항체이어서 형질 감염된 세포를 고정 후보 내인성 단백질에 대한 특이 항체로 염색 된 행한다. 이 경우, 생리 학적 수준에서 내인성 후보 단백질 연구된다. 다른 모터 단백질 유사 모터리스 돌연변이들은화물을 식별하기 위해 제조 될 수있다.

<table><tbody><tr><td>absolute ethanol (200 proof)</td><td>Fisher Scientific</td><td>BP2818</td><td></td></tr><tr><td>DAPI</td><td>Sigma-Aldrich</td><td>D9542</td><td></td></tr><tr><td>Hoechst 33342</td><td>Sigma-Aldrich</td><td>B2261</td><td></td></tr><tr><td>Opti-MEM-I (transfection medium)</td><td>Life Technologies</td><td>51985</td><td></td></tr><tr><td>ProLong Diamond Antifade Mountant</td><td>Life Technologies</td><td>P36961</td><td></td></tr><tr><td>formaldehyde, para</td><td>Fisher Scientific</td><td>O4042-500</td><td></td></tr><tr><td>Triton-X100</td><td>Fisher Scientific</td><td>BP151-500</td><td></td></tr><tr><td>X-tremeGENE 9 DNA Transfection Reagent</td><td>Roche</td><td>6365787001</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>Life Technologies</td><td>10342020</td><td></td></tr><tr><td>PCR Grade Nucleotide Mix (dNTP Mix)</td><td>Roche</td><td>12111424</td><td></td></tr><tr><td>Microscope cover glass</td><td>Fisher Scientific</td><td>12-541A</td><td></td></tr><tr><td>GeneRuler 1 kb Plus DNA ladder</td><td>Life Technologies</td><td>SM1333</td><td></td></tr><tr><td>PureLink Quick Gel Extraction kit</td><td>Life Technologies</td><td>K210012</td><td></td></tr><tr><td>BamHI</td><td>New England Biolab</td><td>R0136</td><td></td></tr><tr><td>SalI</td><td>New England Biolab</td><td>R0138</td><td></td></tr><tr><td>T4 DNA ligase&amp;nbsp;</td><td>New England Biolab</td><td>M0202T</td><td></td></tr><tr><td>Ethidium bromide</td><td>Thermo Scientific</td><td>17898</td><td></td></tr><tr><td>DMEM</td><td>Life Technologies</td><td>11995-065</td><td></td></tr><tr><td>c-MYC rabbit antibody</td><td>Cell Signaling</td><td>5606</td><td></td></tr><tr><td>p53 mouse antibody</td><td>Santa Cruz</td><td>sc-126</td><td></td></tr><tr><td>Alexa Fluor 488-conjugated anti-rabbit IgG antibody</td><td>Life Technologies</td><td>A11008</td><td></td></tr><tr><td>Alexa Fluor 488-conjugated anti-mouse IgG antibody</td><td>Life Technologies</td><td>A11059</td><td></td></tr><tr><td>fluorescent microscope&amp;nbsp;</td><td>Olympus IX71_Fluoview</td><td></td><td></td></tr><tr><td>computer software for imaging</td><td>&amp;nbsp;cellSens&amp;nbsp;</td><td></td><td></td></tr></tbody></table>

identification of kinesin-1 cargos using fluorescence microscopy

Fluorescence microscopy is employed to identify Kinesin-1 cargos. Recently, the heavy chain of Kinesin-1 (KIF5B) was shown to transport the nuclear transcription factor c-MYC for proteosomal degradation in the cytoplasm. The method described here involves the study of a motorless KIF5B mutant for fluorescence microscopy. The wild-type and motorless KIF5B proteins are tagged with the fluorescent protein tdTomato. The wild-type tdTomato-KIF5B appears homogenously in the cytoplasm, while the motorless tdTomato-KIF5B mutant forms aggregates in the cytoplasm. Aggregation of the motorless KIF5B mutant induces aggregation of its cargo c-MYC in the cytoplasm. Hence, this method provides a visual means to identify the cargos of Kinesin-1. A similar strategy can be utilized to identify cargos of other motor proteins.

외인성는 C-MYC는 핵 (도 1A)를 중심으로 나타난 반면 야생형 KIF5B은 세포질에서 발현 균일 나타났다. 그러나, 모터리스 KIF5B 돌연변이 세포질 (도 1a)의 응집체를 형성했다. 모터리스 KIF5B의 집계는 C-MYC의 응집을 유도. 세포의 비율이 낮았다 야생형 KIF5B 발현 세포 TagCFP 태그가 C-MYC 집계를 발현. 그러나, 모터리스 KIF5B는 (도 1a)을 공동 발현 될 때 상당히 높았다. C-MYC와 돌연변이 KIF5B의 관찰 공동 현지화 (그림 1) KIF5B는 C-MYC의 세포 내 현지화를 조절하고 C-MYC는 키네신-1의화물 있음을 시사한다. 구조가 단독으로 표현 된에 음성 대조군은 그림 1A의 하부 패널에 포함되어 있습니다. 결과는 형광 emissio의 유의 블리드 - 스루가 없다고 표시엔. 모터리스 KIF5B 또한 내인성 C-MYC (도 1b) 및 전사 인자 p53의 (도 2)의 응집을 유도 나타내는 C-MYC 및 p53이 모두 키네신-1화물이며 KIF5B 두 내인성 단백질의 세포 내 위치 파악을 조절한다. 함께 키네신-1 억제제는 C-MYC 및 p53이 모두 5 벵골 락톤 (RBL) 고 분자량 종 (20)이 유도 형성 상승한 결과, p53의 가능성 키네신-1화물이다. C-MYC 같은 핵 전사 인자 p53의는, 또한 프로 테아 좀 저하 (21, 22)의 세포질에 핵에서 내 보낸 것을주의하는 것이 재미있다. 모터리스 KIF5B 변이체의 발현이 세포 내 지역화 C-에 Fos 영향을하거나 응집 (도 3)이 발생하지 않았기 때문에 KIF5B하여 전사 인자의 이동이 상세하게 보인다. 전술 한 데이터는 운전 방식이 있음을 입증이 책에서 사용 d를 키네신-1화물의 높은 특이성 식별 할 수 있습니다. 유사한 전략은 다른 모터 단백질에 적용될 수있다. <img alt="그림 1" src="/files/ftp_upload/53632/53632fig1.jpg" /> 그림 1 : 모터리스 KIF5B 돌연변이 체의 발현은 세포질에서 C-MYC 응집을 유도 (A) 헬라 세포는 tdTomato-태그 야생형 (WT) KIF5B (적색)과 TagCFP - 태그 C-MYC (파란색)으로 형질 감염시켰다.. MYC는 C-핵에 주로 등장 TagCFP-태그 동안 tdTomato-태그 WT KIF5B는 세포질에 주로 나타났다. 그러나, tdTomato-태그 모터리스 KIF5B 돌연변이 (빨간색)은 세포질에서 사상 또는 반점 집계를 형성했다. 모터리스 KIF5B의 발현은 C-MYC의 응집을 유도. 돌연변이 KIF5B 및 C-MYC의 함께 (핑크) 공동는 지역화. CFP-C-MYC (%)의 집계를 나타내는 세포 (%)의 비율이 표시됩니다. 결과로서 도시SD (N = 3) ± 의미한다. tdTomato-태그 KIF5B 단백질 또는 빈 벡터 (V)와 함께 TagCFP - 태그 C-MYC의 발현과 음성 대조군은 하단 패널에 표시됩니다. (B) 유사한 결과 tdTomato 태깅 WT 또는 모터리스 KIF5B 단백질 (적색)을 나타냈다 내인성 C-MYC (녹색)로 수득 하였다. tdTomato-태그 모터리스 KIF5B 돌연변이는 세포질에 집계를 형성하고, 내생 C-MYC의 응집을 유도. 집계의 두 종류의 세포질 (오렌지)에서 함께 지역화 공동. 핵은 염료의 Hoechst 33342 또는 DAPI로 염색 하였다. 스케일 바; 20 μm의. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53632/53632fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53632/53632fig2.jpg" /> 그림 2 : 모터리스 KIF5B 돌연변이 체의 발현은 t에서 내인성 p53의 응집을 유도내인성 p53의 (녹색)이 핵을 중심으로 등장하면서 그 HeLa 세포이다. 세포질 외인성 tdTomato 태깅 된 야생형 (WT) KIF5B (적색), 세포질 주로 나타났다. 반면, 태그가 tdTomato 모터리스 KIF5B 돌연변이 (적색) 세포질 응집체 형성. 모터리스 KIF5B의 발현은 세포질 (노란색)의 KIF5B의 공동 현지화 및 p53의 결과, p53의의 응집을 유도. 실험을 3 회 실시 하였다. 핵은 DAPI 염색으로 염색 하였다. 스케일 바; 20 μm의. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53632/53632fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53632/53632fig3.jpg" /> 그림 3 :. 모터리스 KIF5B 돌연변이 체의 발현은 세포질에서 C-FOS를 응집을 유도하지 않습니다 야생형을 tdTomato가-태그 (WT) KIF5B (적색) 등장주로 EGFP-C-에 Fos (녹색)이 핵을 중심으로 등장 동안 HeLa 세포의 세포질에서. 반대로 tdTomato 태깅 KIF5B 모터리스 돌연변이 (적색) 세포질 응집체 형성. 모터리스 KIF5B의 발현은 C-FOS를 응집을 유도하지 않았다. 실험 4 번 수행 하였다. 세포의 핵은 DAPI 염색으로 염색 하였다. 스케일 바; 20 μm의. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53632/53632fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table fo:keep-together.within-page="1"><tbody><tr><td> 공통의 역방향 프라이머 </td><td> 5&#39;-AGAGGATCCTTACACTTGTTTGCCTCCTC-3 &#39; </td></tr><tr><td> 야생형 KIF5B 정방향 프라이머 </td><td> AGAGTCGACGCGGACCTGGCCGAGTGCAACATCAAAGT 5&#39;-3 &#39; </td></tr><tr><td> 모터리스 KIF5B 정방향 프라이머 </td><td> AGAGTCGACGATGAAGAGTTCACTGTTGC 5&#39;-3 &#39; </td></tr></tbody></table>표 1 : 야생 형 및 모터리스 KIF5B 단백질을 복제하기위한 프라이머 시퀀스.

Watch this Scientific Journal Video about Identification of Kinesin-1 Cargos Using Fluorescence Microscopy at JoVE.com

Identification of Kinesin-1 Cargos Using Fluorescence Microscopy

여기에서, 프로토콜은 키네신 -1-화물을 식별하기 위해 제시된다. 키네신-1 중쇄 (KIF5B)의 모터리스 돌연변이는 세포질에 집계 및화물의 응집을 유도한다. 모두 집계는 형광 현미경에서 검출된다. 유사한 전략이 다른 모터 단백질화물을 식별하기 위해 사용될 수있다.

형광 현미경을 사용 키네신 -1-화물 식별

Fluorescence microscopy is employed to identify Kinesin-1 cargos. Recently, the heavy chain of Kinesin-1 (KIF5B) was shown to transport the nuclear ...

identification-of-kinesin-1-cargos-using-fluorescence-microscopy

Universidad San Sebastian

Research

JoVE Journal

Biology

7.8K 조회수.  Icahn School of Medicine at Mount Sinai.  여기에서, 프로토콜은 키네신 -1-화물을 식별하기 위해 제시된다. 키네신-1 중쇄 (KIF5B)의 모터리스 돌연변이는 세포질에 집계 및화물의 응집을 유도한다. 모두 집계는 형광 현미경에서 검출된다. 유사한 전략이 다른 모터 단백질화물을 식별하기 위해 사용될 수있다. 

비디오: Identification of Kinesin-1 Cargos Using Fluorescence Microscopy

Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins

The kinesin superfamily of microtubule associated motor proteins share a characteristic motor domain which both hydrolyses ATP and binds microtubules. Kinesins display differences across the superfamily both in ATP turnover and in microtubule interaction. These differences tailor specific kinesins to various functions such as cargo transport, microtubule sliding, microtubule depolymerization and microtubule stabilization. To understand the mechanism of action of a kinesin it is important to understand how the chemical cycle of ATP turnover is coupled to the mechanical cycle of microtubule interaction. To dissect the ATP turnover cycle, one approach is to utilize fluorescently labeled nucleotides to visualize individual steps in the cycle. Determining the kinetics of each nucleotide transition in the ATP turnover cycle allows the rate-limiting step or steps for the complete cycle to be identified. For a kinesin, it is important to know the rate-limiting step, in the absence of microtubules, as this step is generally accelerated several thousand fold when the kinesin interacts with microtubules. The cycle in the absence of microtubules is then compared to that in the presence of microtubules to fully understand a kinesin&#8217;s ATP turnover cycle. The kinetics of individual nucleotide transitions are generally too fast to observe by manually mixing reactants, particularly in the presence of microtubules. A rapid mixing device, such as a stopped-flow fluorimeter, which allows kinetics to be observed on timescales of as little as a few milliseconds, can be used to monitor such transitions. Here, we describe protocols in which rapid mixing of reagents by stopped-flow is used in conjunction with fluorescently labeled nucleotides to dissect the ATP turnover cycle of a kinesin.

Kinesins are characterized by nucleotide-dependent interaction with microtubules: a cycle of ATP turnover coupled to a cycle of microtubule interaction. Here, we describe protocols to analyze the kinetics of individual nucleotide transitions in the ATP turnover cycle of a kinesin using fluorescently labeled nucleotides and stopped-flow fluorescence.

형광 흐름 중지 및 레이블 뉴클레오티드의 사용은 키네신의 ATP 턴 오버주기를 분석하는

The kinesin superfamily of microtubule associated motor proteins share a characteristic motor domain which both hydrolyses ATP and binds microtubules. ...

연구

화학

Immobilization of Caenorhabditis elegans to Analyze Intracellular Transport in Neurons

Axonal transport and intraflagellar transport (IFT) are essential for axon and cilia morphogenesis and function. Kinesin superfamily proteins and dynein are molecular motors that regulate anterograde and retrograde transport, respectively. These motors use microtubule networks as rails. Caenorhabditis elegans (C. elegans) is a powerful model organism to study axonal transport and IFT in vivo. Here, I describe a protocol to observe axonal transport and IFT in living C. elegans. Transported cargo can be visualized by tagging cargo proteins using fluorescent proteins such as green fluorescent protein (GFP). C. elegans is transparent and GFP-tagged cargo proteins can be expressed in specific cells under cell-specific promoters. Living worms can be fixed by microbeads on 10% agarose gel without killing or anesthetizing the worms. Under these conditions, cargo movement can be directly observed in the axons and cilia of living C. elegans without dissection. This method can be applied to the observation of any cargo molecule in any cells by modifying the target proteins and/or the cells they are expressed in. Most basic proteins such as molecular motors and adaptor proteins that are involved in axonal transport and IFT are conserved in C. elegans. Compared to other model organisms, mutants can be obtained and maintained more easily in C. elegans. Combining this method with various C. elegans mutants can clarify the molecular mechanisms of axonal transport and IFT.

Immobilization of Caenorhabditis elegans to Analyze Intracellular Transport in Neurons

Caenorhabditis elegans (C. elegans) is a good model to study axonal and intracellular transport. Here, I describe a protocol for in vivo recording and analysis of axonal and intraflagellar transport in C. elegans.

신경 세포에서 세포내 수송 분석 꼬마 선 충 의 동원 정지

Axonal transport and intraflagellar transport (IFT) are essential for axon and cilia morphogenesis and function. Kinesin superfamily proteins and dynein ...

발생학

Assembling Molecular Shuttles Powered by Reversibly Attached Kinesins

This protocol describes how to create kinesin-powered molecular shuttles with a weak and reversible attachment of the kinesins to the surface. In contrast to previous protocols, in this system, microtubules recruit kinesin motor proteins from solution and place them on a surface. The kinesins will, in turn, facilitate the gliding of the microtubules along the surface before desorbing back into the bulk solution, thus being available to be recruited again. This continuous assembly and disassembly leads to striking dynamic behavior in the system, such as the formation of temporary kinesin trails by gliding microtubules.
Several experimental methods will be described throughout this experiment: UV-Vis spectrophotometry will be used to determine the concentration of stock solutions of reagents, coverslips will first be ozone and ultraviolet (UV) treated and then silanized before being mounted into flow cells, and total internal reflection fluorescence (TIRF) microscopy will be used to simultaneously image kinesin motors and microtubule filaments.

We present a protocol to build molecular shuttles, where surface-adhered kinesin motor proteins propel dye-labelled microtubules. Weak interactions of the kinesins with the surface enables their reversible attachment to it. This creates a nanoscale system which exhibits dynamic assembly and disassembly of its components while retaining its functionality.

Kinesins 연결 된 조립 분자 셔틀 역에 의해 구동

This protocol describes how to create kinesin-powered molecular shuttles with a weak and reversible attachment of the kinesins to the surface. In contrast ...

공학

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

The mitotic bipolar kinesin-5 motors perform essential functions in spindle dynamics. These motors exhibit a homo-tetrameric structure with two pairs of catalytic motor domains, located at opposite ends of the active complex. This unique architecture enables kinesin-5 motors to crosslink and slide apart antiparallel spindle microtubules (MTs), thus providing the outwardly-directed force that separates the spindle poles apart. Previously, kinesin-5 motors were believed to be exclusively plus-end directed. However, recent studies revealed that several fungal kinesin-5 motors are minus-end directed at the single-molecule level and can switch directionality under various experimental conditions. The Saccharomyces cerevisiae kinesin-5 Cin8 is an example of such bi-directional motor protein: in high ionic strength conditions single molecules of Cin8 move in the minus-end direction of the MTs. It was also shown that Cin8 forms motile clusters, predominantly at the minus-end of the MTs, and such clustering allows Cin8 to switch directionality and undergo slow, plus-end directed motility. This article provides a detailed protocol for all steps of working with GFP-tagged kinesin-5 Cin8, from protein overexpression in S. cerevisiae cells and its purification to in vitro single-molecule motility assay. A newly developed method described here helps to differentiate between single molecules and clusters of Cin8, based on their fluorescence intensity. This method enables separate analysis of motility of single molecules and clusters of Cin8, thus providing the characterization of the dependence of Cin8 motility on its cluster size.

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

The bi-directional mitotic kinesin-5 Cin8 accumulates in clusters that split and merge during their motility. Accumulation in clusters also changes the velocity and directionality of Cin8. Here, a protocol for motility assays with purified Cin8-GFP and analysis of motile properties of single molecules and clusters of Cin8 is described.

S. cerevisiae 세포로부터 정제된 양방향 Kinesin-5 Cin8의 단일 분자 및 클러스터의 이동성

The mitotic bipolar kinesin-5 motors perform essential functions in spindle dynamics. These motors exhibit a homo-tetrameric structure with two pairs of ...

생화학

Characterizing the Composition of Molecular Motors on Moving Axonal Cargo Using "Cargo Mapping" Analysis

Understanding the mechanisms by which molecular motors coordinate their activities to transport vesicular cargoes within neurons requires the quantitative analysis of motor/cargo associations at the single vesicle level. The goal of this protocol is to use quantitative fluorescence microscopy to correlate (&#8220;map&#8221;) the position and directionality of movement of live cargo to the composition and relative amounts of motors associated with the same cargo. &#8220;Cargo mapping&#8221; consists of live imaging of fluorescently labeled cargoes moving in axons cultured on microfluidic devices, followed by chemical fixation during recording of live movement, and subsequent immunofluorescence (IF) staining of the exact same axonal regions with antibodies against motors. Colocalization between cargoes and their associated motors is assessed by assigning sub-pixel position coordinates to motor and cargo channels, by fitting Gaussian functions to the diffraction-limited point spread functions representing individual fluorescent point sources. Fixed cargo and motor images are subsequently superimposed to plots of cargo movement, to &#8220;map&#8221; them to their tracked trajectories. The strength of this protocol is the combination of live and IF data to record both the transport of vesicular cargoes in live cells and to determine the motors associated to these exact same vesicles. This technique overcomes previous challenges that use biochemical methods to determine the average motor composition of purified heterogeneous bulk vesicle populations, as these methods do not reveal compositions on single moving cargoes. Furthermore, this protocol can be adapted for the analysis of other transport and/or trafficking pathways in other cell types to correlate the movement of individual intracellular structures with their protein composition. Limitations of this protocol are the relatively low throughput due to low transfection efficiencies of cultured primary neurons and a limited field of view available for high-resolution imaging. Future applications could include methods to increase the number of neurons expressing fluorescently labeled cargoes.

Intracellular transport of cargoes, such as vesicles or organelles, is carried out by molecular motor proteins that track on polarized microtubules. This protocol describes the correlation of the directionality of transport of individual cargo particles moving inside neurons, to the relative amount and type of associated motor proteins.

사용 축삭화물을 이동하는 분자 모터의 구성을 특성화 &quot;화물 매핑&quot;분석

Understanding the mechanisms by which molecular motors coordinate their activities to transport vesicular cargoes within neurons requires the quantitative ...

신경과학

Cargo Loading onto Kinesin Powered Molecular Shuttles

Cells have evolved sophisticated molecular machinery, such as kinesin motor proteins and microtubule filaments, to support active intracellular transport of cargo. While kinesins tail domain binds to a variety of cargoes, kinesins head domains utilize the chemical energy stored in ATP molecules to step along the microtubule lattice. The long, stiff microtubules serve as tracks for long-distance intracellular transport.
These motors and filaments can also be employed in microfabricated synthetic environments as components of molecular shuttles 1. In a frequently used design, kinesin motors are anchored to the track surface through their tails, and functionalized microtubules serve as cargo carrying elements, which are propelled by these motors. These shuttles can be loaded with cargo by utilizing the strong and selective binding between biotin and streptavidin. The key components (biotinylated tubulin, streptavidin, and biotinylated cargo) are commercially available.
Building on the classic inverted motility assay 2, the construction of molecular shuttles is detailed here. Kinesin motor proteins are adsorbed to a surface precoated with casein; microtubules are polymerized from biotinylated tubulin, adhered to the kinesin and subsequently coated with rhodamine-labeled streptavidin. The ATP concentration is maintained at subsaturating concentration to achieve a microtubule gliding velocity optimal for loading cargo 3. Finally, biotinylated fluorescein-labeled nanospheres are added as cargo. Nanospheres attach to microtubules as a result of collisions between gliding microtubules and nanospheres adhering to the surface.
The protocol can be readily modified to load a variety of cargoes such as biotinylated DNA4, quantum dots 5 or a wide variety of antigens via biotinylated antibodies 4-6.

Molecular shuttles consisting of functionalized microtubules gliding on surface-adhered kinesin motor proteins can serve as a nanoscale transport system. Here, the assembly of a typical shuttle system is described.

Kinesin 전원 분자 셔틀로화물 로딩

Cells have evolved sophisticated molecular machinery, such as kinesin motor proteins and microtubule filaments, to support active intracellular transport ...

생물학

Simultaneous Interference Reflection and Total Internal Reflection Fluorescence Microscopy for Imaging Dynamic Microtubules and Associated Proteins

Several techniques have been employed for the direct visualization of cytoskeletal filaments and their associated proteins. Total-internal-reflection-fluorescence (TIRF) microscopy has a high signal-to-background ratio, but it suffers from photobleaching and photodamage of the fluorescent proteins. Label-free techniques such as interference reflection microscopy (IRM) and interferometric scattering microscopy (iSCAT) circumvent the problem of photobleaching but cannot readily visualize single molecules. This paper presents a protocol for combining IRM with a commercial TIRF microscope for the simultaneous imaging of microtubule-associated proteins (MAPs) and dynamic microtubules in vitro. This protocol allows for high-speed observation of MAPs interacting with dynamic microtubules. This improves on existing two-color TIRF setups by eliminating both the need for microtubule labeling and the need for several additional optical components, such as a second excitation laser. Both channels are imaged on the same camera chip to avoid image registration and frame synchronization problems. This setup is demonstrated by visualizing single kinesin molecules walking on dynamic microtubules.

We present a protocol for implementing interference-reflection microscopy and total-internal-reflection-fluorescence microscopy for the simultaneous imaging of dynamic microtubules and fluorescently labeled microtubule-associated proteins.

동시 간섭 반사 및 전체 내부 반사 형광 현미경 검사 이미징 동적 미세 소관 및 관련 단백질

Several techniques have been employed for the direct visualization of cytoskeletal filaments and their associated proteins. ...

Single-Molecule Analysis of Sf9 Purified Superprocessive Kinesin-3 Family Motors

A complex cellular environment poses challenges for single-molecule motility analysis. However, advancement in imaging techniques have improved single-molecule studies and has gained immense popularity in detecting and understanding the dynamic behavior of fluorescent-tagged molecules. Here, we describe a detailed method for&#160;in vitro single-molecule studies of kinesin-3 family motors using Total Internal Reflection Fluorescence (TIRF) microscopy. Kinesin-3 is a large family that plays critical roles in cellular and physiological functions ranging from intracellular cargo transport to cell division to development. We have shown previously that constitutively active dimeric kinesin-3 motors exhibit fast and superprocessive motility with high microtubule affinity at the single-molecule level using cell lysates prepared by expressing motor in mammalian cells. Our lab studies kinesin-3 motors and their regulatory mechanisms using cellular, biochemical and biophysical approaches, and such studies demand purified proteins at a large scale. Expression and purification of these motors using mammalian cells would be expensive and time-consuming, whereas expression in a prokaryotic expression system resulted in significantly aggregated and&#160;inactive protein. To overcome the limitations posed by bacterial purification systems and mammalian cell lysate, we have established a robust Sf9-baculovirus expression system to express and purify these motors. The kinesin-3 motors are C-terminally tagged with 3-tandem fluorescent proteins (3xmCitirine or 3xmCit) that provide enhanced signals and decreased photobleaching. In vitro single-molecule and multi-motor gliding analysis of Sf9 purified proteins demonstrate that kinesin-3 motors are fast and superprocessive akin to our previous studies using mammalian cell lysates. Other applications using these assays include detailed knowledge of oligomer conditions of motors, specific binding partners paralleling biochemical studies, and their kinetic state.

This study details purification of KIF1A(1-393LZ), a member of kinesin-3 family, using Sf9-baculovirus expression system. In vitro single-molecule and multi-motor gliding analysis of these purified motors exhibited robust motility properties comparable to motors from mammalian cell lysate. Thus, Sf9-baculovirus system is amenable to express and purify motor protein of interest.

Sf9 정제 초공정 키네신-3 제품군 모터의 단일 분자 분석

A complex cellular environment poses challenges for single-molecule motility analysis. However, advancement in imaging techniques have improved ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

원자력 교통 단일 분자 이미징

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Kinesin의 분리 및 정제에서 Drosophila 태아

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...