This work was supported in part by the Lupus Research Institute, NCI grant CA138617, NIDDK grant DK090978, Charlotte Schmidlapp Award (to E.M.J.), and the Albert J. Ryan Fellowship (to J.K.). We are grateful for the support and instrumentation provided by the Research Flow Cytometry Core in the Division of Rheumatology at Cincinnati Children&#8217;s Hospital Medical Center, supported in part by NIH AR-47363, NIH DK78392 and NIH DK90971.

<ol>
	<li>Helmick, C. G., Felson, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Part+I.+Arthritis+Rheum.">Part I. Arthritis Rheum.</a> Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).</li><li>Somers, E. C., Marder, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+incidence+and+prevalence+of+systemic+lupus+erythematosus:+The+Michigan+lupus+epidemiology+and+surveillance+program.">Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program.</a> Arthritis and Rheumatol. 66, 369-378 (2014).</li><li>Perry, D., Sang, A., Yin, Y., Zheng, Y. -. Y., Morel, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+models+of+systemic+lupus+erythematosus.">Murine models of systemic lupus erythematosus.</a> J Biomed Biotechnol. 2011, 271694 (2011).</li><li>Lindholm, L., Rydberg, L., Stranneg&#229;rd, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+host+plasma+cells+during+graft-versus-host+reactions+in+mice.">Development of host plasma cells during graft-versus-host reactions in mice.</a> Eur J Immunol. 3 (8), 511-515 (1973).</li><li>Fialkow, P. J., Gilchrist, C., Allison, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoimmunity+in+chronic+graft-versus-host+disease.">Autoimmunity in chronic graft-versus-host disease.</a> Clin Exp Immunol. 13, 479-486 (1973).</li><li>Streilein, J. W., Stone, M. J., Duncan, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+Specificity+of+Autoantibodies+Produced+in+Systemic+Graft-vs-Host+Disease.">Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease.</a> J Immunol. 114 (1), 255-260 (1975).</li><li>Gleichmann, E., Gleichmann, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diseases+caused+by+reactions+of+T+lymphocytes+to+in+compatible+structures+of+the+major+histocompatibility+complex.+I.+Autoimmune+hemolytic+anemia.">Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia.</a> Eur J Immunol. 6 (12), 899 (1976).</li><li>Morris, S., Cohen, P. L., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+induction+of+systemic+lupus+erythematosus+by+recognition+of+foreign+Ia.">Experimental induction of systemic lupus erythematosus by recognition of foreign Ia.</a> Clin Immunol Immunopathol. 57 (2), 263-273 (1990).</li><li>Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Role+of+Host+(Endogenous)+T+Cells+in+Chronic+Graft-Versus-Host+Autoimmune+Disease.">The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease.</a> J Immunol. 161 (11), 5880-5885 (1998).</li><li>Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING-Mediated+DNA+Sensing+Promotes+Antitumor+and+Autoimmune+Responses+to+Dying+Cells.">STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells.</a> J Immunol. 193, 6124-6134 (2014).</li><li>Petri, M., Orbai, A. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+and+validation+of+systemic+lupus+international+collaborating+clinics+classification+criteria+for+systemic+lupus+erythematosus.">Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus.</a> Arthritis Rheum. 64 (8), 2677-2686 (2012).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+Protocol+Plus+Troubleshooting+and+Optimization+Strategies.">Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies.</a> J Vis Exp. (63), e3998 (2012).</li><li>. Product information: Thermo Scientific FastDigest PsuI Available from: <a target="_blank" href="https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf">https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf</a> (2012)</li><li>Matheu, M. P., Parker, I., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+and+2-photon+imaging+of+peripheral+lymph+nodes+in+mice.">Dissection and 2-photon imaging of peripheral lymph nodes in mice.</a> J Vis Exp. (7), e265 (2007).</li><li>Harrell, M. I., Iritani, B. M., Ruddell, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymph+node+mapping+in+the+mouse.">Lymph node mapping in the mouse.</a> J Immunol Methods. 332 (1-2), 170-174 (2008).</li><li>Covelli, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+3,+Internal+examination.">Chapter 3, Internal examination.</a> Guide to the necroscopy of the mouse. , (2009).</li><li>Quah, B. J. C., Parish, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+carboxyfluorescein+diacetate+succinimidyl+ester+(CFSE)+to+monitor+lymphocyte+proliferation.">The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation.</a> J Vis Exp. (44), e2259 (2010).</li><li>Matheu, M. P., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+CD4++T+cells+from+mouse+lymph+nodes+using+Miltenyi+MACS+purification.">Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification.</a> J Vis Exp. (9), e53319 (2007).</li><li>Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manual+Restraint+and+Common+Compound+Administration+Routes+in+Mice+and+Rats.">Manual Restraint and Common Compound Administration Routes in Mice and Rats.</a> J Vis Exp. (67), e2771 (2012).</li><li>Hoff, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+of+Blood+Collection+in+the+Mouse.">Methods of Blood Collection in the Mouse.</a> Lab Animal. 29 (10), 47-53 (2000).</li><li>Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Unfixed,+Frozen+Tissues+to+Study+Natural+Mucin+Distribution.">Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution.</a> J Vis Exp. (67), e3928 (2012).</li><li>Cohen, P. L., Maldonado, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+for+SLE.">Animal models for SLE.</a> Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).</li><li>Seavey, M. M., Lu, L. D., Stump, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+systemic+lupus+erythematosus+(SLE)+and+ex+vivo+assay+design+for+drug+discovery.">Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery.</a> Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).</li><li>McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+caveat+for+T+cell+transfer+studies:+generation+of+cytotoxic+anti-Thy1.2+antibodies+in+Thy1.1+congenic+mice+given+Thy1.2++tumors+or+T+cells.">A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells.</a> J Leukoc Biol. 89 (2), 291-300 (2011).</li><li>Scott, D. M., Ehrmann, I. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+mouse+male-specific+transplantation+antigen+H-Y..">Identification of a mouse male-specific transplantation antigen H-Y..</a> Nature. 376, 695-698 (1995).</li><li>Joly, E., Hudrisier, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+trogocytosis+and+what+is+its+purpose.">What is trogocytosis and what is its purpose.</a> Nat Immunol. 4 (9), 815 (2003).</li><li>Brown, D. R., Calpe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+an+NK+cell-independent+role+for+Slamf4+in+controlling+humoral+autoimmunity.">Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity.</a> J Immunol. 187 (1), 21-25 (2011).</li><li>Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allotype-specific+immunoregulation+of+autoantibody+production+by+host+B+cells+in+chronic+graft-versus+host+disease.">Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease.</a> J Immunol. 144 (3), 916-922 (1990).</li><li>Choudhury, A., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+require+&#8220;nurturing&#8221;+by+CD4+T+cells+during+development+in+order+to+respond+in+chronic+graft-versus-host+model+of+systemic+lupus+erythematosus.">B cells require &#8220;nurturing&#8221; by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus.</a> Clin Immunol. 136 (1), 105-115 (2010).</li><li>Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humoral+immunity+due+to+long-lived+plasma+cells.">Humoral immunity due to long-lived plasma cells.</a> Immunity. 8 (3), 363-372 (1998).</li></ol>

The authors have nothing to disclose.

BM12 유도 모델은 SLE의 세포 및 분자 프로세스를 연구하는 비교적 간단하고 효율적인 방법입니다. 자기 항원에 대해 지시 적응 적 전송 CD4 T 세포의 활성화는 만성 여기 기술 된 바와 같이, 유동 세포 계측법에 의해 측정 될 수 TFH, GC B 세포와 플라즈마 세포의 축적에 이르게. 빠르고 쉽게 SLE 환자에서 발생하는 것과 유사하고, 궁극적으로 병리 적자가 항체의 축적을 제어하는​​자가 면역 배 중심 공정에서 후보 유전자 및 신규 치료법의 역할을 할 수 심문이 모델을 이용하여 미래 연구. 또한, 여기에 설명 유세포 분석을 비롯한 면역 글로불린의 추가 개발을 포함 마우스 모델을 연구하는 데 사용하지만,자가 면역, 감염, 및 알레르기에 한정 될 수 없다. 인간의 질병의 모든 동물 모델과 마찬가지로이 모델은 한계가있다. 어떤 질병 (STABLE)와 속도 감안할 때OPS와 그 크기는 SLE의 개발에 관련된 모든 유전자는이 모델에 필요한 병원성 될 가능성이 없다. 데이터가 유전자 변형받는 사람의 TFH의 최소한의 확장을 제안 할 때 또한주의가 이식 거부를 배제하기 위해주의해야한다. Congenic 마커받는 세포는 그렇지 공여 세포의 부재를 마스크 할 수 TFH (도 3B)로 분화 할 수 특히 이후 수확에서 공여 세포의 존재를 확인하는데 사용되어야한다. congenic 마커를 사용하여, 우리는 분명 14 일 (그림 6)에 의해 거부 항원을 숨겨 공여 세포의 완전한 제거를 관찰했다. 우리는 성공적으로 기증자로 CD45.1 + BM12 및 CD45.2 + BM12 마우스를 사용하고, 한 수신자 (그림 같은 CD45.1 + BoyJ (B6.SJL- Ptprc PEPC의 B / BoyJ)와 CD45.2 + C57BL / 6 마우스 3, 6, 7, 미발표 데이타). 그러나, 야생형 congenicB6.PL- Thy1의 / CyJ 마우스 변형에서 CD90.1 + 세포는 분명하지 않은 현상을 잘 접목,도 CD90.1 +받는 사람 (게시되지 않은 데이터)에 이식 잘 CD90.2 + BM12 세포를하지 않는다 이 모델 (26)에 고유. 어느 C57BL / 6 BM12 마우스는 처음 모리스 등에 의해보고 된 기증자 또는받는 사람, 역할을 할 수 있습니다. 9 그러나, 우리의 실험실에서 우리는 B6 마우스에 BM12 세포의 전송이 T 세포와 B 세포의 일관성 확장을 생산 찾아 하루에 14에서 인구는 또한, 다른 그룹에서 기증자와받는 사람 마우스는 성별과 연령 일치해야합니다. BM12 모델의 첫 번째 설명에서보고 된 실험은 남성 → 남성과 여성 → 여성 전송 (9) 사이에 질병 매개 변수에서 유의 한 차이를 발견하지 않지만, 남성 → 여성 전송은 남성 항원 (HY)로, 조언 전송 CD4 T 세포에 의해 표현되지 않습니다 이식 reje을 야기 할 수 있음여성받는 사람 27 ction의. 게이트 전체 CD45.1 + 이식을 구성하지 것이다 - congenic 마커에 대한 항체 및 형광 색소를 선택하면 공여 세포는 CD45.2 것으로, 다양한 각도로받는 사람 congenic 마커에 대한 긍정적이 될 것을 주목해야한다. 현상 명확 CD45.1 + 나이브, CD45.1 + 도너 및 CD45.2받는 CD4 + T 세포 (도 7)에 의해 CD45.2 발현의 비교에 도시되어있다. 특히, 도너 세포는 나이브 컨트롤 (도 7)에 비해, 자신 congenic 마커의 발현을 상향 조절하는 것으로 보인다. 유사한 결과가 또한 CD45.1 + BoyJ 마우스로 CD45.2 + BM12 전송으로 볼 수있다 (데이터는 미도시). 아마도, 활성화 된 CD4 T 세포에 의해 trogocytosis 28받는 사람 CD45 결과의 인수받는 B 세포와의 상호 작용을 반복 다음. 사실, BM12 모드L은 생체 내에서 trogocytosis 과정 연구에 유용한 도구를 증명할 수있다. <img alt="그림 7" src="/files/ftp_upload/53319/53319fig7.jpg" /> 그림 7. 기증자 세포는 획득받는 사람 CD45 congenic 마커. CD45.1 + BM12 림프구 CD45.2 + C57BL / 6 수신자로 옮겼다. 기증자,받는 사람, 그리고 순진한 (CD45.1의 +) CD4 T 세포 14 일 전송 후 CD45.1와 CD45.2 식에 대한 평가된다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 그것은 C57BL / 7 마우스에 정제 BM12 CD4 T 세포의 전달이 병 (29)을 시작하기에 충분한 것으로 밝혀졌다; 그러나 해당하는 질병은 전체 림프구가 전송 될 때 개발, 정제는 반드시 T 가전에 따라 질병 의존성을 연구 할 필요가 없습니다LL-고유 유전자 발현. 아이젠 버그와 동료, 명확하게 BM12 모델의 항체 생산 세포가 거의 독점적으로받는 사람의 기원 (30)는 것을 보여 주었다. 또한, 수신자 CD4 T 세포 10 요건은 우리의 데이타는 그 수신인을 나타낼지라도 T 세포가 참여할 수 상계 외인성 IL-4 (31)의 첨가에 의해 될 수있는 그들의 개발 동안 B 세포의 &#39;양육&#39;에 한한다 다소 배 중심에 응답하여, 그들 중 일부는 TFH 표현형 (그림 3B, 오른쪽 아래)를 개발 할 수있다. 분석을위한 조직을 수확 할 때마다 BM12 실험을 위해 만든해야 하나 중요한 결정이다. 물론 결정 요인이 다를 수 있습니다 본 연구에 중요한 정확히에 따라 달라집니다. 그들은 TFH 세포와 형질 세포의 초기 개발에 초점을 여기에 기술 된 실험은 14 일까지 걸릴; 그러나,이 모델은 이후 만성적 인SLE의 GVHD 모델은 질병은 더 이상 모니터링 할 수 있습니다. 사실, 사구체 신염을 포함한 SLE의 특정 임상 양상, 나중에 개발할 수 있습니다. 단백뇨는 주입 후 10,31 4-8주에서 최고 수준을 빠르면 2와 주에게 포스트 분사를 감지하지만, 도달하고있다. 또한, 유세포 분석은 여기에 설명 된 2 주 지속 실험을 위해 최적화되었다. 우리는이 시점에서 GC의 B 세포와 플라즈마 세포의 상당수를 발견; 추가 시간을 부여하더라도, ANA 분비 혈장 세포의 큰 비율은 골수 (32)에 상주 할 수있다. 또한,이 유동 염색 패널에 의해 식별 형질 세포 가능성도 plasmablasts 인 두 종류의 세포를 구별하기 위해 포함 추가적인 항체가 요구 될 것이다. TFH 확장 아마도 우리가 초점을 맞추었다되는 14 일 윈도우 후 어느 시점에서 피크에 도달한다. 그러나, 우리의 지식에 대한 연구가 이주를 넘어 공여 세포 수 BM12보고되지 않았거나 사용D congenic 마커 적응 적 전송 세포를 추적합니다.

전신성 홍 반성 루푸스 (SLE)는 항핵 항체 (ANA) 생산 및 사구체 신염을 특징으로 prototypically 복잡한자가 면역 질환이다. 많은 다른 피부를 포함하여 후유증, 심장 - 폐 및 간 병변은 몇몇 개인의 질병과 관련이있다. 미국에서 보급 추정치는 여성과 소수 민족 (3)에서 특히 높은 빈도로, 150,000-1,500,000 1, 2에서 널리 다릅니다. SLE의 원인이 식별 곤란 하였지만, 전신성자가 면역에 절정 다양한 유전 적 및 환경 적 요인의 상호 작용으로부터 발생하는 것으로 생각된다. 많은 동물 모델은 질병 발병과 진행으로 이어지는 요인을 연구하기 위해 사용되었다. SLE의 클래식 마우스 모델은 P 등 안에 1000mg F1 모델과 NZM 유도체, MLR / LPR 변형 및 BXSB / YAA 변형 및 유도 시스템 NZB x를 포함하여 유 전적으로 걸리기 마우스 균주를 포함ristane 및 만성 이식편 대 숙주 질환 (cGVHD) 모델 4. GVHD 모델에서자가 항체 생산의 초기 보고서는 F1 전송 5에 부모에 대한 다양한 마우스 균주 또는 햄스터 균주를 사용 - 8; 루푸스와 같은 질병을 연구하는 데 더 일반적인 방법은 현재 DBA / 2 부모 → (C57BL / 6 ×의 DBA / 2) F1, 여기에 설명 된 BM12 전송 모델을 포함한다. 각 모델은 자신의주의를 가지고 있지만, 그들은 일반적으로 인간의 질병의 임상 적 특징과 상관 관계 기능의 공통 집합을 공유합니다. 마우스 모델에서 가장 흔히보고 된 파라미터는, 비장 종대, 신장염, ANA 생산을 포함하고, 세포 수준에서, T 모낭 헬퍼 세포 (TFH), 배 중심 (GC) B 세포와 플라즈마 세포의 팽창. H2 - - AB1 BM12 / KhEgJ (BM12) 마우스, 변형 내가 유도 BM12 모델은 IA BM12 B6 (C)에서 림프구의 입양 전송에 의해 달성된다MHC 클래스 II에 3 아미노산 치환을 제외하고 C57BL / 6 dentical, IA에 C57BL / 6 (B6) 마우스 나. 받는 사람 장갑차에 의한 기증자 CD4 T 세포의 Alloactivati​​on는 증상이 밀접하게 SLE를 닮은으로 cGVHD로 연결됩니다. 특히, 이러한 도너 유래 TFH의 팽창, 수신자 유래 GC의 B 세포와 플라즈마 세포의 팽창 및 항 dsDNA, 항 ssDNA를 방지 염색질 및 안티 RBC 항체 9 포함한 아나의 생산을 포함한다. 시간이 지남에 따라,받는 사람 마우스는 사구체 간질에 IgG의 예금 및 신장 (10)의 혈관 영역과 관련된 사구체 신염을 개발한다. 우리는 최근 인간의 질병과 유사한, 나는이 모델 11 IFN 유형에 대한 중요한 역할도 있습니다, 것으로 나타났습니다. 특히, 인간 SLE 대한 정의 기준은 항 dsDNA의 존재 하에서 SLE와 호환 신염의 개발이 마우스 모델의 두드러진 특징은 둘 다 12 항체를 포함한다. 있다 SE자연 모델에 비해 BM12 모델의 veral 장점. 자발적으로 SLE 같은 징후를 개발 클래식 모델은 녹아웃하거나 유전자 변형 마우스 어렵고 시간이 많이 소요하는 교차 만든다 하이브리드 마우스 변종이 아닌 B6 배경에 B6 배경, 또는 대형 유전 좌위에 근친 마우스 균주 중 하나에 의존한다. BM12 유도 모델, 유전자 변형 마우스는 특정 유전자 질환에 중요 할 수있는 셀룰러 구획의보다 신속한 식별을 허용 도너 또는 수신자 중 하나의 역할을 할 수있다. 또한, BM12 모델 질환 개발은 대부분 자발적 모델 수개월에 비해 아나의 출현까지 단지 2 주 필요한 훨씬 빠르다. 또한, 서로 다른 시점에서 질환이 자발적 모델 달리 BM12의 → B6의 모델에서 질병의 발병 및 진행은 고도로 동기화된다. 이것은 수 b 적절한 크기의 코호트 생성을 허용전자는 질병 개발의 모든 단계에서 중재 또는 치료 전략에 사용됩니다. 다음은 B6 배경에 C57BL / 6 마​​우스에 BM12 림프구의 입양 전송, 또는 유전자 변형에 의해 전신성 홍 반성 루푸스와 같은자가 면역을 개시하기위한 상세한 프로토콜입니다. 또한, 우리는 TFH, GC B 세포를 열거하는 유세포 염색 프로토콜을 기술하고, 형질 세포 - 세포 유형은 인간의 질병과 관련된. 중요한 것은, 이러한 프로토콜은 SLE의 대부분의 마우스 모델에서 질병의 특성 및 기타 질병 모델에서 TFH, GC B 세포와 플라즈마 세포를 식별하기 위해 사용될 수있다.

<table><tbody><tr><td>B6.SJL-Ptprca Pepcb/BoyJ</td><td>The Jackson Laboratory</td><td>001162</td><td>CD45.1+ BoyJ mouse strain</td></tr><tr><td>B6(C)-H2-Ab1bm12/KhEgJ</td><td>The Jackson Laboratory</td><td>001162</td><td>Bm12 mouse strain</td></tr><tr><td>FastDigest PsuI</td><td>Life Technologies</td><td>FD1554</td><td>Restriction digest enzyme for genotyping</td></tr><tr><td>1X RBC Lysis Buffer</td><td>eBioscience</td><td>00-4333-57</td><td></td></tr><tr><td>IMDM</td><td>GE Healthcare</td><td>SH30228.01</td><td></td></tr><tr><td>Plasma Separation Tube (PST)</td><td>BD</td><td>365974</td><td>Blood collection tube with Dipotassium EDTA</td></tr><tr><td>Serum Separation Tube (SST)</td><td>BD</td><td>365967</td><td>Blood collection tube with Clot activator / SST Gel</td></tr><tr><td>Ficoll</td><td>GE Healthcare</td><td>17-1440-02&amp;nbsp;</td><td>High density cell separation solution</td></tr><tr><td>Lympholyte-M</td><td>Cedarlane</td><td>CL5030</td><td>High density cell separation solution</td></tr><tr><td>GL-7-biotin</td><td>eBioscience</td><td>13-5902-82&amp;nbsp;</td><td></td></tr><tr><td>Streptavidin-BUV395</td><td>BD</td><td>564176</td><td></td></tr><tr><td>CD138-BV421</td><td>BioLegend</td><td>142508</td><td></td></tr><tr><td>CD4-BV510</td><td>BioLegend</td><td>100559</td><td></td></tr><tr><td>TCR&amp;beta;-BV605</td><td>BD</td><td>562840</td><td></td></tr><tr><td>CD45.1-BV711</td><td>BioLegend</td><td>110739</td><td></td></tr><tr><td>CD45.2-FITC</td><td>BioLegend</td><td>109806</td><td></td></tr><tr><td>PD-1-PE</td><td>BioLegend</td><td>135206</td><td></td></tr><tr><td>CD19-PerCP</td><td>BioLegend</td><td>115532</td><td></td></tr><tr><td>Fas-PE-Cy7</td><td>BD</td><td>557653</td><td></td></tr><tr><td>CXCR5-APC</td><td>BioLegend</td><td>145506</td><td></td></tr><tr><td>Fixable Viability Dye ef780</td><td>eBioscience</td><td>65-0865-18</td><td></td></tr><tr><td>CD4-BV421</td><td>BioLegend</td><td>100443</td><td></td></tr><tr><td>1.2 ml FACS tube inserts, racked</td><td>USA Scientific</td><td>1412-1400</td><td></td></tr><tr><td>BD Falcon&amp;trade; Round-Bottom Tubes</td><td>BD</td><td>352017</td><td></td></tr></tbody></table>

the bm12 inducible model of systemic lupus erythematosus (sle) in c57bl/6 mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

병에 걸린 마우스는 질량과 세포 수 (그림 2)의 측면에서 비장을 2 ~ 3 회 건강한 쥐의 크기를 나타내는, 적은 14 일 종대을 개발한다. 비장 세포는 순차적으로 빛 산란 (SSC-에 의해 FSC-A)에 문이있다, 이중선 (FSC-으로 FSC-W 또는 -H), 생존 세포 (생존 염료의 낮은 염색) 및 CD4 + TCRβ + (그림의 제거 3A). 공여 세포는 CD45.1 및 CD45.2 (도 3b, 왼쪽 아래)에 기초하여 수신자 세포로부터 구별된다. PD-1, CXCR5,과 Bcl-6, 및 ICOS (도 3B, C)의 상향 조절을 특징으로 공여 세포는 주로, T의 모낭 헬퍼 (TFH) 세포의 표현형을 채택한다. 수신자 CD4 T 세포 집단의 일부는 또한 TFH (도 3b, 오른쪽 아래)로 구별. 전사 셀 초기 다이 - 오프 및 / 또는 이송 후, 도너 유래 TFH의 팽창은 대수, R이고쥐의 비장에서 10-20000000 세포를 eaching 십사일 주입 (그림 3D) 후. 전송 림프구의 CFSE - 라벨은 CD4 T 세포가 초기 활성화 후 TFH로 분화하는 기증자를 보여; 본질적으로 모든 분할 셀은 3 일, 7에서 관찰하고, 14 CXCR5과 PD-1을 (도 4)를 상향 조절. 확산 피크 프로파일은 또한 기증자 CD4 T 세포의 상대적으로 낮은 비율 alloactivati​​on과 분열을 시행하는 것이 좋습니다. 날 (14)에 의해, 검출 공여 세포의 대부분은 CFSE에 의한 측정 부문의 최대 수 초과 분할 한 것들이다. 도너 - 유도 TFH의 팽창은 내인성 GC의 B 세포와 플라즈마 세포 (도 5a)의 대응 누적 수반된다. 비장 형질 세포 축적 3 일 또는 7 (도 5b)에 나이브 동물 위에 더 증가 나타내지 않는, TFH에 비해 지연된다. Accordingly, 항핵 항체는 종래 9 일 (데이터는 도시하지 않음)에 용이하게 검출되지 않지만 안정적 일 14 일 11 일에 정량화 될 수있다. congenic 마커를 사용하여, 우리는 여러 균주에 공여 세포의 거부 반응을 관찰했다. 이 마우스는 충분히 C57BL / 6 배경에 backcrossed되지 않는 일반적인 문제이지만 BM12 세포는 일반적으로 완전히로 간주됩니다 B6.PL- Thy1 / CyJ (CD90.1) 마우스에 전송 될 때, 우리는 거부 반응을 관찰 backcrossed. 따라서, 마우스는 통상적으로 초기 CD4 T 세포 이식의 효율을 평가하기 위해 유동 염색에 의해 혈액 샘플을 3 일 ~ 스크리닝한다; 우리는 세포가 초기 시점에서 매우 작은 확대 이식 CFSE 증식​​ 실험에서 알고있다. 이러한 결과는 14 일 수확에서 얻어진 결과와 비교 한 후이다. 거부 예 케이스 천만 CD45.1 + BM12 림프구 Cardif로 옮겼다<html> - / - 12 세대에 대한 C57BL / 6 마우스에 backcrossed했다 쥐. 5 일째, 모든 마우스는 등가 래프팅 (CD4 T 세포를 순환 2-3 %)을 표시하지만, 일 (14)에 의해, BM12 공여 세포는 완전히 전적으로 변형 된 수신자 (도 6)로부터 제거 하였다. <img alt="그림 2" src="/files/ftp_upload/53319/53319fig2.jpg" /> 도 2 비장 성장 동역학 BM12 림프구의 주입 후에. 비장 직접 절단 (왼쪽) 후 고정밀 밸런스에 칭량 하였다. 생균 수 (오른쪽) 사균을 제외하는 트립 판 블루를 이용하여 혈구 계수하여 결정 하였다. 결과는 SEM, 평균 ±로 묘사된다 여기서 n = 9, 4, 3, 6, 각각. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> JPG &quot;/&gt; SLE. CD45.1 + BM12 림프구의 BM12 모델 T 여포 헬퍼 세포의 확장 그림 3. 분석은 C57BL / 6 수신자로 전송하고 비장 14 일 후 분석 하였다. (A) &quot;림프구&quot;(첫 번째 패널), &quot;단일 셀&quot;(두 번째 패널), &quot;살아있는 세포&quot;(제 3 패널)와 &quot;CD4 T 세포 &#39;(제 4 패널)을 보여주는 대표적인 게이팅 전략. (B) 공여 세포는 CD45.1 및 CD45.2 염색으로받는 CD4 T 세포 구분 및 PD-1 및 CXCR5의 발현을 위해 분석된다. 일반적 TFH과 관련된 여러 단백질의 상향 조절로 나타낸 바와 같이 (C) 공여 세포는 TFH 표현형을 채택한다. (D) 3 일, 7시, 포스트 (14) 및 트랜스퍼 (CD4 + CD45.1 + PD-1 + + CXCR5 생균으로 정의) 도너 유래 TFH의 확장을 나타내는 전형적인 결과. 결과가 도시되어있다S는 ± SEM을 의미 여기서 n = 5, 4, 3, 6, 각각. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/53319/53319fig4.jpg" /> 그림 4. PD-1과 CXCR5는 분열하는 세포에서 상향 조절된다. BM12 세포 전에 C57BL / 6 수신자에 주입 CFSE으로 표시했다. 대표적인 흐름 플롯은 3, 7시에 기증자 CD4 T 세포에 대해 표시, 14 일 주사 후.되는 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53319/53319fig5.jpg" /> 도 5의 플라즈마 비장 세포 및 GC B 세포의 확장. (A) 나이브 마우스 비장 주제 유동 플롯, 또는 이들로부터십사일 CD45.1 + BM12 전송 후 마우스. 플라즈마 세포는 CD138 + CD19 낮은 살아있는 세포 (상단 패널)로 정의됩니다. GC B 세포는 GL-7 개의 FA (하단 패널)을 표현하는 CD19 + B 세포의 서브 세트이다. (B) Quantitave 데이터는 시간 경과에 플라스마 비장 세포의 축적을 도시. 결과는 SEM, 평균 ±로 묘사된다 여기서 n = 5, 4, 3, 6, 각각. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/53319/53319fig6.jpg" /> 그림 6. BM12 이식 일부 유전자 변형받는 사람 마우스에 의해 거부됩니다. CD45.1 + BM12 림프구는 유전자 변형 마우스 (상단 패널) 또는 C57BL / 6 (하단 패널)받는 사람 마우스 하나에 옮겼다. 마우스 5 일 포스트 주입에 출혈 및 이식 효율을 평가 하였다. 비장같은 쥐에서의이 십사일 후 분석 하였다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53319/53319fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" fo:keep-together.within-page="1" style="top-margin: 20px"><tbody><tr><td> 프라이머 이름 </td><td colspan="2"> 시퀀스 (5 &#39;- 3&#39;) </td><td> 어닐링 온도 </td></tr><tr><td> Bm12F </td><td colspan="2"> CGTGGTCCCCGCTGTCCCCC </td><td rowspan="2"> * 65 ° C </td></tr><tr><td> Bm12R </td><td colspan="2"> GGGCAGAGGGCAGAGGTGAG </td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td> 분절 </td><td> 사이클의 수 </td><td> 온도 </td><td> 지속 </td></tr><tr><td> 1 </td><td> 1 </td><td> 95 ° C </td><td> 2 분. </td></tr><tr><td rowspan="3"> (2) </td><td rowspan="3"> (40) </TD&gt; <td> 95 ° C </td><td> 15 초. </td></tr><tr><td> * 65-0.5 ° C / 단계 </td><td> 15 초. </td></tr><tr><td> 72 ° C </td><td> 45 초. </td></tr><tr><td> 3 </td><td> 1 </td><td> 72 ° C </td><td> 10 분. </td></tr></tbody></table> 표 1 :. 프라이머 및 BM12의 유전자형에 대한 열 순환 조건 최적의 열 순환 조건은 사용되는 정확한 시약 및 장비에 따라 달라집니다. 프로토콜은 또한 정적 어닐링 온도를 사용하여 작동 할 수 있지만 이러한 조건은, 모든 단계에서 어닐링 온도를 변화시킬 수있는 열 순환기에 대해 최적화되었다. <img alt="표 2" src="/files/ftp_upload/53319/53319table2.jpg" /> 표 2 :. 우리가 성공적으로 사용한 패널은 비장 TFH, GC B와 유동 세포 계측법에 의해 형질 세포 식별을위한 항체 패널 제시3 일 (왼쪽)와 BM12 세포 주입 (가운데) 후 14 일에서 T 세포와 B 세포의 분석에 이식 효율을 평가. 이 5 레이저 (355, 405, 488, 561, 640 ㎚)와 LSRII에 최적화되어있다. 이 모든 시스템에 대한 최선의 선택되지 않을 수 있지만 각각의 형광 색소 권장 필터 세트, (오른쪽) 표시됩니다. 무엇 레이저, PMT, 및 필터 설정의 조합에 따라 여러 개의 패널로 T와 B 세포의 분석 패널을 분리하는 것이 필요할 수있다 사용할 수 있습니다.

Watch this Scientific Journal Video about The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice at JoVE.com

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

the-bm12-inducible-model-systemic-lupus-erythematosus-sle-c57bl6

Universidad San Sebastian

Research

JoVE Journal

Medicine

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

17.4K 조회수.  Cincinnati Children's Hospital Medical Center and University of Cincinnati College of Medicine. The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

비디오: The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

SJL 마우스의 실험적 면역 Hypophysitis의 유도

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

연구

면역학 및 감염병학

The CYP2D6 Animal Model: How to Induce Autoimmune Hepatitis in Mice

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to generate an animal model that reflects the characteristics of the human disease 3-5. However, in various models the induction of disease was rather complex and often hepatitis was only transient3-5. Therefore, we have developed a straightforward mouse model that uses the major human autoantigen in type 2 autoimmune hepatitis (AIH-2), namely hCYP2D6, as a trigger6. Type 1 liver-kidney microsomal antibodies (LKM-1) antibodies recognizing hCYP2D6 are the hallmark of AIH-27,8. Delivery of hCYP2D6 into wildtype FVB or C57BL/6 mice was by an Adenovirus construct (Ad-2D6) that ensures a direct delivery of the triggering antigen to the liver. Thus, the ensuing local inflammation generates a fertile field9 for the subsequent development of autoimmunity. A combination of intravenous and intraperitoneal injection of Ad-2D6 is the most effective route to induce a long-lasting autoimmune damage to the liver (section 1). Here we provide a detailed protocol on how autoimmune liver disease is induced in the CYP2D6 model and how the different aspects of liver damage can be assessed. First, the serum levels of markers indicating hepatocyte destruction, such as aminotransferases, as well as the titers of hCYP2D6 antibodies are determined by sampling blood retroorbitaly (section 2). Second, the hCYP2D6-specific T cell response is characterized by collecting lymphocytes from the spleen and the liver. In order to obtain pure liver lymphocytes, the livers are perfused by PBS via the portal vein (section 3), digested in collagen and purified over a Percoll gradient (section 4). The frequency of hCYP2D6-specific T cells is analyzed by stimulation with hCYP2D6 peptides and identification of IFN&gamma;-producing cells by flow cytometry (section 5). Third, cellular infiltration and fibrosis is determined by immunohistochemistry of liver sections (section 6). Such analysis regimen has to be conducted at several times after initiation of the disease in order to prove the chronic nature of the model. The magnitude of the immune response characterized by the frequency and activity of hCYP2D6-specific T and/or B cells and the degree of the liver damage and fibrosis have to be assessed for a subsequent evaluation of possible treatments to prevent, delay or abrogate the autodestructive process of the liver.

Infection of mice with an Adenovirus expressing the major human autoantigen cytochrome P450 2D6 (hCYP2D6) recognized by sera of patients suffering from type 2 autoimmune hepatitis results in a persistent form of autoimmune-mediated liver disease characterized by extensive hepatitis, fibrosis and generation of a CYP2D6-specific immune response.

CYP2D6 동물 모델 : 마우스에 면역 간염을 유발하는 방법

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to ...

의학

Myelin Oligodendrocyte Glycoprotein (MOG35-55) Induced Experimental Autoimmune Encephalomyelitis (EAE) in C57BL/6 Mice

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While the exact etiology of the disease is yet unclear, autoreactive T lymphocytes are thought to play a central role in its pathophysiology. MS therapy is only partially effective so far and research efforts continue to expand our knowledge on the pathophysiology of the disease and to develop novel treatment strategies. Experimental autoimmune encephalomyelitis (EAE) is the most common animal model for MS sharing many clinical and pathophysiological features. There is a broad diversity of EAE models which reflect different clinical, immunological and histological aspects of human MS. Actively-induced EAE in mice is the easiest inducible model with robust and replicable results. It is especially suited for investigating the effects of drugs or of particular genes by using transgenic mice challenged by autoimmune neuroinflammation. Therefore, mice are immunized with CNS homogenates or peptides of myelin proteins. Due to the low immunogenic potential of these peptides, strong adjuvants are used. EAE susceptibility and phenotype depends on the chosen antigen and rodent strain. C57BL/6 mice are the commonly used strain for transgenic mouse construction and respond among others to myelin oligodendrocyte glycoprotein (MOG). The immunogenic epitope MOG35-55 is suspended in complete Freund's adjuvant (CFA) prior to immunization and pertussis toxin is applied on the day of immunization and two days later. Mice develop a "classic" self-limited monophasic EAE with ascending flaccid paralysis within 9-14 days after immunization. Mice are evaluated daily using a clinical scoring system for 25-50 days. Special considerations for care taking of animals with EAE as well as potential applications and limitations of this model are discussed.

Myelin Oligodendrocyte Glycoprotein MOG35-55 Induced Experimental Autoimmune Encephalomyelitis EAE in C57BL/6 Mice

Experimental autoimmune encephalomyelitis (EAE) is an established animal model of multiple sclerosis. C57BL/6 mice are immunized with myelin oligodendrocyte glycoprotein (MOG) peptide 35-55 (MOG35-55), resulting in an ascending flaccid paralysis caused by autoreactive immune cells in the central nervous system. Protocols for disease induction and monitoring will be discussed.

수초 희소 돌기 아교 세포 당 단백질 (MOG<sub&gt; 35-55</sub&gt;) C57BL / 6 쥐에 실험자가 면역 뇌척수염 (EAE) 유도

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

다양한 조직에서 면역 세포의 질병에 의존하는 유통의 마우스 및 평가에 실험자가 면역 뇌척수염의 유도

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

자가 면역 탈수 초화의 약리 개입에 대한 CNS 보호 대 결정 면역 시스템 억제

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...

A Simple Approach to Induce Experimental Autoimmune Neuritis in C57BL/6 Mice for Functional and Neuropathological Assessments

Experimental autoimmune neuritis (EAN) is a well-appreciated experimental model of autoimmune peripheral demyelinating diseases. EAN disease is induced by immunizing mice with neurogenic peptides to direct an inflammatory attack toward components of the peripheral nervous system (PNS). Recent advances have enabled the induction of EAN in the relatively resistant C57BL/6 mouse line using myelin protein zero (P0)106-125 or P0180-199 peptides delivered in adjuvant combined with the injection of pertussis toxin. The ability to induce EAN in the C57BL/6 strain allows for the use of the numerous genetic tools that exist on this mouse background, and thus allows the sophisticated study of disease pathogenesis and interrogation of the mechanistic action of novel therapeutics in combination with transgenic approaches. In this study, we demonstrate a simple approach to successfully induce EAN using the P0180-199 peptide in C57BL/6 mice. We also outline a protocol for the assessment of functional deficits that occur in this model, accompanied by an array of neuropathological features. Thus, this model is a powerful experimental model to study the pathogenesis of human peripheral demyelinating neuropathies, and to determine the efficacy of potential therapies that aim to promote myelin repair and protect against nerve damage in autoimmune neuritis.

This report outlines a simple approach to successfully induce experimental autoimmune neuritis (EAN) using the myelin protein zero (P0)180-199 peptide in combination with Freund&#39;s complete adjuvant and pertussis toxin. We present a sophisticated paradigm capable of accurately assessing the extent of functional deficits and neuropathology that occur in this EAN.

기능과 Neuropathological 평가 대 한 C57BL/6 쥐에 실험 자가 면역 신경 염을 유발 하는 간단한 방법

Experimental autoimmune neuritis (EAN) is a well-appreciated experimental model of autoimmune peripheral demyelinating diseases. EAN disease is induced by ...

신경과학

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Murine Distal Colostomy, A Novel Model of Diversion Colitis in C57BL/6 Mice

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a diverting enterostomy. The etiology of this disease remains ill-defined but appears to differ from that of classical inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Research aimed to decipher the pathophysiological mechanisms leading to the development of this disease has been severely hampered by the lack of an appropriate murine model. This protocol generates a murine model of DC that facilitates the study of the immune system's role and its interaction with the microbiome in the development of DC. In this model using C57BL/6 animals, distal parts of the colon are excluded from the fecal stream by creating a distal colostomy, triggering the development of mild to moderate inflammation in the excluded bowel segments and reproducing the hallmark lesions of human DC with a moderate systemic inflammatory response. In contrast to the rat model, a large number of genetically-modified murine models on the C57BL/6 background are available. The combination of these animals with our model allows the potential roles of individual cytokines, chemokines, or receptors of bioactive molecules (e.g., interleukin (IL)-17; IL-10, chemokine CXCL13, chemokine receptors CXCR5 and CCR7, and the sphingosine-1-phosphate receptor 4) to be assessed in the pathogenesis of DC. The availability of congenic mouse strains on the C57BL/6 background largely facilitates transfer experiments to establish the roles of distinct cell types involved in the etiology of DC. Finally, the model offers the opportunity to assess the influences of local interventions (e.g., modification of the local microbiome or local anti-inflammatory therapy) on mucosal immunity in affected and non-affected bowel segments and the on systemic immune homeostasis.

Murine distal colostomy provides a murine model for human diversion colitis, a predominantly lymphocytic colitis in colon segment excluded from the fecal stream.

Murine 원심 인공, C57BL/6 마우스에 전환 Colitis의 새로운 모델

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a ...

Analyses of Proteinuria, Renal Infiltration of Leukocytes, and Renal Deposition of Proteins in Lupus-prone MRL/lpr Mice

Systemic lupus erythematosus (SLE) is an autoimmune disorder with no known cure and is characterized by persistent inflammation in many organs, including the kidneys. Under such circumstances, the kidney loses its ability to clean waste from the blood and regulate salt and fluid concentrations, eventually leading to renal failure. Women, particularly those of childbearing age, are diagnosed nine times more often than men. Kidney disease is the leading cause of mortality in SLE patients. The present protocol describes a quick and simple method to measure excreted protein levels in collected urine, tracking lupus progression over time. In addition, an approach to isolate kidney mononuclear cells is provided based on size and density selection to investigate renal infiltration of leukocytes. Furthermore, an immunohistochemical method has been developed to characterize protein deposition in the glomeruli and leukocyte infiltration in the tubulointerstitial space. Together, these methods can help investigate the progression of chronic inflammation associated with the kidneys of lupus-prone MRL/lpr mice.

The present protocol describes a method to track lupus progression in mice. Two additional procedures are presented to characterize lupus nephritis based on cell infiltration and protein deposition in the kidneys.

단백뇨, 백혈구의 신장 침윤 및 루푸스가 발생하기 쉬운 MRL / lpr 마우스에서 단백질의 신장 침착 분석

Systemic lupus erythematosus (SLE) is an autoimmune disorder with no known cure and is characterized by persistent inflammation in many organs, including ...

Induction and Evaluation of Experimental Autoimmune Encephalomyelitis in Mouse(마우스에서 실험적 자가면역 뇌척수염의 유도 및 평가)

Modeling Multiple Sclerosis in the Two Sexes: MOG35-55-Induced Experimental Autoimmune Encephalomyelitis

Multiple Sclerosis (MS) is a chronic autoimmune inflammatory disease affecting the central nervous system (CNS). It is characterized by different prevalence in the sexes, affecting more women than men, and different outcomes, showing more aggressive forms in men than in women. Furthermore, MS is highly heterogeneous in terms of clinical aspects, radiological, and pathological features. Thus, it is necessary to take advantage of experimental animal models that allow the investigation of as many aspects of the pathology as possible. Experimental autoimmune encephalomyelitis (EAE) represents one of the most used models of MS in mice, modeling different disease features, from the activation of the immune system to CNS damage. Here we describe a protocol for the induction of EAE in both male and female C57BL/6J mice using myelin oligodendrocyte glycoprotein peptide 35-55 (MOG35-55) immunization, which leads to the development of a chronic form of the disease. We also report the evaluation of the daily clinical score and motor performance of these mice for 28 days post immunization (28 dpi). Lastly, we illustrate some basic histological analysis at the CNS level, focusing on the spinal cord as the primary site of disease-induced damage.

저자 스포트라이트: 수컷과 암컷 마우스 모두에 적합한 다재다능한 실험적 자가면역 뇌척수염 모델 만들기 

Experimental autoimmune encephalomyelitis is one of the most widely used murine models of multiple sclerosis. In the current protocol, C57BL/6J mice of both sexes are immunized with myelin oligodendrocyte glycoprotein peptide, resulting mainly in ascending paresis of the tail and limbs. Here we discuss the protocol of EAE induction and evaluation.

C57BL / 6 마우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

요약

더 많은 비디오 탐색

이 비디오의 챕터

SJL 마우스의 실험적 면역 Hypophysitis의 유도

CYP2D6 동물 모델 : 마우스에 면역 간염을 유발하는 방법

수초 희소 돌기 아교 세포 당 단백질 (MOG

다양한 조직에서 면역 세포의 질병에 의존하는 유통의 마우스 및 평가에 실험자가 면역 뇌척수염의 유도

자가 면역 탈수 초화의 약리 개입에 대한 CNS 보호 대 결정 면역 시스템 억제

기능과 Neuropathological 평가 대 한 C57BL/6 쥐에 실험 자가 면역 신경 염을 유발 하는 간단한 방법

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

Murine 원심 인공, C57BL/6 마우스에 전환 Colitis의 새로운 모델

단백뇨, 백혈구의 신장 침윤 및 루푸스가 발생하기 쉬운 MRL / lpr 마우스에서 단백질의 신장 침착 분석

두 성별의 다발성 경화증 모델링: MOG_35-55-유도 실험적 자가면역 뇌척수염

C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

요약

더 많은 비디오 탐색

이 비디오의 챕터

SJL 마우스의 실험적 면역 Hypophysitis의 유도

CYP2D6 동물 모델 : 마우스에 면역 간염을 유발하는 방법

수초 희소 돌기 아교 세포 당 단백질 (MOG

다양한 조직에서 면역 세포의 질병에 의존하는 유통의 마우스 및 평가에 실험자가 면역 뇌척수염의 유도

자가 면역 탈수 초화의 약리 개입에 대한 CNS 보호 대 결정 면역 시스템 억제

기능과 Neuropathological 평가 대 한 C57BL/6 쥐에 실험 자가 면역 신경 염을 유발 하는 간단한 방법

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

Murine 원심 인공, C57BL/6 마우스에 전환 Colitis의 새로운 모델

단백뇨, 백혈구의 신장 침윤 및 루푸스가 발생하기 쉬운 MRL / lpr 마우스에서 단백질의 신장 침착 분석

두 성별의 다발성 경화증 모델링: MOG35-55-유도 실험적 자가면역 뇌척수염

C57BL / 6 마우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

두 성별의 다발성 경화증 모델링: MOG_35-55-유도 실험적 자가면역 뇌척수염