Name: polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies
Uploaded: 2012-05-22T12:00:00.000+00:00
Duration: 9 min
Description: Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

시약을 설정 및 젤류를 따르고하고 UCLA의 에린 샌더스에 영감,지도 및 지원을하고 원고를 교정을위한 UCLA의 크리스 Reddi에 대한 특별 감사합니다. 나는 또한 GAL3 유전자를 증폭하기 위해 효모 게놈의 DNA와 primers를 공급을위한 감사 Giancarlo Costaguta과 그레고리 S. 페인에게 싶습니다. 4 - 나는 또한 실험실 장비 및 숫자 2를 만들기 위해 사용되는 시약의 사진을내어 Bhairav​​의 샤 감사드립니다. 이 프로젝트에 대한 자금 지원은 HHMI (HHMI 그랜트 번호 52006944)에 의해 제공되었다.

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

나는 공개 할게 없다.

PCR은 생물 학적 과학 병기의 indispensible 도구가되었습니다. PCR은 genomes과 다양성뿐만 아니라, 더욱 생화 학적 분석을 위해 간단하게 복제 유전자에 대한 통찰력을 얻고, 구체적이고 정확한 임상 테스트를 수 있도록 생물학 자들이 genomes을 통해 권력을 양보하고, 새로운 기능과 하이브리드 유전자를 만들 수 있도록 과학의 진로를 변경했다. PCR 응용 프로그램은 자사의 강력한 힘을 가졌 과학자의 상상력에 의해 제한됩니다. 이 PCR의 새로운 특수 용도를 설명하는 많은 서적과 논문이 있으며, 많은는 생물 학적 과학의 차세대 걸쳐 개발됩니다. 그러나 관계없이 예상 접근법, 기본 프레임 워크는 동일 남아있다. PCR은 모든 과대에 DNA가 특정 세그먼트의 대량 생성의 체외 응용 프로그램입니다. PCR 실험을 설계하는 것은 사상과 인내가 필요합니다. 그림 3에 표시된 결과는 주요 채널 중 하나를 예시PCR을위한 최적화 전략을 디자인할 때 allenges. PCR 중 하나가 매개 변수가 변경되면 그것은, 그것은 또 다른 영향을 미칠 수 있습니다. 초기 PCR은 최적의 MG이 2.0 mm의 + 농도와 하위 최적 어닐링 온도 (58 ° C)에서 실시되었다 경우 예를 들어, 다음, 결과는 그림 3C에서 볼로 얼룩을 생산합니다. 얼룩을 해결하기위한 시도가 2.0 밀리미터 MgCl 2를 포함하는 반응과 PCR 조건을 설정하고 61 ° C.로 어닐링 온도를 조정 관련 됐을지도 몰라요 그러나, 같은 그림 3A에서 본,이 모든 제품을 얻을 수없는 것이다. 따라서, 그것은 오히려 가짜 결과를 해결할 때, 단일 반응을 한 농도를 추가하는 것보다, 시약을 적정하다 것이 좋습니다. 또한, PCR 실험을 최적화하는 데 필요한 가장 일반적인 조정 MG 2 + 농도를 변경하고 어닐링 온도를 수정하는 것입니다. 그러나 이러한 변화는 최소화하거나 탈선 결과를 폐기하다, additi의 적정하지 않을 경우ves 및 / 또는 같은 표 2-6에 설명된 사이클링 조건 프로토콜을 변경하는 문제를 줄일 수 있습니다. 다른 모든 실패하면 primers를 다시 디자인하고 시도 다시 시도하십시오.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 댓글 </td></tr><tr><td> DNA 형성 촉매 Polymeras </td><td> 시그마 </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201,225 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 PCR 튜브 </td><td> 바이오는 힘이에요 </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 모자 </td><td> 바이오는 힘이에요 </td><td> 223-9472 </td><td></td></tr><tr><td> TE 버퍼 : </td><td></td><td></td><td></td></tr><tr><td> EDTA (에틸렌 다이아 민 테트라 초산) 나트륨 소금의 이수화물 </td><td> 시그마 </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCL </td><td> 시그마 </td><td> T-3253 </td><td></td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> Gal3 (1848) - SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG에게 </td></tr><tr><td> 열전달 자전거 타는 사람 </td><td> 바이오는 힘이에요 </td><td> 170-9703 </td><td> 내 자전거 타는 사람 </td></tr><tr><td> 아가로 오스 </td><td> ISC BioExpress </td><td> 전자 3120-500 </td><td></td></tr><tr><td> 겔 전기 영동 </td><td> Hoeffer 과학 계측기 </td><td> 모델 HE33 </td><td></td></tr><tr><td> 1킬로바이트의 DNA 사다리 </td><td> 뉴잉글랜드 BioLabs </td><td> N3232S </td><td></td></tr><tr><td> 바이오 방사선 파워 팩 </td><td> 바이오는 힘이에요 </td><td> 164-5050 </td><td> PowerPac 기본 </td></tr><tr><td> 젤 닥 시스템 </td><td> Fotodyne 법인 </td><td colspan="2"> FOTO / 분석 탐정 FX 워크 스테이션 </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

생명 공학 발견의 황금 시대로 징계를 쇠뇌 기술 진보가 있었다. 예를 들어, 미생물학 분야는 과학자들이 처음으로 prokaryotes을 시각화 수 안톤 반 리웬허크와의 현미경의 출현으로 변모되었다. 중합 효소 사슬 반응 (PCR)의 개발 미치는 영향은 생물학에서 수많은 subdisciplines를 스팬과 분자 과학의 진로를 변경 이들 혁신 중 하나입니다. 이론 과정은 1971 년에 Keppe와 동료에 의해 제시된되었다; 전체 PCR 절차 주면 주식 회사에서 1985 년 동안 Kary Mullis에 의해 설명하고 실험적으로 적용되기 전까지는하지만, 그건 다른 14년했습니다. 이 기법의 자동화 및 개선은 세균의 Thermus aquaticus의, 따라서 이름이 DNA 형성 촉매 장치의 DNA 중합 효소의 열 안정성의 DNA 중합 효소의 도입과 함께 진행. PCR은 포웨입니다시작하는 재료만을 소량 (즉, DNA를 템플릿이나 대상 시퀀스)의 DNA (즉, amplicon)의 특정 세그먼트의 충분한 공급을 생성할 수 rful 증폭 기술. 간단하고 일반적으로 문제가없는 반면, 가짜 결과를 생산하는 반응을 복잡하게 함정이 있습니다. PCR이 실패했을 때 그것은 아가로 오스의 젤에 대한 밴드의 사다리 또는 얼룩으로 나타 다양한 규모의 다수가 아닌 특정 DNA의 제품으로 이어질 수 있습니다. 가끔 제품이 전혀 나오지. 변이가 실수로 PCR 제품의 이질적인 인구 결과, amplicons에 소개되면 또 다른 잠재적인 문제가 발생합니다. 인내와 신중 문제 해결이 정리 및 문제 (들)을 해결하기 위해 고용하지 않는 경우 PCR 실패는 절망적이 될 수 있습니다. 이 프로토콜은 PCR의 기본 원리를 설명 대부분의 대상 시퀀스의 증폭집니다 방법론을 제공하고 반응을 최적화하기위한 전략을 제시합니다. 이 PCR 가이드, 일에 따라udents는 할 수 있어야합니다 : <ul><li> 종래의 PCR 실험에 대한 반응 및 열 사이클링 조건을 설정 </li><li> 다양한 반응 구성 요소의 기능과 PCR 실험에 미치는 전반적인 영향을 이해 </li><li> 어떤 DNA를 템플릿에 대한 PCR 실험을 설계하고 최적화 </li><li> 실패 PCR 실험 문제 해결 </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

중합 효소 사슬 반응 : 기본 프로토콜 플러스 문제 해결 및 최적화 전략

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Universidad San Sebastian

Research

JoVE Journal

Biology

403.2K 조회수.  University of California, Los Angeles. PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

비디오: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the traditional method of choice is 3&#39; rapid amplification of cDNA ends (3&#39; RACE). Protocols for 3&#39; RACE require the careful design and selection of nested primers within the 3&#39; untranslated region (3&#39; UTR) of the target gene of interest. However, with a few modifications the protocol can be used to include the entire 3&#39; UTR and sequences within the open reading frame (ORF), providing a more comprehensive picture of the relationship between the ORF and the 3&#39; UTR. This is in addition to identification of the polyadenylation signal (PAS), as well as the cleavage and polyadenylation site provided by conventional 3&#39; RACE. Expanded 3&#39; RACE can detect unusual 3&#39; UTRs, including gene fusions within the 3&#39; UTR, and the sequence information can be used to predict potential miRNA binding sites as well as AU rich destabilizing elements that may affect the stability of the transcript.

The two different 3&#39; rapid amplification of cDNA ends (3&#39; RACE) protocols described here make use of two different DNA polymerases to map sequences that include a segment of the open reading frame (ORF), the stop codon, and the entire 3&#39; UTR of a transcript using RNA obtained from different cancer cell lines.

암에 성적표를 매핑할 CDNA의 급속 한 확대 끝 적응 3'

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the ...

연구

유전학

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

튜브에 칩 형식을 사용 하 여 산발적 인 가족 용 대 환자에 있는 유전 변이 대 한 디지털 중 합 효소 연쇄 반응 분석 결과

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

암 연구학

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

원형 RNA를 분석하기 위해 미니유전자를 포함하는 Alu 요소 사용

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

생화학

An Affordable HIV-1 Drug Resistance Monitoring Method for Resource Limited Settings

HIV-1 drug resistance has the potential to seriously compromise the effectiveness and impact of antiretroviral therapy (ART). As ART programs in sub-Saharan Africa continue to expand, individuals on ART should be closely monitored for the emergence of drug resistance. Surveillance of transmitted drug resistance to track transmission of viral strains already resistant to ART is also critical. Unfortunately, drug resistance testing is still not readily accessible in resource limited settings, because genotyping is expensive and requires sophisticated laboratory and data management infrastructure. An open access genotypic drug resistance monitoring method to manage individuals and assess transmitted drug resistance is described. The method uses free open source software for the interpretation of drug resistance patterns and the generation of individual patient reports. The genotyping protocol has an amplification rate of greater than 95% for plasma samples with a viral load &#62;1,000 HIV-1 RNA copies/ml. The sensitivity decreases significantly for viral loads &#60;1,000 HIV-1 RNA copies/ml. The method described here was validated against a method of HIV-1 drug resistance testing approved by the United States Food and Drug Administration (FDA), the Viroseq genotyping method. Limitations of the method described here include the fact that it is not automated and that it also failed to amplify the circulating recombinant form CRF02_AG from a validation panel of samples, although it amplified subtypes A and B from the same panel.

Drug resistance testing for HIV-1 infected individuals failing antiretroviral therapy (ART) can guide future therapies and improve treatment outcomes. Optimizing individual and population health outcomes in high HIV prevalence but resource-limited settings will ultimately require affordable and accessible drug resistance genotyping and interpretation methods.

자원 제한 설정에 대한 경제적 인 HIV-1 약제 내성 모니터링 방법

HIV-1 drug resistance has the potential to seriously compromise the effectiveness and impact of antiretroviral therapy (ART). As ART programs in ...

의학

Primer Extension Capture: Targeted Sequence Retrieval from Heavily Degraded DNA Sources

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ancient bones. The method greatly reduces sample destruction and sequencing demands relative to direct PCR or shotgun sequencing approaches. We used this method to reconstruct the complete mitochondrial DNA (mtDNA) genomes of five Neandertals from across their geographic range. The mtDNA genetic diversity of the late Neandertals was approximately three times lower than that of contemporary modern humans. Together with analyses of mtDNA protein evolution, these data suggest that the long-term effective population size of Neandertals was smaller than that of modern humans and extant great apes.

We present a method of targeted ancient DNA sequence retrieval, which we used to reconstruct the complete mitochondrial genomes of five Neandertal individuals. Comparison of these sequences with present day humans suggests that Neandertals had a long term low effective population size.

프라이머 확장 캡처 : 경비 저하 DNA 소스에서 타겟 시퀀스 불러오기

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ...

생물학

Rapid, Enzymatic Methods for Amplification of Minimal, Linear Templates for Protein Prototyping using Cell-Free Systems

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins in less than 24 h using cell-free expression. After receiving DNA from a vendor, the gene fragment is PCR-amplified, cut, circularized, and cryo-banked. A small amount of the banked DNA is then diluted and amplified significantly (up to 106x) using isothermal rolling circle amplification (RCA). RCA can yield microgram quantities of the minimal expression template from picogram levels of starting material (mg levels if all starting synthetic fragment is used). In this work, a starting amount of 20 pg resulted in 4 &#181;g of the final product. The resulting RCA product (concatemer of the minimal template) can be added directly to a cell-free reaction with no purification steps. Due to this method being entirely PCR-based, it may enable future high-throughput screening efforts when coupled with automated liquid handling systems.

The study describes a protocol for creating large (&#181;g-mg) quantities of DNA for protein screening campaigns from synthetic gene fragments without cloning or using living cells. The minimal template is enzymatically digested and circularized and then amplified using isothermal rolling circle amplification. Cell-free expression reactions could be performed with the unpurified product.

세포 없는 시스템을 사용하여 단백질 프로토타이핑을 위한 최소선형 템플릿의 증폭을 위한 신속하고 효소적인 방법

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins ...

생체공학

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

무세포 시스템을 사용한 유전 부분의 신속한 특성 분석

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting them for degradation. This system is exploited in many non-plant eukaryotes, such that a target protein, tagged with the AID motif, is degraded upon auxin addition. The level of TIR1 expression is critical; excessive expression leads to degradation of the AID-tagged protein even in the absence of auxin, whereas low expression leads to slow depletion. A &#946;-estradiol-inducible AID system was created, with expression of TIR1 under the control of a &#946;-estradiol inducible promoter. The level of TIR1 is tunable by changing the time of incubation with &#946;-estradiol before auxin addition. This protocol describes how to rapidly deplete a target protein using the AID system. The appropriate &#946;-estradiol incubation time depends on the abundance of the target protein. Therefore, efficient depletion depends on optimal timing that also minimizes auxin-independent depletion.

Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the &#946;-est AID system.

특이적이고 효율적인 단백질 고갈을 달성하기 위한 튜닝 분해

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting ...

면역학 및 감염병학

PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are&#160;three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.
This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

PCR: Principle, Instrumentation, and Applications

PCR: 중합 효소 연쇄 반응

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time ...

교육

JoVE Science Education

기초 생물학

세포 및 분자 생물학의 기본 테크닉

Gradient Polymerase Chain Reaction to Determine the Optimum Annealing Temperature

Source: Tsujimoto, H. et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/63008">Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti.</a> J. Vis. Exp. (2021).
This video demonstrates the gradient polymerase chain reaction for optimization of the annealing temperature of primers, which sets gradient annealing temperature along wells. The effect of different annealing temperatures is determined by the yield of amplified products that helps to optimize the reaction condition.

최적의 어닐링 온도를 결정하기 위한 그래디언트 중합효소 연쇄 반응

Source: Tsujimoto, H. et al., Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti. J. Vis. ...