הסיוע הטכני המיומן של יסמין Kresse היא הודתה בהכרת תודה.

בידול 1. של האדם ESC כלפי האנדודרם המכריע <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> טפחו את תאי גזע עובריים אנושיים (ESCs) באינקובטור ב 37 מעלות צלזיוס, 5% CO 2. </li><li style=";text-align:right;direction:rtl"> מעיל צלחת תרבות 6 היטב סלולרי חדש עם 1 מ&quot;ל של מטריצה ​​קרום במרתף דגירה כלי התרבות למשך 30 דקות לפחות ב RT. לפרטים ספציפיים בבקשה לפנות להוראות היצרן בהתאמה. </li><li style=";text-align:right;direction:rtl"> ודא ESCs האדם התרבותי יגיע ל -80% -90% confluency תחת מיקרוסקופ באמצעות בהגדלה נמוכה (למשל, 4X). לשאוב את המדיום מהנקבובי ידי מוצצת המדיום עם pipet פסטר זכוכית סטרילית. שוטפים את התאים פעם עם פתרון בופר פוספט (PBS). לשם כך, להוסיף 2 מ&quot;ל PBS היטב כל ברכות לנער את צלחת ולמצוץ את הפתרון כדי להסיר תאים מתים ופסולת התא. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מ&quot;ל של ריאגנט פתרון passaging ללא אנזים דיסוציאציה עדין של צבירי תאים. דגירת התאים לעבר 37 ° Cד 5% CO 2 עד התאים להראות סימנים ברורים של הפרעה בצבירים קטנים. הערה: זמן הדגירה תלוי המגיב בשימוש. לקבלת פתרון passaging ללא אנזים שהוזכר בסעיף החומרים, זמן דגירה הוא בערך 7 דקות. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מ&quot;ל DMEM / בינוני F-12 ולשבש המצרפים תא הנותרים לתוך תאים בודדים ידי pipetting מעלה ומטה באמצעות קצה פיפטה 1 מ&quot;ל. השתמש באפשרות זו כדי לרוקן את התאים מפני השטח ולהעביר את תאי צינור צנטריפוגה. כדי לאחזר את כל התאים, לשטוף היטב עם כל 1 מ&quot;ל של DMEM / בינוני F-12 ולהוסיף המדיום אל הצינור צנטריפוגה. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. לשאוב supernatant ו resuspend התאים במדיום תרבית תאים 5 מ&quot;ל ES המכיל מעכב 10 מיקרומטר Rho-קינאז (ROCK). </li><li style=";text-align:right;direction:rtl"> ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer וזרעי 150,000 - 400,000 תאים לכל 6 באר או אחר צלחת פריסה, בהתאם לקו בתאי הגזע העוברי בשימוש. מבוי סתום שימוש<html> ture בינוני מעכב ROCK 10 מיקרומטר המכיל להימנע אפופטוזיס והתרבות התאים באינקובטור ב 37 מעלות צלזיוס, 5% CO 2. </li><li style=";text-align:right;direction:rtl"> כ -24 שעות לאחר זריעה לשאוב את המדיום עם pipet פסטר זכוכית סטרילית להוסיף 2 מ&quot;ל של מדיום אינדוקציה הראשונית. הערה: בינוני זה מכיל ריכוזים סופי של 1% גלוטמין, 0.2% FCS, 5 מיקרומטר CHIR-99,021 ו 50 ng / A Activin מ&quot;ל מתקדם RPMI-1640 בינוני. בדרך כלל, להשתמש 2 מ&quot;ל של מדיום לגידול 6 צלחות היטב. </li><li style=";text-align:right;direction:rtl"> 48 שעות לאחר הזריעה, להחליף את המדיום כדי endoderm בינוני אינדוקציה. טפחו את התאים במדיום הזה במשך 48 אחר שעה עם שינוי בינוני יומי. הערה: בינוני זה מכיל 1% גלוטמין, 0.2% FCS ו -50 ng / ml Activin א &#39;מתקדם RPMI-1640 בינוני. תאים מחויבים כלפי האנדודרם הסופי להביע את סמן המשטח CXCR4. המכתים של CXCR4 יכול לשמש כדי לכמת את מספר התאים המחויבים DE. </li></ol>class = &quot;jove_title&quot;&gt; 2. צביעת תאי CXCR4 + Definitive endoderm עבור ניתוח cytometry הזרימה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במשך 24 שעות הסופיות אבל לפחות 1 שעה לפני קצירת התאים להוסיף 10 מיקרומטר ROCK מעכבים עד בינוני התרבות. </li><li style=";text-align:right;direction:rtl"> מעיל התא-ware תרבות ישמש מחדש זריעה עם מטריצה ​​קרום במרתף, כלומר, 12-גם צלחות לניתוח qPCR או קאמרית שקופיות עבור מכתים immunofluorescence. דגירת הצלחות או שקופיות למשך 30 דקות לפחות ב RT. </li><li style=";text-align:right;direction:rtl"> לשאוב את המדיום עם pipet פסטר זכוכית סטרילית מן הבארות של התאים הממוינים המשמשים מכתים ו / או מיון. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מ&quot;ל של ריאגנט פתרון passaging האנזים ללא עבור דיסוציאציה עדין של צבירי תאים. דגירת התאים ב 37 מעלות צלזיוס, 5% CO 2 עד להראות את תאי סימנים ברורים של הפרעה בצבירים קטנים. הערה: זמן הדגירה תלוי המגיב בשימוש. לקבלת הפתרון passaging האנזים ללא המוזכרים materiסעיף als, זמן הדגירה הוא בערך 7 דקות. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר DMEM / F-12 בינוניים ולשבש הנותרים אגרגטים תא לתוך תאים בודדים ידי pipetting מעלה ומטה בעזרת טיפ 1 מיליליטר. השתמש באפשרות זו כדי לרוקן את התאים מפני השטח ולהעביר את תאי צינור צנטריפוגה. כדי לאחזר את כל התאים, לשטוף היטב עם כל 1 מ&quot;ל של DMEM / F-12 בינוני w / o FCS ולהוסיף המדיום אל הצינור צנטריפוגה. </li><li style=";text-align:right;direction:rtl"> ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. תאים משלוש בארות של צלחת 6-גם אמורים לגרום 10-15 x 10 6 תאים לאחר שלושה ימים של בידול. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. הערה: המספר המדויק של התאים המתקבלים יהיה תלוי שורת תאים פלוריפוטנטיים המשמש את הבידול. </li><li style=";text-align:right;direction:rtl"> לשאוב supernatant ו resuspend התאים חיץ PEB המכילים מעכבי ROCK 10 מיקרומטר. השתמש 100 μl של חיץ זה לתקופה של עד 10 7 תאים. מוסיפים את מעכבי ROCK 10 מיקרומטר ביום staining. השתמש חיץ זה עבור כל היישומים במורד הזרם (המכונה חיץ PEB + RI). הערה: חיץ PEB מכיל 0.5% BSA ו -2 מ&quot;מ EDTA ב PBS. אם יותר תאים להיות מוכתמים, להתאים את עוצמת קול החיץ בהתאם. </li><li style=";text-align:right;direction:rtl"> הוסף 10 μl של נוגדן CXCR4-APC לכל 10 7 תאים 100 μl, זה בערך מייצג דילול של 1:10. הערה: השימוש של נוגדן APC צמוד אינו חובה. במקום זה ניתן להחליף בהתאם microbeads בשימוש. אם יותר תאים הם להיצבע לכוונן את עוצמת קול הנוגדן בהתאם. </li><li style=";text-align:right;direction:rtl"> מערבבים על ידי היפוך הצינור בעדינות עם האצבעות דגירה על 4 מעלות צלזיוס במקרר במשך 15 דקות. Resuspend התאים עם חיץ PEB מ&quot;ל 1-2. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. </li><li style=";text-align:right;direction:rtl"> לשאוב supernatant עם pipet פסטר זכוכית סטרילית resuspend התא גלולה ב PEB 80 μl לכל 10 7 תאים ולהוסיף 20 microbeads μl אנטי APC. הערה: </sטרונג&gt; אם יותר התאים להיות מוכתם, להתאים את עוצמת הקול מיקרו-חרוז בהתאם. </li><li style=";text-align:right;direction:rtl"> מערבבים על ידי היפוך הצינור בעדינות עם האצבעות דגירה על 4 מעלות צלזיוס במקרר במשך 15 דקות. Resuspend התאים עם חיץ PEB מ&quot;ל 1-2 + RI. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. לשאוב את המאגר. Resuspend במאגר 500 μl PEB + RI. </li></ol> 3. הפרדה מגנטית של CXCR4 + תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניח טור מגנטי בגודל בינוני בתוך שדה מגנטי לפי הוראות ייצור. טרום לשטוף את העמודה עם 500 μl PEB חיץ + RI. החל את השעית התא כולו לעמודה. אסוף את הזרימה דרך תאים לא הכל כפי יהיה לאגד את העמודה. ודא שלא להפריע את העמודות לשליפה אופטימלית של תאי CXCR4 +. </li><li style=";text-align:right;direction:rtl"> לשטוף את העמודה שלוש פעמים עם חיץ 500 μl PEB + RI. אסוף את הזרם הראשון דרך ולשלב אותו עם תאים שנאספו שלב 3.1. הסר את העמודה המגנטית מהשדה המגנטי ומניח אותו בתוךצינור איסוף מתאים. הוסף 1 מ&quot;ל PEB חיץ + RI על הטור. כדי elute התאים היטב ומהדקים את הבוכנה לתוך הטור. </li><li style=";text-align:right;direction:rtl"> אופציונלי: לאסוף את כל הזרימה דרך דגימות בנפרד ולהשתמש 20 μl כל לנתח את מספר CXCR4 + תאים באמצעות cytometry הזרימה. מספרם צריך לרדת עם כל צעד כביסה. הערה: לפחות 2 x 10 4 קיימא, תאים מגודרים צריכים לספור עבור תוצאות אמינות. </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 3.1-3.3 עם הזרם-שנאסף באמצעות מדגם משלב 3.1 ואת הזרם הראשון באמצעות מדגם משלב 3.2 באמצעות טור חדש. אל תשתמש שוב בטור הקודם. באמצעות אוויר הבוכנה נלחץ לתוך הטור, אשר חוסם אותו. </li><li style=";text-align:right;direction:rtl"> ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. בהתאם היעיל של עד הבידול עד 6 x 10 6 תאים ניתן למיין בתחילה ועוד 1 x 10 6 תאים באמצעות עמודה שנייה בעת שימוש 10 7 תאים עבור ההליך. </li&gt; <li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב XG 300 במשך 5 דקות. לשאוב את supernatant עם pipet פסטר זכוכית סטרילית resuspend התאים במדיום אינדוקציה האנדודרם 1 מ&quot;ל משלב 1.9 עם מעכב ROCK 10 מיקרומטר נוסף. </li><li style=";text-align:right;direction:rtl"> ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. זרעי התאים בצפיפות מתאימה, כלומר, ~ 4 x 10 5 תאים לכל גם צלחת 12-היטב (אפליקציה. 3.6 סנטימטר 2 משטח) או ~ 1.5 x 10 5 תאים לכל טוב של 8-היטב קאמרי שקופיות. </li></ol> 4. אופציונאלי: ניתוח אוכלוסין endoderm Definitive מטוהרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עבור מכתים immunofluorescence לתקן את התאים מטוהרים משלב 3.7 בערך 24 שעות לאחר זריעה עם 4% paraformaldehyde ו כתם במשך האנדודרם סופי (DE) ו / או חלבונים סמן pluripotency. הערה: בשימוש נפוץ סמנים DE כוללים FOXA2 ו SOX17, סמנים pluripotency נפוצים כוללים OCT3 / 4, NANOG ו Sox2 6, 8. </li><li style=";text-align:right;direction:rtl"> For ניתוח RT-qPCR, לקצור את התאים מטוהרים ישירות או 24 שעות לאחר זריעה, לחלץ סך-RNA הפוכה לתמלל cDNA מן מכלל הדגימות-RNA חילוץ. השתמש 10 cDNA ng כתבנית לכל תגובה RT-qPCR (triplicates) לנתח את הביטוי של DE וגנים סמן pluripotency 6, 8. הערה: גני סמן מקובלים הם שהוזכרו בשלב 4.1. תנאי מחזור 5 דקות ב 95 ° C ו 40 מחזורים של 15 שניות על 95 מעלות צלזיוס ו 1 דקות ב 60 מעלות צלזיוס, ואחריו נמס ניתוח עקום. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

נכון לעכשיו פרוטוקולי בידול לעתים נדירות לגרום תאים מובחנים 100%. מסיבות שעדיין יש לטפל תאים מסוימים להתנגד לתהליך הבידול. בהתאם את היעילות של פרוטוקול בידול המשמשים ואת הנטייה של ESC קו מספר מסוים של תאים פלוריפוטנטיים שיורית הם נצפו גם בכינויו לאחר בידול לתוך האנדודרם סופי. תאים שיורית אלו עלולים לפגוע differentiations במורד הזרם או ניתוח נוסף כגון transcriptomics, פרוטאומיקה, וניתוח ביטוי מירנה. תאים פלוריפוטנטיים שיורים או שושלות רצויות אחרות עשויים גם להפגין תופעות paracrine שעשוי להפריע מטרות הבידול. כתוצאה מכך, הסרת תאים אלה עלולות לגרום שחזור משופר. הטיהור של CXCR4 + לבטא בתאי endoderm לאחר בידול ניתן להשתמש כדי להעשיר אוכלוסיות אלה כדי להסיר תאי מגן מפני תהליך ההתמיינות.החלבון סמן DE המשטח CXCR4 יכול לשמש עבור הטיהור הספציפית של תאים האנדודרם. פרוטוקול טיהור MACS בהישג יד יכול להסתיים בתוך פחות מ 2 שעות וניתן להורג במתכונת גבי ספסל פשוט בכל מעבדה תרבית תאים ללא מכשירים וציוד מעבדה יקר. טיהור FACS היא טכניקה נפוצה אבל מעסיקה בתנאים קשים. במהלך FACS תאי purifications בדרך כלל נשמרים השעיה לתקופה ממושכת של זמן התאים כפופים גורמים אחרים אתגרים, למשל, בלחץ גבוה של הפייה של מכשיר FACS. לשם השוואה ההליך MACS הוא מהיר ועדין. זה משפר את יכולת התאים לצרף במהלך זריעה מחדש לאחר תהליך הטיהור. כדי להמשיך ולהקל שחיבור זה מעכב ROCK מתווסף התקשורת והתרבות לאחר ולפני הטיהור כדי למנוע אפופטוזיס. גורם חשוב נוסף המשפיע שחיבור הוא הצפיפות שבו תאי reseeded. זה depen בחוםDS על שורת תאים בשימוש. מספרי התא המשמש זריעה במחקר זה הם מספר נציג תא שפועלים היטב בידינו. עם זאת, ייתכנו צריך לשנות מספרים אלה עבור שורות תאים שונות. שני הצעדים, התוספת של מעכב ROCK ואת ההערכה של המספרים הסלולריים עבור זריעה מחודשת, הם קריטיים להצלחת תרבות תא הנוספת לאחר המיון. עם פרוטוקול בידול DE המשמש בדרך כלל&gt; 70% CXCR4 + תאים ניתן להשיג ללא מיון 8. המופע של הפרוטוקול המשמש לייצור DE consequentially משפיע על היעילות של פרוטוקול טיהור MACS שלאחר מכן. באופן כללי, בידול יעיל (&gt; 80% CXCR4 + תאים) מניב טוהר גבוה לאחר מיון MACS (עד 95%). לפיכך, השימוש של שיטת טיהור זה מפחית את מספר תאים שלא עברו התמיינות משמעותית אבל 100 טוהר% לא יכול להיות מושגת. בעתיד, סמני משטח ספציפיים שושלת ניתן להגדיר tכובע יאפשר טיהור של תאים מובחנים סופני יותר. הליך מיון MACS הוא בחירת הממשלה למטרה זו.

תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) יש את היכולת להתמיין כמעט כל סוג תא בגוף האדם. לפיכך, פרוטוקולים בידול במבחנה יכול לשמש כדי ליצור סוגי תאים בוגרים רבים כגון cardiomyocytes 1, hepatocytes 2, תאי בטא 3, ריאות אפיתל 4 או 5 תאים עצביים. זה עושה ESCs כלי רב ערך לטיפול הפוטנציאל של מחלות ניווניות שונות 3. בידול במבחנה של ESCs כלפי רקמות בוגרות של ריאות, כבד ולבלב דורש פסאודו gastrulation לתאים מזכיר את האנדודרם סופי (DE) 6. מאז בידול במורד כלפי סוגי תאים סומטיים הנ&quot;ל הוא משמעותי פחות יעיל, בידול האנדודרם אופטימלי נחשב הגבלת קצב 7. תאים מחויבים כלפי שושלת endoderm לעבור צ&#39;השינויי racteristic בפרופיל ביטוי הגנים שלהם. מאסטר pluripotency גנים הרגולטור למטה מוסדרים, ואילו הביטוי של גורמי שעתוק אחרים כגון FOXA2, SOX17, HNF1B, בני משפחת Gata ואת לקולטן CXCR4 הוא שהוגברו מאוד 6, 8, 9. CXCR4 ידוע להיות transactivated ידי SMAD2 / 3, במורד זרם של איתות קטרים ​​/ TGF-β ו SOX17 בשל אתרי קישור ספציפיים באזור האמרגן שלה 10. לכן הוא סמן מתאים מאוד בשימוש מספר הדיווחים 6, 8, 11-13. שינויי ביטוי אלה משקפים אירוע פסאודו gastrulation, שבו ESCs לרכוש הראשונה מאפיינים של אוכלוסיית תא פס דמוי פרימיטיבית ובהמשך להתחייב לתוך השכבה ניבטת endoderm 6. עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים כמו כמה תאים עשויים להתנגד לתהליך הבידול או להבדיל כלפי שושלות מכוונות אחרות 14. תאים אלה עשויים לרעה influeבידול נוסף NCE. יתר על כן, תאים שלא עברו התמיינות שיורית נמל סיכונים גדולים לניסויי השתלה מאוחר יותר עשוי להצמיח teratomas 15-17. כדי להסיר תאים לא רצויים אלה מוקדם על CXCR4 סמן המשטח יכול לשמש עבור טיהור של תאים מחויבים כלפי DE 18. כאן אנו מתארים שיטת הסלקציה החיובית של CXCR4 + תאים מתרבויות בידול DE. לשם כך, CXCR4 סמן המשטח מחויב נוגדן אשר בתורם נקשר microbeads המגנטי. בניגוד לתנאים הקשים במהלך מיון FACS, תאי DE הדמויים המתויגים מגנטי אז יכולים להיות מטוהרים בקלות בפורמט המעבדתיים באמצעות שיטת טיהור עדינה. פרוטוקול זה מספק שיטה פשוטה להסרת אוכלוסיות תאי המגן מפני תהליך התמיינות DE.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

יכולות ההתמיינות של תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) לאפשר יישום טיפולי פוטנציאל טיפולי התחדשות תאים. סופני סוגי תאים מובחנים יכול לשמש לטיפול במחלות ניווניות שונות. חוץ גופית התמיינות של תאים אלה כלפי רקמות של ריאות, כבד ולבלב דורש כצעד ראשון הדור של תאים endodermal מוחלטות. שלב זה הוא הגבלת קצב לבידול נוסף לקראת סוגי תאים התבגר סופני כגון תאי ביתא מייצרי אינסולין, hepatocytes או סוגי תאים אחרים הנגזרות האנדודרם. תאים מחויבים כלפי השושלת endoderm מאוד להביע שפע של גורמי שעתוק כגון FOXA2, SOX17, HNF1B, בני משפחת גאטה, ואת לקולטן CXCR4. עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים. כאן אנו מתארים שיטה לטיהור של אוכלוסיית תא CXCR4 + לאחר התמיינותאל DE באמצעות microbeads מגנטי. טיהור זה גם מסיר תאים של שושלות רצויות. שיטת הטיהור העדינה היא מהירה ואמינה ועשויה לשמש כדי לשפר יישומי differentiations במורד זרם.

עם בידול ESCs לעבור שינויים דרסטיים גנים ביטוי חלבון. איור 1 מתאר גנים סמן טיפוסי שניתן להשתמש בהם כדי לאמת בידול האנדודרם מוצלח. מטרות הממשלה עבור ניתוח ביטוי גנים הם GSC, FOXA2, ו SOX17. בניתוח ביטוי גנים ביחס במיוחד FOXA2 ו SOX17 הם עלו ב&gt; 2,000 לקפל בהשוואה ESCs מובחן. GSC כבר מתבטא מאוד מוקדם בתוך 24 שעות במהלך היווצרות פס פרימיטיבי אבל זה בכל זאת מושרה&gt; 100 לקפל ביום ארבע. הביטוי של גנים אלה וכתוצאה מכך הוא גדל על מיון באמצעות סמן משטח CXCR4 6. רגולטורים pluripotency כגון OCT3 / 4 (POU5F1) ו NANOG הם למטה מוסדר באופן משמעותי למרות ההתבטאות שלהם עדיין לזיהוי לאחר ארבעה ימים. אינדיקה זהtes שתאים מסוימים אינם מגיבים במידה מספקת כדי משטר הטיפול עם ביטוי גני SOX7 א CHIR-99,021 ו Activin בדרך כלל מופנה להפלות היווצרות endoderm חוץ עוברית נגד DE. במקרה הראשון SOX17 הוא הביע שיתוף עם SOX7 ובמקרה האחרון SOX17 הוא שיתוף הביע עם FOXA2. התוצאות באיור 1 מצביעות על כך יחד עם DE כמה תאי חוץ עובריים נוצרו במהלך התמיינות, למרות שאנחנו עדיין לא הצלחנו להכתים תאי SOX7 +. איור 2 מדגים את אוכלוסיות תאים השונות שנמצאות לאחר ההתמיינות של ESCs לתוך DE. בשלב 1 ESCs הם זורעים כמו תאים בודדים ולאחר מכן הנבדלים טיפול עם CHIR-99,021 ו Activin במשך ארבעה ימים. מכתים IF של DE סמנים SOX17 ו FOXA2 (איור 2 א) עולה כי שני סמנים הם אחיד שיתוף מביעיםד בתוך גרעיני. זה נחשב סימן היכר של מחויבות DE. עם זאת, תאים מסוימים להתנגד לתהליך הבידול ולהביע אף אחד החלבונים שני סמן DE (איור 2 א). למעשה, שתי אוכלוסיות תאים מובחנים הם נצפו לאחר בידול ארבעה ימים. בעוד תאים רבים מבטאים את FOXA2 סמן DE יש עדיין תאי נותרים המבטאים את Sox2 סמן pluripotency (איור 2 ב). חלבונים שני אלה באים לידי ביטוי בשתי אוכלוסיות נפרדות ואין שיתוף ביטוי ניתן לצפות (איור 2 ב). ביום שלושה או ארבעה הבדלה בין CXCR4 חלבון משטח משמש כדי למיין את האוכלוסייה DE-מחויב CXCR4 + ובכך להסיר את התאים pluripotent הנותרים השושלות לא רצויות אחרות. בהתאם יעיל הבידול של הקו הסלולרי משמש&gt; 80% CXCR4 + תאים ניתן להשיג באמצעות פרוטוקול הבידול מפורט שלב 1 8 </sup&gt;. השורה HES3 משמש כאן הניב 66% ± 3% תאים חיוביים CXCR4 לפני מיון ו -92% ± 4% לאחר מיון (n = 3). איור 3 מתאר cytometry זרימה נתונים לאחר מכתים וטיהור MACS של CXCR4 + תאים לאחר בידול כלפי DE ו מראה את הביטוי של חלבונים נפוצים DE סמן pluripotency באמצעות immunofluorescence (IF) מכתים לפני ואחרי טיהור MACS. ביום השלישי של בידול בערך 60% CXCR4 + תאים באמצעות מכתים immunofluorescence עבור CXCR4 המתואר בשלב 2 התקבלו (איור 3 א, פאנל באמצע). תאים CXCR4 + לעבור Q4 כדי Q1 על צביעה עם נוגדן אנטי CXCR4 מצומדות APC. לאחר טיהור MACS המתואר בשלב 3 האוכלוסייה CXCR4 + מועשר ל -85%. תהליך הטיהור, לעומת זאת, אינו פותר את כל השושלות הרצויות מן התרבויות (איור 3 א, פנל מימין). לאחר טיהור MACS,ניתן וזרע CXCR4 + התאים לניתוח נוסף או סיבוב שני אופציונאלי של מיון עשויה להתבצע להניב purities גבוהה אך כדאיות מופחתת. לפני בידול הביטוי רחב התפשט של Sox2 סמן pluripotency (מוכתם בירוק) הוא זוהה על ידי מכתים IF. לעומת זאת, FOXA2 סמן DE (מוכתם באדום) לא ניתן לאתר (איור 3B). באיור 3C CXCR4 + תאים מגואלות נוגדנים FOXA2 (ירוק) הם שיתוף מוכתם עבור Sox2 סמן pluripotency (אדום). לאחר זריעה של תאי CXCR4 + מטוהרים רק כמה Sox2 + תאים מזוהים. רוב תאי הזרע הם חיוביים עבור FOXA2 סמן DE. <img alt="איור 1" src="/files/ftp_upload/53655/53655fig1highres.jpg" width="700" /> איור 1. שינויים נציג בביטוי הגנים של גנים סמן pluripotency ו endoderm שונים במהלך בידול האנדודרם ארבעה ימים. (א) </איור strong&gt; של פרוטוקולים בשימוש לבידול endoderm ואחריו ניתוח ביטוי גנים. אקראי מציין לתנאים תרבות ללא כל גורמי גדילה, RP מציין אל בידול באמצעות פרוטוקול התייחסות 7, טיפול עם Activin לבד, and-A CA (CHIR-99,021 ו- A Activin) פרוטוקול, אשר משמש MACS מיון (ראה פירוט 8). התקשורת המשמשת את CA-פרוטוקול מכונית כאן כמדיום אינדוקצית פס פרימיטיווי ובינוני אינדוקציה האנדודרם. (ב) המתואר היא ביטוי הגנים נמדד על ידי RT-qPCR של GSC, SOX17 ו FOXA2, אשר באים לידי ביטוי על התחייבות האנדודרם סופית ללא MACS נוסף מיון. POU5F1 (OCT3 / 4) ו NANOG הם רגולטורי pluripotency ובדרך כלל למטה מוסדר על בידול, ואילו SOX7 מתבטא endoderm חוץ עוברי. את ביטוי הגנים היה מנורמל נגד שלושה גני משק לידי ביטוי ביציבות (&lt;em&gt; TBP, TUBA1A, G6PD) וכתוצאה מכך ערך CNRQ. הביטוי של הגנים הנ&quot;ל תאים שלא עברו התמיינות נקבע ל -1 ושינויים הם זממו כמו שינוי הקיפול של ביטוי גנים. ערכים הם אמצעי ± SEM, n = 4-5. ANOVA ובמבדקים פוסט הוק של Bonferroni. ** P ≤ 0.01 לעומת אקראיות #P ≤ 0.05, ## P ≤ 0.01 לעומת RP (כל הנתונים בתוך נתון זה פורסמו לאחרונה ב 8). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53655/53655fig1highres.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53655/53655fig2.jpg" /> איור 2. אוכלוסיות תאים שונות לאחר בידול האנדודרם. (א) מכתים של DE סמנים SOX17 ו FOXA2 עם נוגדנים המתאימים על D4 של בידול חושף שיתוף לוקליזציה הומוגנית שלהם. עם זאת, חלקתאים התנגדו תהליך הבידול אינם מבטאים סמנים אלה (גרעין כתמים כחולים בלבד). המיזוג של מכתים ירוק ואדום מוצג בצהוב. (ב) לאחר התמיינות DE יש שתי אוכלוסיות תאים נפרדים. DE דמויי תאים להביע FOXA2 ואילו תאי המגן מפני תהליך ההתמיינות עדיין לבטא את Sox2 סמן pluripotency. (AB) גרעינים היו counterstained עם DAPI (כחול). סרגל קנה מידה בלוח (א) הוא 50 מיקרומטר בלוח (B) הוא 100 מיקרומטר. הדמיה בוצעה ב- 670 ננומטר (אדום, Cy5), 520 ננומטר (ירוק, FITC) ו 433 ננומטר (כחול, DAPI), בהתאמה. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53655/53655fig2large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53655/53655fig3highres.jpg" width="700" /> איור 3. MACS המיון של אוכלוסיות תאים DE מבודל נציג staining לאחר מיון. (א) CXCR4 + תאים מוכתמים (Q1) מועשרים לאחר MACS מיון. מספר תאי CXCR4- (Q4) הוא ירד. בהתאם לקו התא בשימוש התשואות פרוטוקול בידול&gt; 80% תאים חיוביים CXCR4 8 ו MACS ניתן להשתמש כדי להעשיר אותם עוד יותר. (ב) תאים שלא עברו התמיינות לבטא את Sox2 סמן pluripotency (ירוק), אך לא את FOXA2 סמן DE (אדום ). (ג) לאחר MACS המיון להישאר (אדום), ואילו אוכלוסיית מיון Sox2 + תאים מעט מאוד מובחן רק כמעט אחיד מבטא את FOXA2 סמן DE (ירוק). (בי סי) גרעינים היו counterstained עם DAPI (כחול). סרגל קנה מידה בלוח (C) הוא 100 מיקרומטר והוא חל על כל הלוחות. הדמיה בוצעה ב- 670 ננומטר (אדום, Cy5), 520 ננומטר (ירוק, FITC) ו 433 ננומטר (כחול, DAPI), בהתאמה. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53655/53655fig3highres.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

כאן אנו מתארים שיטה לטיהור של תאי גזע עובריים אנושיים הבדילו כי מחויב כלפי האנדודרם הסופי לשיפור יישומים במורד בידול נוסף.

שיטה מהירה ויעילה עבור טיהור של תאים האנדודרם המופקים מתאי גזע עובריים אנושיים

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

8.3K Views.  Hannover Medical School.  כאן אנו מתארים שיטה לטיהור של תאי גזע עובריים אנושיים הבדילו כי מחויב כלפי האנדודרם הסופי לשיפור יישומים במורד בידול נוסף. 

Video: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

בידוד של תאי אנדותל אדם נורמלי המעי הגס, סרטן המעי הגס - פרוטוקול משופר

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Cancer Research

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

גזירת בתאי גזע עובריים אנושיים על ידי Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Biology

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

גזירת יעיל של אבות עצב נוירונים האדם מן האדם תאים pluripotent גזע עובריים עם אינדוקציה מולקולה קטנה

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Neuroscience

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

לבידוד של תאי סטרומה רירית הרחם אדם במבחנה Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

דור של אפיתל דרכי נשימת עכבר נגזרות ESC תאי שימוש decellularized פיגומי ריאות

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Bioengineering

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

הדור יציבה של hepatocyte דמויי תאים של אדם אוכלוסיות תאים גזע עובריים

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

הסרת פיברובלסטים מהירה מתרבויות צפיפות גבוהות אדם תאי גזע עובריות

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

בידוד של תאי האנדותל חדרית עובריים

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

השוואת מטריצה לייצור יעיל של אורגנואידים במעיים אנושיים מתאי גזע פלוריפוטנטיים מושרים

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

מחבר זרקור: קידום ייצור אורגנואידים לפיתוח תרופות באמצעות iPSCs

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

מחקר השוואתי של מטריצות קרום מרתף לתחזוקת תאי גזע אנושיים ויצירת אורגנואידים במעי

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

שיטה מהירה ויעילה עבור טיהור של תאים האנדודרם המופקים מתאי גזע עובריים אנושיים

Summary

Explore More Videos

Chapters in this video

בידוד של תאי אנדותל אדם נורמלי המעי הגס, סרטן המעי הגס - פרוטוקול משופר

גזירת בתאי גזע עובריים אנושיים על ידי Immunosurgery

גזירת יעיל של אבות עצב נוירונים האדם מן האדם תאים pluripotent גזע עובריים עם אינדוקציה מולקולה קטנה

לבידוד של תאי סטרומה רירית הרחם אדם במבחנה Decidualization

דור של אפיתל דרכי נשימת עכבר נגזרות ESC תאי שימוש decellularized פיגומי ריאות

הדור יציבה של hepatocyte דמויי תאים של אדם אוכלוסיות תאים גזע עובריים

הסרת פיברובלסטים מהירה מתרבויות צפיפות גבוהות אדם תאי גזע עובריות

בידוד של תאי האנדותל חדרית עובריים

מחקר השוואתי של מטריצות קרום מרתף לתחזוקת תאי גזע אנושיים ויצירת אורגנואידים במעי

מחקר השוואתי של מטריצות קרום מרתף לתחזוקת תאי גזע אנושיים ויצירת אורגנואידים במעי