Name: quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation
Uploaded: 2014-11-26T14:00:00.000+00:00
Duration: 12 min 42 s
Description: Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

We thank Hongjae Sunwoo for helpful advice for oligonucleotide design in RNA FISH. We also thank Serenity Curtis for editing the manuscript. N.Y. was supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science (JSPS). This work was supported by the NIH (RO1-GM102184), the March of Dimes Research Foundation (#6-FY12-337), and the Developmental Fund and Trustee Grant at Cincinnati Children's Hospital Medical Center to Y.O.

1. בדיקה הכנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להשיג oligonucleotides מרובה הייחודי בXist (oligonucleotides 20-30 נוקלאוטיד באורך, טמפרטורת 63-65 מעלות צלזיוס היתוך, טבלת 1) עם שינוי 5&#39;-אמינו ולהשעות במים. </li><li style=";text-align:right;direction:rtl"> כמויות בריכת equimolar של oligonucleotides עם 5&#39;-אמינו שינוי (סה&quot;כ 4.5 מיקרוגרם) ותווית עם צבע פלואורסצנטי אמין-reactive הבא הוראות היצרן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ממיסים את oligonucleotides נקווה ב5 μl הסופי של מים nuclease חינם ולהוסיף 3 μl של סודיום ביקרבונט 1 M לפתרון oligonucleotide. </li><li style=";text-align:right;direction:rtl"> הוספת DMSO 2 μl לבקבוקון של צבע אמין-reactive ובקצרה מערבולת. </li><li style=";text-align:right;direction:rtl"> מערבבים את פתרון oligonucleotide עם צבע תגובתי בDMSO דגירה את התערובת בטמפרטורת חדר למשך שעה 1 בחושך. </li></ol></li><li style=";text-align:right;direction:rtl"> לטהר את בדיקות oligonucleotide שכותרתו fluorescently על ידי עמודת G-25 ואחריו משקעים אתנול. <ol style=";text-align:right;direction:rtl"><li&gt; טור צנטריפוגה G-25 ב 750 XG עבור 1 דקות כדי להסיר חיץ אחסון עודף. </li><li style=";text-align:right;direction:rtl"> מוסיף מים nuclease ללא 40 μl לתערובת התיוג מיוצרת בשלב 1.2.3 ואחול על עמודת G-25. צנטריפוגה ב 750 XG למשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> הוסף 50 מים μl nuclease ללא, 10 נתרן אצטט μl 3 M (pH 5.2) ו -250 אתנול μl לבדיקה המטוהרת מהשלב 1.3.2. חנות ב -80 מעלות צלזיוס למשך 30 דקות ו צנטריפוגות ב 21,000 XG במשך 15 דקות על 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> שטוף את oligonucleotides זירז פעם אחת עם 1 מיליליטר של אתנול 70%. </li><li style=";text-align:right;direction:rtl"> להשעות מחדש ב -50 μl nuclease ללא מים או TE (10 מ&quot;מ טריס-HCl, pH 7.5, 1 mM EDTA) לריכוז סופי של כ -10 מיקרומטר. </li></ol></li><li style=";text-align:right;direction:rtl"> לדלל את בדיקות oligonucleotide שכותרתו fluorescently לריכוז סופי של nM 250 עם חיץ הכלאה (פוראמיד 10%; 2x SSC [300 מ&quot;מ NaCl; ציטראט 30 מ&quot;מ נתרן]; 2 מ&quot;ג / מיליליטר BSA, 10% סולפט dextran). הערה: עם פרוטוקול FISH זה מהר, p oligonucleotideגלימות בXist תוכננו והשתמשו בריכוז גבוה מפרוטוקול FISH הרגיל באמצעות בדיקות oligonucleotide כדי לקצר את זמן הדגירה של הכלאה. </li></ol> 2. החלק הכנה הערה: ניתן להכין שקופיות לאימונו-FISH באמצעות עכבר גזע עוברי (ES) או גוף embryoid (EB) הבחנה תאים 20, 21 או על ידי גידולם ישירות בשקופית שטופל פולי-ליזין או באמצעות cytospin עם השעיה תא. כאן, הכנת שקופיות על ידי cytospin מוצגת. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשאוב את מדיום התרבות בצלחת 6 באר. לשטוף עם PBS (בטמפרטורת חדר), ולשאוב ביסודיות. </li><li style=";text-align:right;direction:rtl"> הוסף 0.5 מיליליטר של טריפסין לצלחת 6-גם, דגירה למשך 5-10 דקות ב 37 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> הוסף 5 מיליליטר של מדיום ולפזר תאים על ידי pipetting בעדינות מעלה ומטה מספר פעמים. </li><li style=";text-align:right;direction:rtl"> העבר את התאים לצינור 15 מיליליטר, צנטריפוגות במשך 5 דקות ב XG 200 בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> מחק את המדיוםד בעדינות להשעות את התאים 2 מיליליטר PBS. </li><li style=";text-align:right;direction:rtl"> ספירת תאים באמצעות hemocytometer, ולדלל השעיה תא ב 4 x 10 5 תאים / מיליליטר ידי PBS. </li><li style=";text-align:right;direction:rtl"> להרכיב שקופיות, כרטיס מסנן וקאמרי עם קליפ ולהכניס אותם לתוך החריצים המתאימים ברוטור של cytospin. הוסף 250 μl של כל דגימה מוכנה בשלב 2.6 לכל תא של היחידות שהתכנסו בcytospin. צנטריפוגה ב 1500 סל&quot;ד במשך 10 דקות בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> מלאו 3 צנצנות coplin על קרח עם 40 מיליליטר כל אחד מחיץ PBS, CSK קר כקרח (10 צינורות מ&quot;מ, pH 6.8; 100 מ&quot;מ NaCl; 300 סוכרוז מ&quot;מ; 3 מ&quot;מ MgCl 2), וחיץ CSKT (חיץ CSK עם 0.5% Triton X-100), בהתאמה. </li><li style=";text-align:right;direction:rtl"> לאחר cytospin הוא סיים, להעביר במהירות את השקופית לתוך PBS קר כקרח ודגירה של 5 דקות. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית למאגר CSK קר כקרח ודגירת דקות 1. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית למאגר CSKT קר כקרח ודגירה של 5 דקות. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית בחזרה לbuf CSK קר כקרחFER דגירה דקות 1. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית לתוך paraformaldehyde 4% ב- ​​PBS ודגירה של 10 דקות בטמפרטורת חדר. </li></ol> 3. Immunofluorescence <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניחים את השקופיות בצנצנת coplin עם PBST (1x PBS עם Tween-20 0.1%) לכמה שניות. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות בשיפוע המאפשר נותר חיץ לזרום במורד המגלשה. לנגב בזהירות נוזל עודף מהשקופיות ולמקם אותו בתיבת pipet-קצה ריק עם מים. כיסוי השקופית עם 40 μl של פתרון חסימה (1x PBS, BSA 1%, 20-Tween 0.1%), מניח בעדינות coverslip, ודגירה של 10 דקות בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> הסר את coverslip, להסיר את פתרון החסימה, ולהוסיף 40 μl של הנוגדן הראשוני היסטון H3K27me3 המדולל לריכוז של 1: 500 בחסימת פתרון. מניחים את coverslip חזרה על שקופיות דגירה במשך 30 דקות בטמפרטורת חדר. הערה: מעכב RNase בפתרון החסימה עשויה להיות מועילה כדי לשמר RNA בRNA FIS זהפרוטוקול H כאשר נוגדני polyclonal משמשים. </li><li style=";text-align:right;direction:rtl"> לשטוף להחליק 2 פעמים בצנצנות coplin מלאות PBST, במשך 5 דקות כל אחד, בעדינות רועדת בזמן הכביסה. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות בשיפוע המאפשר נותר חיץ לזרום במורד המגלשה. לנגב בזהירות נוזל עודף ובמקום להחליק בחזרה לתוך תיבת הקצה. שכבה עם 40 μl של הנוגדנים משני (1: 500) מדוללים בחסימת פתרון, במקום coverslip, ודגירה במשך 15 דקות בחושך. לשלבים הבאים, לשמור על השקופיות בחושך בכל העת. </li><li style=";text-align:right;direction:rtl"> לשטוף 2 פעמים בCoplin צנצנות עם PBST כמו בשלב 3.4. </li></ol> FISH RNA 4. עם oligonucleotide בדיקות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> טרום חם תיבת pipet-קצה ריק עם מים בתחתית כדי למנוע שקופיות מהתייבשות על 37 מעלות צלזיוס במשך FISH RNA בשלב 4.3. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות בשיפוע המאפשר נותר חיץ לזרום במורד המגלשה. לנגב בזהירות את נוזל עודף השקופיות מצעד 3.6 ובמקום להחליק לתוך תיבת pipet-הקצה עם ואטאה בתחתית. הוסף 500 μl של חיץ לשטוף FISH (פוראמיד 10% ב2x SSC) בשקופית ודגירה של 5 דקות בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> הסר פתרון לשטוף FISH, להוסיף 8 μl של בדיקות oligonucleotide לשקופית, במקום להחליק כיסוי, ולהעביר את השקופיות לתיבת pipet-טיפ מראש חימם עם מים בתחתית; לדגור על 37 מעלות צלזיוס במשך 1-2 שעות. </li><li style=";text-align:right;direction:rtl"> מניחים 3 צנצנות coplin מראש חימם באמבט מים ב 37 ° C עם חיץ לשטוף FISH, חיץ לשטוף FISH עם DAPI, ו2x SSC. </li><li style=";text-align:right;direction:rtl"> לאחר הדגירה שעה 1-2 לRNA FISH, לשים את השקופיות לחיץ לשטוף FISH מראש חימם. </li><li style=";text-align:right;direction:rtl"> דגירה השקופיות במשך כמה דקות עד coverslip נופל של השקופית. </li><li style=";text-align:right;direction:rtl"> מניחים את השקף חזרה לחיץ לשטוף, ולהמשיך דגירה במשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית לצנצנת coplin אחרת עם חיץ לשטוף FISH מראש חימם עם 0.5 ng / ml DAPI ודגירה של 5 דקות. </li><li style=";text-align:right;direction:rtl"> העבר את השקופית לצנצנת coplin אחרת עם מראש חימם 2x SSC ודגירה של 5 ק&quot;מn. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות בשיפוע המאפשר נותר חיץ לזרום במורד המגלשה. לנגב בזהירות נוזל עודף ובמקום להחליק בחזרה לתוך תיבת קצה יבשה. הוסף 4 μl של antifade עם DAPI לשקופית ומניח coverslip. </li><li style=";text-align:right;direction:rtl"> לאטום את coverslip עם לק ולהתבונן תחת מיקרוסקופ. השקופית יכולה להיות מאוחסן על 4 מעלות צלזיוס בחושך במשך כמה חודשים. </li></ol>

<ol>
	<li>Payer, B., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+chromosome+dosage+compensation:+how+mammals+keep+the+balance.">X chromosome dosage compensation: how mammals keep the balance.</a> Annu Rev Genet. 42, 733-772 (2008).</li><li>Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gracefully+ageing+at+50,+X-chromosome+inactivation+becomes+a+paradigm+for+RNA+and+chromatin+control.">Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control.</a> Nat Rev Mol Cell Biol. 12, 815-826 (2011).</li><li>Gendrel, A. V., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fifty+years+of+X-inactivation+research.">Fifty years of X-inactivation research.</a> Development. 138, 5049-5055 (2011).</li><li>Froberg, J. E., Yang, L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guided+by+RNAs:+X-inactivation+as+a+model+for+lncRNA+function.">Guided by RNAs: X-inactivation as a model for lncRNA function.</a> J Mol Biol. 425, 3698-3706 (2013).</li><li>Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+Xist+in+X+chromosome+inactivation.">Requirement for Xist in X chromosome inactivation.</a> Nature. 379, 131-137 (1996).</li><li>Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xist-deficient+mice+are+defective+in+dosage+compensation+but+not+spermatogenesis.">Xist-deficient mice are defective in dosage compensation but not spermatogenesis.</a> Genes Dev. 11, 156-166 (1997).</li><li>Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XIST+RNA+paints+the+inactive+X+chromosome+at+interphase:+evidence+for+a+novel+RNA+involved+in+nuclear/chromosome+structure.">XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure.</a> J Cell Biol. 132, 259-275 (1996).</li><li>Sado, T., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+chromosome+silencing+by+the+long+non-coding+RNA.">Advances in understanding chromosome silencing by the long non-coding RNA.</a> Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322, 750-756 (2008).</li><li>Plath, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+histone+H3+lysine+27+methylation+in+X+inactivation.">Role of histone H3 lysine 27 methylation in X inactivation.</a> Science. 300, 131-135 (2003).</li><li>Silva, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+histone+h3+methylation+on+the+inactive+X+chromosome+requires+transient+recruitment+of+Eed-Enx1+polycomb+group+complexes.">Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes.</a> Dev Cell. 4, 481-495 (2003).</li><li>Gall, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+synthesis+of+the+genes+for+ribosomal+RNA+during+amphibian+oogenesis.">Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis.</a> Proc Natl Acad Sci U S A. 60, 553-560 (1968).</li><li>Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+single+RNA+transcripts+in+situ.">Visualization of single RNA transcripts in situ.</a> Science. 280, 585-590 (1998).</li><li>Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat Methods. 5, 877-879 (2008).</li><li>Chaumeil, J., Augui, S., Chow, J. C., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+immunofluorescence,+RNA+fluorescent+in+situ+hybridization,+and+DNA+fluorescent+in+situ+hybridization+to+study+chromatin+changes,+transcriptional+activity,+nuclear+organization,+and+X-chromosome+inactivation.">Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation.</a> Methods Mol Biol. 463, 297-308 (2008).</li><li>Katayama, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+transcription+in+the+mammalian+transcriptome.">Antisense transcription in the mammalian transcriptome.</a> Science. 309, 1564-1566 (2005).</li><li>Ogawa, Y., Xite Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-inactivation+intergenic+transcription+elements+that+regulate+the+probability+of+choice.">X-inactivation intergenic transcription elements that regulate the probability of choice.</a> Mol Cell. 11, 731-743 (2003).</li><li>Panning, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+inactivation+in+mouse+ES+cells:+histone+modifications+and+FISH.">X inactivation in mouse ES cells: histone modifications and FISH.</a> Methods Enzymol. 376, 419-428 (2004).</li><li>Khalil, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+human+large+intergenic+noncoding+RNAs+associate+with+chromatin-modifying+complexes+and+affect+gene+expression.">Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression.</a> Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).</li><li>Martin, G. R., Evans, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+clonal+lines+of+teratocarcinoma+cells:+formation+of+embryoid+bodies+in+vitro.">Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro.</a> Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).</li><li>Lee, J. T., Lu, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+of+Tsix+leads+to+nonrandom+X+inactivation.">Targeted mutagenesis of Tsix leads to nonrandom X inactivation.</a> Cell. 99, 47-57 (1999).</li><li>Zhang, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomeric+RNAs+mark+sex+chromosomes+in+stem+cells.">Telomeric RNAs mark sex chromosomes in stem cells.</a> Genetics. 182, 685-698 (2009).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472, 365-386 (2010).</li><li>Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+organization+of+histone+H3+modifications+as+revealed+by+a+panel+of+specific+monoclonal+antibodies.">The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies.</a> Cell Struct Funct. 33, 61-73 (2008).</li><li>Ogawa, Y., Sun, B. K., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intersection+of+the+RNA+interference+and+X-inactivation+pathways.">Intersection of the RNA interference and X-inactivation pathways.</a> Science. 320, 1336-1341 (2008).</li><li>Kohlmaier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chromosomal+memory+triggered+by+Xist+regulates+histone+methylation+in+X+inactivation.">A chromosomal memory triggered by Xist regulates histone methylation in X inactivation.</a> PLoS Biol. 2, 171 (2004).</li><li>Wang, K. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+long+noncoding+RNAs.">Molecular mechanisms of long noncoding RNAs.</a> Mol Cell. 43, 904-914 (2011).</li></ol>

No conflicts of interest declared.

במאמר זה, שהצגנו פרוטוקול חיסוני FISH מהיר שלוקח פחות מ 5 שעות כדי להשלים הכנת שקופיות, Xist RNA FISH, וimmunofluorescence לH3K27me3. בהשוואה לגישה חיסונית FISH הכללי לXist RNA זיהוי, אשר בדרך כלל צריך דגירה הלילה לRNA FISH, פרוטוקול זה לא רק מפחית באופן משמעותי את משך זמן, אלא גם משפר את הרגישות של חיסון-FISH באמצעות בדיקות oligonucleotide. מאז Xist הוא עיבד מאוד במהלך איון כרומוזום X והתמליל שלה נמצא לצבור עוצמה על Xi בחבר עמים, זה קל לזהות Xist RNA אות בהבחנה ותאים מובחנים על ידי RNA FISH ניצול זמן דגירה קצר יחסית. הפרוטוקול חיסוני הדג הזה יכול להיות מיושם על חלבונים אחרים בעלי עניין וRNA בשפע, אם כי ייתכן שתהיה צורך באופטימיזציה immunofluorescence וRNA FISH. על מנת ליישם את הפרוטוקול לRNA האחר, numבער של בדיקות oligonucleotide אפשריות היה צריך להילקח בחשבון, ואחריו אופטימיזציה של ניסוי וטעייה של הריכוז של החללית, זמן דגירה, וטמפרטורה לRNA FISH. אחת דוגמאות ליישומים אחרים היא ההצלחה הקודמת שלנו באיתור RNA telomeric באמצעות בדיקות LNA אחת 22. לעיצוב בדיקה והכנה לגילוי מטרות RNA שפע נמוכים, עיינו במאמר של ראג ​​&#39;וTyagi 23. נושא נוסף שיש לקחת בחשבון הוא צעד permeabilization. יש צורך בשיקול דעת זהירה לגבי מצב permeabilization שונה; לדוגמא, השפעות מתונות יותר ממה שמתואר בפרוטוקול שלנו יכולות להתרחש עם permeabilization לאחר קיבוע 15. נהלי permeabilization שונים גם צריכים להילקח בחשבון בעת ​​ביצוע חיסוני FISH באמצעות תאים מסוגים שונים. סדר immunofluorescence וRNA FISH עשוי להשפיע גם על זיהוי של חלבוני יעד, שינויים, ו- RNA על ידי חיסוני FISH. אם FISH RNA הוא לבצעed לפני immunofluorescence, דגירה שעה אחת במגזר FISH RNA הוא מספיק כדי לזהות Xist RNA אות. עם זאת, מאז פוראמיד הכלול במאגר ההכלאה ולשטוף חיץ FISH משפיע לרעה על immunofluorescence H3K27me3, אנחנו תמיד לבצע immunofluorescence H3K27me3 לפני Xist RNA FISH בפרוטוקול זה. עבור יישומים אחרים, בסדר הגודל של הליכים יהיו תלויה בחלבוני היעד ושינויים אפיגנטיים להיות שנצפה על ידי immunofluorescence. כנוגדן הראשוני שמשמשים לimmunofluorescence H3K27me3 יש כייל גבוה וספציפיות ל -24 H3K27me3, אנו יכולים להשתמש בזמן דגירה קצר יותר עבור immunofluorescence. עם זאת, זמן תגובה וטמפרטורה לimmunostaining תלוי בנוגדן המשמש ובכך יש צורך באופטימיזציה עבור כל נוגדן. באמצעות בדיקות oligonucleotide, זיהוי RNA Xist על ידי RNA FISH השתפר באופן משמעותי. במחקרים הקודמים שלנו, מצאנו כי תת-קבוצה של DIFתאי ferentiating עם כתמי H3K27me3 על Xi אינם קשורים לאות Xist RNA 25. מאז שינוי H3K27me3 על Xi קשור גיוס PRC2 ידי Xist RNA 9-11, 26, שהערכנו כי זו נבעה מהחדירה יעילה של riboprobes לגרעינים בהשוואה לנוגדן לimmunofluorescence. באמצעות בדיקות oligonucleotide בפרוטוקול זה, שמה לב שאות H3K27me3 בהבחנת תאים נשיים כמעט תמיד שיתוף מקומי עם Xist RNA (איור 1). פרוטוקול חיסוני FISH מהיר זו מאפשר לנו להשיג תמונת מצב של השינויים הדינמיים המסתובבים סביב Xist lncRNA ומציע כלי חדש כדי לעזור להשיג הבנה טובה יותר של הדרך lncRNA עובדת. IncRNAs משפיע על תפקוד תאי שונים כגון הטבעה גנומית, ויסות הגנים, תרגום RNA, והתבגרות RNA 27. פיתוח הבנה מוגברת של התפקיד המגווןמנוגן על ידי lncRNA יעזרו להניע את השדה קדימה ולאפשר לתגליות עתידיות ברגולציה של תהליכים תאיים חיוניים בגוף האדם, כמו גם לתרום לפיתוח של מטרות פוטנציאליות לטיפול במחלה. מאז פרוטוקול זה יכול להיות מותאם בקלות ביחס לסמנים וlncRNAs עניין אחרים, זה הוא כלי נהדר כדי לעזור להתמודד עם המסתורין של lncRNAs השונים בתאים.

איון כרומוזום X יונקים (xci) הוא אסטרטגיה כדי לפצות על חוסר האיזון במינון גן צמוד X בין XX וXY, שבו אחד משני כרומוזומי X-בנקבות הוא תעתיק 1 מומת. איון כרומוזום X הוא מערכת מודל נהדרת עבור RNA קידוד שאינו ארוך מחקר (lncRNA). איון כרומוזום X מוסדר על ידי lncRNAs מרובה, ונחקר בהרחבה בעשרות השנים האחרונות לחשוף את מנגנוני crosstalk בין lncRNAs, שעתוק, מבנה הכרומטין וארגון גרעיני 2, 3. מרכז איון X (XIC) הממוקם על כרומוזום X הוא מוקד גנטי מורכב מורכב ממספר גני ייצור RNAs ללא קידוד 4. X-פעיל תמליל ספציפי (Xist) lncRNA ביונקי eutherian הוא lncRNA אחד כזה אשר ממלא תפקיד מכריע באיון כרומוזום X 5,6. תמלילי Xist מקיפים את מיקומו של פוture Xi ליזום איון כרומוזום X, ומופיע כענן כאשר דמיינו באמצעות RNA FISH; מערך זה נקרא &quot;Xist הענן&quot; 7. מאז Xist RNA אינטראקציה עם אנזימי שינוי הכרומטין שונים, שיתוף לוקליזציה של ענני Xist עם שינויים אפיגנטיים שונים להכרומטין השקט ושעתוק דיכוי הוא ציין במהלך איון כרומוזום X 8. לדוגמא, Xist RNA אינטראקציה עם מורכב Polycomb מדכא 2 (PRC2) האחראית על H3K27me3 וגורם למצב הכרומטין דיכוי 9. המופע של ענן Xist על Xi ושיתוף הלוקליזציה שלה עם שינוי H3K27me3 האינטנסיבי מייצג נוף heterochromatin פקולטטיביים של Xi 10,11. טכניקות ציטוגנטית, כגון DNA / RNA FISH יש כברת דרך מהשיטה המסורתית באמצעות בדיקות radiolabelled 12 לטכניקות האחרונות ומתקדמות ברגישות ובמשופרותהדמיה ניאון באמצעות בדיקות oligonucleotide מרובות 13,14. FISH DNA / RNA בשילוב עם immunofluorescence נעשה שימוש באופן שגרתי ככלי ציטולוגית להבין ארגון spatiotemporal גרעיני, לוקליזציה RNA, מבנה הכרומטין ושינויים. הכנת הבדיקה סטנדרטית ביותר עבור RNA FISH כרוך בשימוש בפלסמיד או כרומוזום מלאכותי שיבוטים חיידקים (BAC) והתיוג הבא שלהם או עם תרגום לכינוי או לתחולו אקראי 15. עם זאת, כמעט 70% מהגנים בעכברים ו -40% מהגנים בבני האדם להראות חפיפה של תמלילי תחושה וantisense 16, ומכאן צורך בשיטת FISH גדיל הספציפי כדי להבדיל תמלילי תחושה וantisense. במבחנה בדיקות RNA עיבד (riboprobe ) משמש לעתים קרובות לFISH גדיל RNA ספציפי 17,18; עם זאת, מדובר בהכנת שיבוט פלסמיד או מוצר PCR עם T7, SP6, או אמרגן T3 וriboprobes סינתזה. יתר על כן, Riboprobes נגזר מgenomic DNA או cDNA לעתים קרובות מכיל אזורים שאינם ספציפיים ואלמנטים חוזרים, אשר יביאו לרעש רקע גבוה. בעיה נוספת היא שriboprobes, שהם כמה מאה נוקלאוטידים באורך ומכיל fluorophores מרובה, לא יכולה לחדור ביעילות לתוך הגרעין. כדי לעקוף את זה, בדיקות oligonucleotide קצרות מרובות שכותרתו עם fluorophore אחד בסוף פותחו שיש לי רגישות טובה, עוצמת אות אחידה, וקלות לניקוי וטיפול 14. בנוסף, oligonucleotides DNA הוא בדרך כלל יציב יותר מRNA. אנחנו מוחלים אסטרטגיה דומה של שימוש בoligonucleotides Xist RNA FISH 19 עם immunofluorescence להבין את הדינמיקה אפיגנטיים של Xi הנגרמת על ידי Xist lncRNA במהלך התהליך של איון כרומוזום X. פרוטוקול זה מתאר את הקמתה של בדיקות oligonucleotide והכנה נכונה של תאים, כמו גם ניצול של immunofluorescence וRNA FISH. Xist RNA FISH באמצעות oligonucle מרובהotides היא גישה יעילה עלות בטווח הארוך אם Xist RNA FISH מבוצע באופן שוטף במעבדתו של אחד. טכניקה זו יכולה לשמש כדי לזהות lncRNAs בתאים תוך מיפוי שיתוף הלוקליזציה שלה עם שינויים או גורמים אפיגנטיים בו-זמנית. אחד יתרונות עיקריים של הפרוטוקול הוא היכולת לשנות אותו בקלות כדי להתאים תחומי המחקר של אחד.

<table><tbody><tr><td>oligonucleotides with 5&amp;rsquo;-amino modification</td><td>IDT</td><td></td><td></td></tr><tr><td>Alexa Fluor 488 Reactive Dye</td><td>Life Technologies</td><td>A32750</td><td></td></tr><tr><td>MicroSpin G-25 columns</td><td>GE Healthcare</td><td>27-5325-01</td><td></td></tr><tr><td>Cytospin 2</td><td>Shandon</td><td>59900102</td><td></td></tr><tr><td>Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer)</td><td>Roche</td><td>10715859103</td><td></td></tr><tr><td>Histone H3K27me3 antibody</td><td>Active Motif</td><td>61017</td><td></td></tr><tr><td>Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed</td><td>Life Technologies</td><td>A21424</td><td></td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36931</td><td></td></tr></tbody></table>

quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation

שילוב ניאון RNA הכלאה באתר (דגים) עם immunofluorescence (חיסוני דגים) יוצר בטכניקה שיכולה להיות מועסק ברמת התא הבודד כדי לזהות את הדינמיקה המרחבית של לוקליזציה RNA עם תובנה סימולטני ללוקליזציה של חלבונים, שינויים אפיגנטיים ופרטים נוספים אשר יכול להיות מודגש על ידי immunofluorescence. איון כרומוזום X הוא פרדיגמה להשתקת גנים ארוכה RNA קידוד שאינו (lncRNA) בתיווך. הצטברות X-פעיל תמליל ספציפי (Xist) lncRNA (נקראת Xist ענן) באחת משני כרומוזומים X-בנקבות יונקים היא שלב קריטי ליזום איון כרומוזום X. RNA Xist במישרין או בעקיפין אינטראקציה עם אנזימי שינוי הכרומטין שונים ומציג נופים אפיגנטיים ברורים לכרומוזום X פעיל (Xi). סימן היכר ידוע אפיגנטיים אחד Xi הוא trimethyl ליזין היסטון H3 27 שינוי (H3K27me3). כאן אנו מתארים חיסוני FISH פשוט ומהירפרוטוקול לאיתור Xist RNA באמצעות RNA FISH עם בדיקות oligonucleotide מרובות בשילוב עם immunofluorescence של H3K27me3 לבחון את הלוקליזציה של Xist RNA ושינויים אפיגנטיים הקשורים. שימוש בתוצאות בדיקות oligonucleotide בזמן דגירה קצר יותר וגילוי רגיש יותר של Xist RNA בהשוואה לבדיקות RNA במבחנה עיבד (riboprobes). פרוטוקול זה מספק כלי רב עוצמה להבנת הדינמיקה של lncRNAs והשינוי אפיגנטיים הקשורים אליו, מבנה הכרומטין, ארגון גרעיני ורגולצית תעתיק.

נציג תמונות של חיסוני FISH מהיר מוצגות באיור 1 א. שיתוף לוקליזציה של אות הענן וH3K27me3 Xist RNA על Xi התגלתה בהבחנת תאים נקביים. ביום 12 על בידול, יותר מ -90% מתאי EB היו ענן Xist (איור 1). בדיקות oligonucleotide הקצר חדרו יעילות לתוך הגרעינים, שמובילות להדמיה של כמעט כל אותות H3K27me3 שיתוף מקומי עם Xist RNA (איור 1 ג; 97%, n = 150). <img alt="איור 1" src="/files/ftp_upload/52053/52053fig1highres.jpg" /> איור 1: RNA Xist וH3K27me3 שיתוף למקם על Xi בהבחנת העכבר EB () החיסוני-FISH לXist RNA עם שינוי H3K27me3 בהבחנת תאי EB נקבה ביום 12 על בידול.. בדיקות Xist תויגו עם אלקסה פלואוריד 488, ואנטי-H3K27me3 נוגדן ראשוני היה דהtected על ידי נוגדנים משני 555 מצומדות- אנטי עכבר IgG אלקסה פלואוריד. גרעינים היו counterstained עם DAPI. האזור התאגרף מוגדל בלוחות התחתון. ברים בקנה מידה:... 10 מיקרומטר (B) תדר של תאי cloud- וH3K27me3 החיוביים Xist בEB ביום 12 על בידול (C) תדר של שיתוף לוקליזציה של ענן Xist עם אות H3K27me3 בEB ביום 12 על בידול <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52053/52053fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table style=";text-align:right;direction:rtl"><tbody><tr><td> Xp1 </td><td> ggtaagtatccaaaaccccgttgg </td></tr><tr><td> XP2 </td><td> cgatcagcagcaacagtacacg </td></tr><tr><td> XP3 </td><td> gcaattggttgcttttatccagtcc </td></tr><tr><td> Xp4 </td><td> cgcaacaccgcacactaatacg </td></tr><tr><td> Xp5 </td><td> gccatcttagacacattcaagagcat </td></tr><tr><td> XP6 </td><td> cacacgtgaagtaccaagcgaaac </td></tr><tr><td> Xp7 </td><td> gccacgtatagagcactgtaagagactatg </td></tr><tr><td> Xp8 </td><td> caaagcacactatcagacgtgtcg </td></tr><tr><td> Xp9 </td><td> ggagaatctagatgccataaaggcaag </td></tr><tr><td> XP10 </td><td> tgatggacactgcattttagcactg </td></tr><tr><td> Xp11 </td><td> ggacactgcattttagcaatacgattc </td></tr><tr><td> Xp12 </td><td> gtgatgggcactgcattttagc </td></tr><tr><td> Xp13 </td><td> agatgggctatctcagtcttataggct </td></tr><tr><td> Xp14 </td><td> ggaagtcagtatggagggggtatg </td></tr><tr><td> Xp15 </td><td> tgggactgtgactactacagcaatga </td></tr><tr><td> Xp16 </td><td> aagactcaattcctagtcaggattatccac </td></tr><tr><td> Xp17 </td><td> gggctgtagctctatgacagtgcttt </td></tr><tr><td> Xp18 </td><td> gtcttcaccagatgcagattactacagtg </td></tr><tr><td> Xp19 </td><td> aatagtttgaggaaggggtttcaagtg </td></tr><tr><td> Xp20 </td><td> gctgttcaggtttccttctgtagtga </td></tr><tr><td> Xp21 </td><td> gcaagagatacaatggtccgaaaagt </td></tr><tr><td> Xp22 </td><td> agcacttcgtacaaccctctttctg </td></tr><tr><td> Xp23 </td><td> gaagagagcaggtcattcgtcagag </td></tr><tr><td> Xp24 </td><td> gcaactgagacactgtagccatatgaag </td></tr><tr><td> Xp25 </td><td> ttcctggaggaagaacggaaaga </td></tr><tr><td> Xp26 </td><td> tgattagaaggcttaggtcatcttcca </td></tr><tr><td> Xp27 </td><td> ttttgttcagagtagcgaggacttga </td></tr><tr><td> Xp28 </td><td> aatagagcagaatggcttcctcgaa </td></tr><tr><td> Xp29 </td><td> acattgcttgatcacgctgaagac </td></tr><tr><td> Xp30 </td><td> gcaaggaagaaatagacacacaaagc </td></tr><tr><td> Xp31 </td><td> ggaagaaatagatgtaacaaagaattagacaca </td></tr><tr><td> Xp32 </td><td> cacttcagagccacttgaatcctg </td></tr><tr><td> Xp33 </td><td> agtcacaggtgtcctgtagaaacagttc </td></tr><tr><td> Xp34 </td><td> cctttatgggcaatggcaacaat </td></tr><tr><td> Xp35 </td><td> ggcacatctgcatattgcttgtcta </td></tr><tr><td> Xp36 </td><td> gcaactaagaccatgaacccacaa </td></tr><tr><td> Xp37 </td><td> aaacacactggccttaagtatatggactg </td></tr><tr><td> Xp38 </td><td> cattcatttgcacacatggaacaat </td></tr><tr><td> Xp39 </td><td> tgggagacaatatttagcctccaggt </td></tr><tr><td> Xp40 </td><td> cctagcaagggcactgttttgtaataa </td></tr><tr><td> Xp41 </td><td> taacatttagcacactgccttgcac </td></tr><tr><td> Xp42 </td><td> cagtgatctacactaggtccacctcaca </td></tr><tr><td> Xp43 </td><td> ttatgttgaaggaatcttggccttg </td></tr><tr><td> Xp44 </td><td> aagtgagagctgtagtctcaaggtgtga </td></tr><tr><td> Xp45 </td><td> gtattcaacctctgaggcaaactgtg </td></tr><tr><td> Xp46 </td><td> agattgtggaacttagatggctgtca </td></tr><tr><td> Xp47 </td><td> tggaactgcattaaagtcccaacttag </td></tr><tr><td> Xp48 </td><td> gaactcccagacctcttcaacctg </td></tr></tbody></table&gt; טבלת 1: רצף של oligonucleotides שכותרתו fluorescently לXist RNA FISH. 48 oligonucleotides היו מסונתז עם שינוי 5&#39;-אמינו כדי להכין את בדיקות oligonucleotide שכותרתו fluorescently לXist RNA FISH.

Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level.

המהיר פלורסנט<em&gt; באתר</em&gt; הכלאת פרוטוקול לXist RNA משולב עם Immunofluorescence של היסטון שינוי באיון כרומוזום X

Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell ...

quick-fluorescent-situ-hybridization-protocol-for-xist-rna-combined

Universidad San Sebastian

Research

JoVE Journal

Biology

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

13.9K Views.  Cincinnati Children's Hospital Medical Center. We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level. 

Video: Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

באמצעות קרינה פלואורסצנטית בחיי עיר הכלאה (דגים) כדי לנטר את מצב היד לכידות ב- Prometaphase, מפה של אני דרוזופילה Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Developmental Biology

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. The protocol is a modified version of the standard in situ hybridization using alkaline phosphatase and substrates such as NBT/BCIP and Fast Red 1,2. This protocol utilizes standard digoxygenin and fluorescein labeled probes along with tyramide signal amplification (TSA) 3. The commercially available TSA kits allow flexible experimental design as fluorescence emission from green to far-red can be used in combination with various nuclear stains, such as propidium iodide, or fluorescence immunohistochemistry for proteins. TSA produces a reactive fluorescent substrate that quickly covalently binds to moieties, typically tyrosine residues, in the immediate vicinity of the labeled antisense riboprobe. The resulting staining patterns are high resolution in that subcellular localization of the mRNA can be observed using laser scanning confocal microscopy 3,4. One can observe nascent transcripts at the chromosomal loci, distinguish nuclear and cytoplasmic staining and visualize other patterns such as cortical localization of mRNA. Studies in Drosophila indicate that roughly 70% of mRNAs exhibit specific patterns of subcellular localization that frequently correlate with the function of the encoded protein 5. When combined with computer-aided reconstruction of 3D confocal datasets, our protocol allows the detailed analysis of mRNA distribution with sub-cellular resolution in whole vertebrate embryos.

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. We include a propidium iodide nuclear counter-stain to highlight tissue organization.

דג הזברה שלמים הר ברזולוציה גבוהה פעמיים פלורסנט באתרו הכלאה

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology.  Here, we present a high-resolution double ...

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including genetic disorders, of which chromosomal abnormalities are the most common. Fluorescence in situ hybridization (FISH) is a well-known and frequently used method to detect chromosomal aberrations in humans. FISH is mainly used for the analysis of chromosomal abnormalities in the spermatozoa of males with numerical or structural chromosomal aberrations. Furthermore, this technique is also frequently applied in females to detect X chromosomal aberrations that are known to cause ovarian dysgenesis. However, information on the X chromosomal content of ovarian cells from females with X chromosomal aberrations in lymphocytes and/or buccal cells is still lacking.
The aim of this study is to advance basic research regarding X chromosomal aberrations in females, by presenting two methods based on FISH to identify the X chromosomal content of ovarian cells. First, a method is described to determine the X chromosomal content of isolated ovarian cells (oocytes, granulosa cells, and stromal cells) in non-grafted ovarian cortex tissue from females with X chromosomal aberrations. The second method is directed at evaluating the effect of chromosomal aberrations on folliculogenesis by determining the X chromosomal content of ovarian cells of newly formed secondary and antral follicles in ovarian tissue, from females with X chromosomal aberrations after long-term grafting into immunocompromised mice. Both methods could be helpful in future research to gain insight into the reproductive potential of females with X chromosomal aberrations.

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

This article presents two methods based on fluorescence in situ hybridization to determine the X chromosomal content of ovarian cells in non-grafted and grafted ovarian cortex tissue from females with X chromosomal aberrations.

חקר סטיות X כרומוזומליות בתאי שחלה באמצעות הכלאה פלואורסצנטית באתרו

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including ...

Genetics

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

פלואורסצנציה באתרו הכלאה (FISH) פרוטוקול של זרע אדם

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological processes. In particular, appropriate regulation of calcium activity patterns during embryogenesis is necessary for many aspects of vertebrate neural development, including proper neural tube closure, synaptogenesis, and neurotransmitter phenotype specification. While the observation that calcium activity patterns can differ in both frequency and amplitude suggests a compelling mechanism by which these fluxes might transmit encoded signals to downstream effectors and regulate gene expression, existing population-level approaches have lacked the precision necessary to further explore this possibility. Furthermore, these approaches limit studies of the role of cell-cell interactions by precluding the ability to assay the state of neuronal determination in the absence of cell-cell contact. Therefore, we have established an experimental workflow that pairs time-lapse calcium imaging of dissociated neuronal explants with a fluorescence in situ hybridization assay, allowing the unambiguous correlation of calcium activity pattern with molecular phenotype on a single-cell level. We were successfully able to use this approach to distinguish and characterize specific calcium activity patterns associated with differentiating neural cells and neural progenitor cells, respectively; beyond this, however, the experimental framework described in this article could be readily adapted to investigate correlations between any time-series activity profile and expression of a gene or genes of interest.

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

We present a two-part protocol that combines fluorescent calcium imaging with in situ hybridization, allowing the experimenter to correlate patterns of calcium activity with gene expression profiles on a single-cell level.

סידן פלואורסצנטי הדמיה ובעקבות היברידיזציה באתרו לאפיון עצבי בלתי מבשר בקספוס זריזה

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological ...

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can be hampered by the lack of specific primary or secondary antibodies for immunostaining. Here we describe a protocol to detect the expression of three different genes in the same brain section using double fluorescence in situ hybridization with two gene-specific probes followed by immunostaining with an antibody of high specificity directed against the protein encoded by a third gene. The Aspartoacyclase (ASPA) gene, mutations of which can lead to a rare human white matter disease - Canavan disease - is thought to be expressed in oligodendrocytes and microglia but not in astrocytes and neurons. However, the precise expression pattern of ASPA in the brain has yet to be established. This protocol has allowed us to determine that ASPA is expressed in a subset of mature oligodendrocytes and it can be generally applied to a wide range of gene expression pattern studies.

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Localizing gene expression to specific cell types can be challenging due to the lack of specific antibodies. Here we describe a protocol for simultaneous triple detection of gene expression by combining double fluorescence RNA in situ hybridization with immunostaining.

שילוב קרינה זוגית<em&gt; באתרו</em&gt; כלאה עם Immunolabelling עבור איתור של הביטוי של שלושה גנים בסעיפי מוח עכבר

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can ...

Neuroscience

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The specification of replication timing is thought to be a dynamic process regulated by tissue-specific and developmental cues that are responsive to epigenetic modifications. However, the mechanisms regulating where and when DNA replication initiates along chromosomes remains poorly understood. Homologous chromosomes usually replicate synchronously, however there are notable exceptions to this rule. For example, in female mammalian cells one of the two X chromosomes becomes late replicating through a process known as X inactivation1. Along with this delay in replication timing, estimated to be 2-3 hr, the majority of genes become transcriptionally silenced on one X chromosome. In addition, a discrete cis-acting locus, known as the X inactivation center, regulates this X inactivation process, including the induction of delayed replication timing on the entire inactive X chromosome. In addition, certain chromosome rearrangements found in cancer cells and in cells exposed to ionizing radiation display a significant delay in replication timing of &gt;3 hours that affects the entire chromosome2,3. Recent work from our lab indicates that disruption of discrete cis-acting autosomal loci result in an extremely late replicating phenotype that affects the entire chromosome4. Additional 'chromosome engineering' studies indicate that certain chromosome rearrangements affecting many different chromosomes result in this abnormal replication-timing phenotype, suggesting that all mammalian chromosomes contain discrete cis-acting loci that control proper replication timing of individual chromosomes5.
Here, we present a method for the quantitative analysis of chromosome replication timing combined with fluorescent in situ hybridization. This method allows for a direct comparison of replication timing between homologous chromosomes within the same cell, and was adapted from6. In addition, this method allows for the unambiguous identification of chromosomal rearrangements that correlate with changes in replication timing that affect the entire chromosome. This method has advantages over recently developed high throughput micro-array or sequencing protocols that cannot distinguish between homologous alleles present on rearranged and un-rearranged chromosomes. In addition, because the method described here evaluates single cells, it can detect changes in chromosome replication timing on chromosomal rearrangements that are present in only a fraction of the cells in a population.

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

A quantitative method for the analysis of chromosome replication timing is described. The method utilizes BrdU incorporation in combination with fluorescent in situ hybridization (FISH) to assess replication timing of mammalian chromosomes. This technique allows for the direct comparison of rearranged and un-rearranged chromosomes within the same cell.

עיתוי מעתיק כרומוזום בשילוב עם פלורסנט<em&gt; באתר</em&gt; הכלאה

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The ...

Combined Immunofluorescence and DNA FISH on 3D-preserved Interphase Nuclei to Study Changes in 3D Nuclear Organization

Fluorescent in situ hybridization using DNA probes on 3-dimensionally preserved nuclei followed by 3D confocal microscopy (3D DNA FISH) represents the most direct way to visualize the location of gene loci, chromosomal sub-regions or entire territories in individual cells. This type of analysis provides insight into the global architecture of the nucleus as well as the behavior of specific genomic loci and regions within the nuclear space. Immunofluorescence, on the other hand, permits the detection of nuclear proteins (modified histones, histone variants and modifiers, transcription machinery and factors, nuclear sub-compartments, etc). The major challenge in combining immunofluorescence and 3D DNA FISH is, on the one hand to preserve the epitope detected by the antibody as well as the 3D architecture of the nucleus, and on the other hand, to allow the penetration of the DNA probe to detect gene loci or chromosome territories 1-5. Here we provide a protocol that combines visualization of chromatin modifications with genomic loci in 3D preserved nuclei.

Here we describe a protocol for simultaneous detection of histone modifications by immunofluorescence and DNA sequences by DNA FISH followed by 3D microscopy and analyses (3D immuno-DNA FISH).

Immunofluorescence שילוב ודגי DNA על 3D-השתמרו גרעיני Interphase לחקר שינויים בארגון גרעיני 3D

Fluorescent in situ hybridization using DNA probes  on 3-dimensionally preserved nuclei followed by 3D confocal microscopy (3D DNA  FISH) represents the ...

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within cells. Neurochemical phenotyping of functionally identified neurons usually requires concurrent labelling with multiple antibodies (targeting protein) using immunohistochemistry (IHC) and optimization of in situ hybridization (targeting RNA), in tandem. A &#34;neurochemical signature&#34; to characterize particular neurons may be achieved however complicating factors include the need to verify FISH and IHC targets before combining the methods, and the limited number of RNAs and proteins that may be targeted simultaneously within the same tissue section.
Here we describe a protocol, using both fresh frozen and fixed mouse brain preparations, which detects multiple mRNAs and proteins in the same brain section using RNAscope FISH followed by fluorescence immunostaining, respectively. We use the combined method to describe the expression pattern of low abundance mRNAs (e.g., galanin receptor 1) and high abundance mRNAs (e.g., glycine transporter 2), in immunohistochemically identified brainstem nuclei.
Key considerations for protein labelling downstream of the FISH assay extend beyond tissue preparation and optimization of FISH probe labelling. For example, we found that antibody binding and labelling specificity can be detrimentally affected by the protease step within the FISH probe assay. Proteases catalyze hydrolytic cleavage of peptide bonds, facilitating FISH probe entry into cells, however they may also digest the protein targeted by the subsequent IHC assay, producing off target binding. The subcellular location of the targeted protein is another factor contributing to IHC success following FISH probe assay. We observed IHC specificity to be retained when the targeted protein is membrane bound, whereas IHC targeting cytoplasmic protein required extensive troubleshooting. Finally, we found handling of slide-mounted fixed frozen tissue more challenging than fresh frozen tissue, however IHC quality was overall better with fixed frozen tissue, when combined with RNAscope.

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

This protocol describes a method for combining fluorescence in situ hybridization (FISH) and fluorescence immunohistochemistry (IHC) in both fresh frozen and fixed mouse brain sections, with the goal of achieving multilabel FISH and fluorescence IHC signal. IHC targeted cytoplasmic and membrane attached proteins.

שילוב של הכלאה פלואורסצנטית באתרו עם אימונוהיסטוכימיה פלואורסצנטית על חלקי מוח טריים של עכברים קפואים או קבועים

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within ...

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected.

Combined DNA-RNA Fluorescent In situ Hybridization FISH to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) allows the detection of nucleic acids in their native environment within cells. We here describe a protocol for the combined, simultaneous detection of RNA and DNA by means of FISH, which can be used to study X chromosome inactivation in mouse embryonic stem cells.

המהיר פלורסנט

Summary

Explore More Videos

Chapters in this video