Name: methods for skin wounding and assays for wound responses in c. elegans
Uploaded: 2014-12-03T13:00:00.000+00:00
Duration: 9 min 6 s
Description: Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Needle wounding methods for C. elegans were first developed by Nathalie Pujol and Jonathan Ewbank; we thank Nathalie Pujol for comments on the manuscript. Work in our laboratory on C. elegans epidermal wound repair is supported by a grant from the NIH to A.D.C. (R01 GM054657).

הפרוטוקולים הבאים מתארים את הנוהל מפורט לג עור elegans פצע ולמנסה לאמוד את תגובות פצע. 1. מחט פציעת 3,4 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול תולעי unstarved בריאים על NGM הסטנדרטי (מדיום גידול נמטודות) צלחות עם E. חיידקי coli OP50 כמזון, נשמרו בחממה C ° 20. הערה: שיטות לצלחות אגר NGM וטיפוח שיגרתי של ג ניתן למצוא elegans בשעה 6 www.wormbook.org. </li><li style=";text-align:right;direction:rtl"> פיק 25 תולעי שלב L4 ליום 1 צלחת טרי נזרע לפני פצעת והתרבות ב 20 ° CO / N. </li><li style=";text-align:right;direction:rtl"> לפני פצע, למשוך מחטים מנימים באמצעות חולץ מחט. המחטים המשמשות בפציעה זהות לאלה המשמשים לmicroinjection של ג elegans. </li><li style=";text-align:right;direction:rtl"> ודא שכל התולעים נמצאים בשלב בוגר צעיר. מניחים את הצלחת של תולעים על קרח למשך כ -30 דקות. קירור גורם לבעלי החיים להיות איטיים, להקל על פציעת מחט. <br /&gt; הערה: בתוך 5 דקות של ההסרה מהקרח, התולעים יתחילו לנוע בדרך כלל. זה אפשרי אך מאתגר לפצוע תולעים נעו. עם ניסיון, 5 דקות זה מספיק זמן כדי פצע 25 תולעים. לשתק עם תרופות כגון levamisole (כמו בשימוש בליזר פציעה, ראה בהמשך), אם כי בעלי החיים ייקחו זמן רב יותר להתאושש. </li><li style=";text-align:right;direction:rtl"> הסר את הצלחת אגר מהקרח לסטראו לנתח. באמצעות איסוף תולעת, להעביר 25 תולעים למרכז הצלחת אגר. </li><li style=";text-align:right;direction:rtl"> מניחים את המחט לתוך קצה פיפטה 100 μl להחזיק את המחט בקלות רבה יותר. לנקב את החלק הקדמי או אחורי של הגוף של התולעת עם המחט, הימנעות בלוטת המין. באופן כללי, תנסה לפצוע בין בלוטת מין הלוע האחורי וקדמי, או בין בלוטת המין האחורית ופי הטבעת. מחטי שימוש חוזרים פעמים רבות, עד שהם ישברו. הערה: ודא פצעי דקירות הם קצרות, עדינות שלנקב את הציפורן ועור, חודר ~ 5-10 מיקרומטר לבעלי החיים. המחט צריכה להיכנס לעניםאל בזווית של כ זכות העור. הפצעים לא צריכים לגרום לניזק ברור לאיברים פנימיים, או קרע מיידי של הגוף. שים לב כמות קטנה של ציטופלסמה נוטף החוצה לכמה שניות לאחר שהפצע; עם זאת, אם תוכן סלולארי לדלוף החוצה במשך זמן ממושך בעלי החיים לא ישרדו. עבור הדמיה אופטימלית, פצע syncytium רוחב אפידרמיס (hyp7) או התפר לרוחב. הערה: הליך זה כולל את השימוש במחט זכוכית. </li><li style=";text-align:right;direction:rtl"> לאפשר תולעים להתאושש בRT אז תרבות ב 20 ° C. לשפוט את ההצלחה של פציעת מחט על ידי מספר מבחני שיתוארו להלן. יותר מ 95% של בעלי חיים מסוג בר לשרוד 24 שעות לאחר המחט פצעה בשלב הבוגר הצעיר. ההשפעה פצע בזחלים בוגרים או מבוגרים טרם ניתחה בהרחבה. </li></ol> 2. לייזר פציעת 3 השתמש בהקרנת לייזר פמטו-שנייה (800 ננומטר) לבצע פציעה מדויקת יותר. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן p אגרמודעות בשקופיות זכוכית עם אגר 2% מותכים 7. ודא הרפידות דומות לרפידות אגר המשמשות להדמית חיה של ג elegans. </li><li style=";text-align:right;direction:rtl"> העבר את 10 תולעים בוגרות צעירות על כרית agarose עם בחירת תולעת, ולהוסיף טיפת 2 μl של 12 מ&quot;מ פתרון levamisole. לכסות את בעלי החיים ואת הנוזל עם להחליק את המכסה. חכה 1-2 דקות לתולעים לשתק. </li><li style=";text-align:right;direction:rtl"> מניחים את שקף הזכוכית על מיקרוסקופ confocal הדיסק מסתובב. הזז את הבמה כדי למצוא את התולעים ולהתמקד באפידרמיס הרוחב הקדמי או האחורי syncytial עם מטרת 100X (NA 1.4-1.46). </li><li style=";text-align:right;direction:rtl"> הגדר את הכח של לייזר פמטו-השני ל -140 mW (נמדד לפני האובייקטיבי). השתמש בליזר פמטו-השני בשיעור החזרה של 80 מגה-הרץ. הערה: שתי פעימות של 200 אלפיות שניים כל אחת (מופרדים על ידי 20 אלפיות שני) מספיקות לפציעתם בידיים שלנו. </li><li style=";text-align:right;direction:rtl"> פוקוס על משטח הפסגה של תאי אפידרמיס ופצע האפידרמיס. שים לב שיבוש מקומי של ציטופלסמה (מבעבעת), או o הלבנה המקומיתf כל סמן פלואורסצנטי משמש. הערה: בצע נהלי בטיחות לייזר מתאימים בעת שימוש בליזר פמטו-השני. סריקות קו או נקודה באמצעות לייזרי femtosecond כגון אלה בשני מיקרוסקופי פוטון אמורות לספק מספיק כוח לפציעת לייזר. הערה: למרות שאין לנו חוויה ישירה של שימוש בלייזרים אחרים, בפציעת עיקרון צריך להיות אפשרי באמצעות לייזרי UV קונבנציונליים (כפי שהוא משמש C. elegans כריתת תא). לחלופין, השתמש בשחזור הקרינה לאחר photobleaching מודול (FRAP) על ספינינג confocal דיסק לפצוע את האפידרמיס (נ Pujol, תקשורת אישית). </li></ol> 3. ויזואליזציה של תגובות 2 + Ca עוריות לפציעה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש ג המהונדס זני elegans המבטאים Ca 2 + חיישנים (כמו אלה של סדרת GCaMP) באפידרמיס, תחת השליטה של האמרגן הספציפי אפידרמיס המבוגר col-19 (איור 1 א; transgenes מפורטים ב <strong&gt; לוח 1). השתמש transgene לבטא חלבון ניאון אדום כגון tdTomato כבקרה פנימית לרמת ביטוי transgene. הערה: יש לנו להשתמש tdTomato כבקרה פנימית לביטוי transgene כקרינת tdTomato אפידרמיס היא יציבה יחסית ואינו מפריעים להדמית GCaMP. </li><li style=";text-align:right;direction:rtl"> מחט והן לייזר ופצע את הדק העלאת Ca 2 + באפידרמיס. עם זאת, כפי שפציעת מחט לא ניתן לבצע בקלות על confocal דיסק ספינינג, פציעת לייזר עדיפה לניתוח כמותי של תגובת Ca 2 + (איור 1). </li><li style=";text-align:right;direction:rtl"> לרכוש תמונות זמן לשגות במצב רב-ממדי רכישה (מרווח זמן 2 שניות ל -114 חשיפת לייזר עירור msec) באמצעות דיסק מסתובב confocal עם מטרת 100X (NA 1.4-1.46) ומערכות סינון מתאימות (מסנני GFP יעבדו עבור GCaMP3). הערה: רכישת הזמן לשגות תמונות בכל 30 שניות בערך 2 שעות לבחון את שו&quot;ת Ca 2 +onse לפצע מעל כמובן זמן ארוך יותר. </li><li style=";text-align:right;direction:rtl"> שימוש בתוכנת ניתוח תמונה למדוד את הקרינה GCaMP הממוצעת בעשרת אזורים מקבילים של עניין (ROI), בם חמש התמקדו בcytosol תא אפידרמיס וחמישה ברקע. </li><li style=";text-align:right;direction:rtl"> להשיג הקרינה בסיס (F 0) על ידי חישוב ממוצע הקרינה ב5 ROIs באפידרמיס אז הפחתה הממוצעת של 5 ROIs ברקע לפני פציעה. הגעה השינוי בΔF הקרינה כיחס בין השינוי ביחס לנקודת ההתחלה [(-f F t 0) / F 0]. </li></ol> 4. ויזואליזציה של F- אקטין Dynamics לאחר הפציעה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הערה: בתגובה לפציעת מחט, להתבונן טבעת אקטין באתר הפצע שסוגר בהדרגה סביב הפצע. מבחני סעיף פרוטוקול זה פצע סגירה על ידי מדידת קוטר הטבעת אקטין. </li><li style=";text-align:right;direction:rtl"> צור תולעים מהונדסים המבטאים סמן F- אקטין כגון תחום תסיסנית אקטין moesin מחייב התמזגGFP, הביע תחת שליטתו של אמרגן ספציפי אפידרמיס כגון col-19 (איור 2 א) (transgene juIs352). הערה: יש לנו להשיג תוצאות דומות באמצעות אקטין אחרים מחייבים סמני תחום כגון Lifeact או F-tractin (תוצאות לא פורסמו). </li><li style=";text-align:right;direction:rtl"> בצע מחט פצע על col-19- תולעים מהונדסים GFP-moesin P. לאחר פציעת מחט, להתבונן טבעת של ה- GFP-moesin סביב אתר הפצע על ידי ~ 5 דקות. הטבעת אקטין הופכת להיות קטנה יותר בקוטר וסופו של דבר נסגרה 2-3 שעות שלאחר פציעתם בחיות בר סוג (איור 2 א). </li><li style=";text-align:right;direction:rtl"> הכן משטח אגר 2% בשקופית זכוכית ולהעביר 10 תולעים על הכרית בפתרון 2 μl 12 מ&quot;מ levamisole. תמונת טבעות GFP-moesin שעה 1 לאחר פצע באמצעות מיקרוסקופ confocal הקונבנציונלי. הערה: מיקרוסקופיה confocal השימוש לרכוש Z- ערימות (13 x 0.5 מיקרומטר) של טבעות אקטין שעה 1 לאחר פציעתם. </li><li style=";text-align:right;direction:rtl"> מדוד את קוטר טבעת אקטין לאחר פציעתם. כדי לכמת את אפידרמיס GFP-moesin, ראשון לעשות הקרנת עוצמה מקסימלית של Z- המחסנית ולאחר מכן לצייר 4 סריקות קו (ב 45 מעלות זה לזה) על טבעת GFP-moesin. קוטר טבעת מוגדר כשיא הממוצע למרחק שיא של סריקות ארבע קו (איור 2). לטבעות שכבר נסגרו, הקוטר מוגדר כ0 מיקרומטר. הערה: טבעות F- אקטין בנוחות נמדדות לאחר שעה 1 פצעו כמו זה היא כמחצית דרך בתהליך סגירת הפצעים בסוג בר. ניתן גם למדוד טבעות F- אקטין בנקודות זמן מרובות כדי להפיק במהלך סגירת פצע זמן. סרטי זמן לשגות של סגירת פצע ניתן לרכוש באמצעות תולעים-משותק levamisole ומסתובב מיקרוסקופיה confocal דיסק. </li></ol> 5. האינדוקציה Assay של פפטידים Antimicrobial עוריות הערה: פציעה גם מפעילה תגובה חיסונית מולדת בג עור elegans. שעתוק של גני קידוד פפטידים מיקרוביאלית (אמפר) הוא induced באפידרמיס. AMP NLP-29 (החלבון כמו neuropeptide-) מושרה בחום על ידי פצע 4. לassay איך האפידרמיס שולט ביטוי AMP לאחר פציעה, להשתמש כתבים מהונדסים או בזמן אמת PCR לגילוי רמות תמליל AMP בודדים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> assay כתב המהונדס לתגובה חיסונית מולדת פצע 4. </li><li style=";text-align:right;direction:rtl"> לבצע פציעת מחט (כמו בפרוטוקול 1) על בעלי חיים מבוגרים המבטאים את הכתב המהונדס frIs7, המכיל NLP-P 29. GFP וP col-12 DsRed כבקרה פנימית. תצפיות על בעלי חיים מבוגרים unwounded אדומים או כתומים כהים כמו במסנן מסירה ארוכה GFP. הערה: תולעי wild-type פציעה יגרמו NLP-29 -GFP ביטוי P אבל לא ישפיעו col-12 P -dsRed, וכתוצאה מכך תולעים המופיעים כתום, צהוב, ירוק או תחת תאורת מסירה ארוכה GFP. אובדן התפקוד של גנים במסלול MAPK p38, כגון ורוד-1 או nsy-1 יחסום NLP-29 -GFPאינדוקציה לאחר פצע 4. GFP P NLP-29. באו לידי ביטוי ברמות גבוהות בשלבי זחל </li><li style=";text-align:right;direction:rtl"> לבצע מבחני אינדוקציה AMP בבעלי חיים מבוגרים צעירים. ודא שיש לי חיות שליטת unwounded רמות נמוכות של GFP. הערה: NLP-29. ביטוי P GFP גם הנגרם על ידי לחץ האוסמוטי 8, ועלול להיות רגיש ללחצים סביבתיים אחרים. </li><li style=";text-align:right;direction:rtl"> 6 שעות לאחר פציעה, ציון המספרים של תולעים שיש לי NLP-29 -GFP אינדוקציה P (איור 3) 9 באמצעות הקרינה לנתח היקף עם מסנן ארוך לעבור GFP. הערה: בGFP NLP-P 29. לאחר הפציעה-שעה 1 מושרה בעליל, שהגיע לשיא על פוסט פציעה-6 שעות ולאחר מכן נותר גבוהה עד להודעה פציעת 24 שעות. לכמת ביטוי על ידי 4,9 ניקוד חזותי. לחלופין, לכמת רמות ביטוי באמצעות סדרן תולעת הקרינה הופעלה 4. לסדרן התולעת, לפחות 50 בעלי חיים צריכים להיות פצועים. </li><li style=";text-align:right;direction:rtl"> בזמן אמת assay PCR לקואהntitating רמות תמליל גני AMP הבודדים. רמות תמליל assay עבור מספר גנים: NLP-29, NLP-30, cnc-1, וcnc-5. </li><li style=";text-align:right;direction:rtl"> בצע מחט פצע על wild-type או תולעי מוטציה (ראה פרוטוקול 1) </li><li style=";text-align:right;direction:rtl"> לאסוף 50 תולעים נפצעו ו -50 תולעים unwounded בזמנים הרצויים (למשל 3, 6, 24 שעות) לאחר פציעה. </li><li style=";text-align:right;direction:rtl"> לחלץ RNA באמצעות ערכה מסחרית הבא הוראות היצרן. </li><li style=";text-align:right;direction:rtl"> לבצע שעתוק לאחור כדי לקבל כולל cDNA 20 μl באמצעות ערכת transcriptase הפוכה מסחרית. </li><li style=";text-align:right;direction:rtl"> לRT-PCR, להשתמש 0.2 μl cDNA (1/40) מכל מדגם בשילוב עם Supermix ירוק עם העמסה ו -0.2 מיקרומטר פריימרים. כדי להשוות איכות RNA, להשתמש ama-1 או SNB-1 RT-PCR כהתייחסות; להשוות את רמת הביטוי היחסית AMP ידי נרמול לבקרה פנימית (AMA-1 או SNB-1), או להשוות לאחר פציעת אינדוקציה לקפל (אינדוקציה AMP בתולעים פצועים / תולעי unwounded) על ידי נורמהalizing לבקרה פנימית. הערה: cnc-1 וcnc-5 הן caenacin פפטידים מיקרוביאלית משפחת השעתוק שמופעל על ידי פצע 10. בדרך כלל, פציעת מחט גורמת ביטוי (~ 500 פי לcnc-1) על קורס של 4 שעות 10 זמן. Primers המשמש בעבודה שפורסמה שמותיהם מופיעים בטבלה 2. </li></ol> 6. Assay הישרדות לאחר הפציעה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הערה: פציעה מפעילה לפחות שני מסלולים עצמאי איתות באפידרמיס: מסלול Ca 2 + פצע תלוי תיקון ומסלול התגובה חיסוני המולדת. שני המסלולים נדרשים להישרדות מלאה של פציעת סטרילי. כדי לבדוק אם מוטציה או טיפול RNAi משפיע ריפוי פצע, למדוד הישרדות בהודעת פציעה 24-48 שעות. לחלופין, להשתמש במבחני תוחלת חיים מקובלים על מנת לקבוע את ההשפעה של פצע על אריכות ימים 4,9. </li><li style=";text-align:right;direction:rtl"> בצע מחט פצעה במבוגרים צעירים (L4 + 24 שעות) תולעים (50 תולעים, seve חוזרפעמים RAL) בעקבות פרוטוקול 1 לעיל. לשמור על מספר שווה של תולעי unwounded כפקדים. </li><li style=";text-align:right;direction:rtl"> בדקו הישרדות בכל שעה 24 (תולעים פצועים העברה לצלחת אגר חדשה בכל שעה 24). שים לב ~ 50% הישרדות 24 שעות לאחר פציעתם במוטציות שהם פגומים תיקון פצע כגון GTL-2 או טיר-1, כאשר מנורמל לבעלי חיים שליטה unwounded. מוות מוגדר כחוסר התגובה של תנועה לגעת ידי בחירת תולעת. </li></ol>

<ol>
	<li>Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair+and+regeneration.">Wound repair and regeneration.</a> Nature. 453, 314-321 (2008).</li><li>Sonnemann, K. J., Bement, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair:+toward+understanding+and+integration+of+single-cell+and+multicellular+wound+responses.">Wound repair: toward understanding and integration of single-cell and multicellular wound responses.</a> Annu Rev Cell Dev Biol. 27, 237-263 (2011).</li><li>Xu, S., Chisholm, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+G&#945;q-Ca2++signaling+pathway+promotes+actin-mediated+epidermal+wound+closure+in+C.+elegans.">A G&#945;q-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.</a> Curr Biol. 21, 1960-1967 (2011).</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+innate+immune+responses+to+infection+and+wounding+in+the+C.+elegans+epidermis.">Distinct innate immune responses to infection and wounding in the C. elegans epidermis.</a> Curr Biol. 18, 481-489 (2008).</li><li>Chisholm, A. D., Xu, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Caenorhabditis+elegans+epidermis+as+a+model+skin.+II:+differentiation+and+physiological+roles.">The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles.</a> Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook : the online review of C. elegans biology. , 1-11 .</li><li>Bargmann, C. I., Avery, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+killing+of+cells+in+Caenorhabditis+elegans.+Methods+in+cell+biology.">Laser killing of cells in Caenorhabditis elegans. Methods in cell biology.</a> 48, 225-250 .</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-fungal+innate+immunity+in+C.+elegans+is+enhanced+by+evolutionary+diversification+of+antimicrobial+peptides.">Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.</a> PLoS Pathog. 4, (2008).</li><li>Tong, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+Caenorhabditis+elegans+epidermal+damage+responses+by+death-associated+protein+kinase.">Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase.</a> Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).</li><li>Zugasti, O., Ewbank, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroimmune+regulation+of+antimicrobial+peptide+expression+by+a+noncanonical+TGF-beta+signaling+pathway+in+Caenorhabditis+elegans+epidermis.">Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis.</a> Nat Immunol. 10, 249-256 (2009).</li><li>Zhao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip-based+C.+elegans+microinjection+system+for+investigating+cell-cell+communication+in+vivo.">Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo.</a> Biosensor., &amp; Bioelectronics. 50, 28-34 (2013).</li><li>Jansson, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adhesion+of+Conidia+of+Drechmeria+coniospora+to+Caenorhabditis+elegans+Wild+Type+and+Mutants.">Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants.</a> J Nematol. 26, 430-435 (1994).</li><li>Hodgkin, J., Kuwabara, P. E., Corneliussen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+bacterial+pathogen,+Microbacterium+nematophilum,+induces+morphological+change+in+the+nematode+C.+elegans.">A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans.</a> Curr Biol. 10, 1615-1618 (2000).</li><li>Hochbaum, D., Ferguson, A. A., Fisher, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+C.+elegans+by+biolistic+transformation.">Generation of transgenic C. elegans by biolistic transformation.</a> J Vis Exp. (42), (2010).</li><li>Hashmi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+nematodes+using+arrays+of+micromechanical+piercing+structures.">Genetic transformation of nematodes using arrays of micromechanical piercing structures.</a> BioTechniques. 19, 766-770 (1995).</li></ol>

The authors are not aware of any competing interests.

השיטות שהוצגו כאן למחט ופציעת לייזר לספק גישות משלימות להערכת היכולת של האפיתל אפידרמיס לתקן את הנזק. פציעת לייזר היא יחסית מקומית ו( בהתאם לתצורת לייזר) יכול להיות מוגבל לאפידרמיס, ואילו פציעת מחט משבשת את האפידרמיס, ציפורן, וקרומים מרתף פנימיים סביר. פציעת מחט עשויה בצורה מדויקת יותר דומה לפצעים שנגרמו על ידי גורמי מחלה או פגיעה מכאנית בסביבה הטבעית. ככלל, פציעת מחט דורשת יותר תרגול כדי להשיג פצעים מדויקים התואמים את ההישרדות של בעלי חיים. התגובות התאיות לדמיון רב מחט ותצוגת פציעת לייזר. עם זאת יש לציין כי ההיווצרות של טבעות אקטין לא נצפתה reproducibly לאחר פציעת לייזר פמטו-שנייה. הגבלה של ניקור מחט היא שזה לא פצע מדויק: המחט גם רקמות פנימיות נזקים שתרומה לתולעתהישרדות לא נחקרה. שינוי אפשרי של פרוטוקול זה יהיה לשלב מערכת מבוססת microfluidic microinjection 11 וכתבי ניאון לבצע פציעה פיזית מדויקת יותר. שיטות פציעת המחט ולייזר המפורטות כאן הן פשוט עדיין די עבודה אינטנסיבית, ובמקרה הטוב בינונית-תפוקה, מה שהופך את מאתגר להשתמש בגישות הגנומי או ביוכימי לאפיון תגובת הפצע. ציפורן חודרת פתוגנים כגון פטריות או 12,13 פרוטוזואה יכולים להיות מועברים לאוכלוסייה גדולה יותר של בעלי חיים, ועלולים לעורר תגובות החופפים לתגובה לפציעה, עדיין להציג את מורכבות נוספות של תגובות ספציפיות הפתוגן. עבודה נוספת שתידרש כדי לחקור האם ניתן להתאים שיטות אביוטי אחרות כגון הפצצה בליסטית 14 או מערכים של מבני פירסינג מייקרו-מכאניים 15 לפציעתם בקנה מידה גדולה.

מנגנוני ריפוי עור פצע הם עניין ביולוגי בסיסי ורלוונטיים לבריאות אדם. ריפוי פצעים בבעלי חוליות ויונקים כולל סדרה מורכבת של תגובות מתואמות של רקמות רבות ואיתות 1. אורגניזמים מודל גנטי פשוטים רבים הם גם מסוגלים ריפוי פצעי עור 2. לכן זה עניין לנתח מודלים גנטיים צייתנים של תיקון פצע עור. אנו ואחרים החלו להשתמש elegans Caenorhabditis כמודל חדש לפצע עור ריפוי 3,4. המטרה של פרוטוקול זה היא לאפשר למגוון רחב יותר של חוקרים להשתמש בג elegans ככלי לחקור מנגנונים מולקולריים ותאיים של ריפוי הפצע באפידרמיס. ג עור elegans כולל את האפידרמיס (הידוע גם בבהיפודרמיס) וציפורן תאית 5. האפידרמיס המבוגר נוצר ממספר קטן של syncytia multinucleate, מתוכם הגדול ביותר הוא k syncytiumnown כhyp7. האפידרמיס הוא אפיתל פשוט שמפריש לציפורן על משטח הפסגה שלה. העור יכול באופן פעיל בהגנה מפני פתוגנים-חודר עור ולתקן פצעים קטנים 4. תיקון פצע של ג עור elegans הוא איתן, שכן כמעט כל בעלי החיים מהסוג בר לשרוד יכולים לשרוד פצעי דקירה קטנים הנגרמים על ידי מחטים, או נזק לעור מקומי הנגרם על ידי קרינת לייזר. ג פציעת עור elegans מפעילה חבילה של תגובות, כולל תגובת אפידרמיס מולדת חיסונית, סגירת פצע, והיווצרות צלקת 4. האפידרמיס המבוגר הוא שלאחר mitotic-, וריפוי פצעים כרוך תגובות הסלולר מקומיות בניגוד לריבוי אפידרמיס או נדידת תאים. הראינו כי פציעת העור גורמת עלייה גדולה ומתמשכת באפידרמיס Ca 2 +, המחייבת את ערוץ TRPM קרום GTL-2 וCa 2 + חנויות פנימיות 3. אות אפידרמיס 2 + Ca נדרשת להיווצרות וסגירת טבעות F- אקטין בוואתר und. פציעה גם גורמת תגובה חיסונית מולדת המפעילה את השעתוק של מגברים כגון NLP-29. השעתוק מושרה פציעתם של אמפר תלוי בTIR-1 מפל kinase MAP p38 / PMK-1 פועל באופן עצמאי באפידרמיס 4. פגמים באו מסלול איתות Ca 2 + או בתגובה החיסונית המולדת יובילו להישרדות נמוכה לאחר פציעה. המבנה פשוט יחסית של ג elegans האפידרמיס, נְהִילוּת הגנטית ויתרונות לin vivo הדמיה לעשות את זה מערכת מצוינת ללמוד היבטים רבים של תיקון פצע. כאן אנו מציגים פרוטוקולים לשתי שיטות נפוצות של פציעה: פציעת מחט ופציעת לייזר. פציעת מחט לא דורשת ציוד מיוחד (למעט חולץ המחט), ועם ניסיון יכולה להתבצע על מאות תולעים בכל יום. פציעת מחט מתבצעת על בעלי חיים גדלו על צלחות אגר. בניגוד לכך, פציעת לייזר מבוצעת על anesבעלי החיים thetized רכובים על אגר כריות מתחת coverslip, והוא מתאים להדמית חיה של התגובות התאיות לנזק.

<table><tbody><tr><td>Agarose</td><td>Denville Scientific</td><td>CA3510-8</td><td></td></tr><tr><td>Plastic Petri plate</td><td>Tritech Research</td><td>T3308</td><td>60 mm</td></tr><tr><td>Levamisole</td><td>Sigma</td><td>L9756</td><td>12 mM</td></tr><tr><td>Borosilicate glass capillary</td><td>World Precision Instruments</td><td>1B100F-4</td><td></td></tr><tr><td>Needle puller</td><td>Sutter Instrument&amp;nbsp;</td><td>P-2000</td><td></td></tr><tr><td>Worm pick (platinum wire)</td><td>Tritech Research</td><td>PT-9010</td><td></td></tr><tr><td>M9 solution</td><td>Home-made</td><td></td><td>3 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 6 g Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;, 5 g NaCl, 1 ml 1 M MgSO&lt;sub&gt;4&lt;/sub&gt;, H&lt;sub&gt;2&lt;/sub&gt;O to 1 liter. Sterilize by autoclaving</td></tr><tr><td>Trizol</td><td>Invitrogen</td><td>15596026</td><td>Use 500 ml for 50 worms</td></tr><tr><td>iQ SYBR Green</td><td>Bio-Rad</td><td>1708882</td><td></td></tr><tr><td>SuperScript III</td><td>Invitrogen</td><td>18080-051</td><td></td></tr><tr><td>PCR machine</td><td>Bio-Rad</td><td>C1000/CFX96</td><td></td></tr><tr><td>96-well PCR tubes</td><td>Bio-Rad</td><td>MLL9601</td><td></td></tr><tr><td>Image analysis software</td><td>Molecular Devices</td><td>Metamorph</td><td></td></tr></tbody></table>

methods for skin wounding and assays for wound responses in c. elegans

ג elegans האפידרמיס וציפורן ליצור שכבת עור אך מתוחכמת פשוטה שיכול לתקן את הנזק מקומי כתוצאה מפציעתם. מחקרים של תגובות פצע ותיקון במודל זה מואר ההבנה של cytoskeletal ותגובות הגנומי לנזק לרקמות שלנו. שתי השיטות הנפוצות ביותר לפצע ג עור בוגר elegans הם דקירות במחטי microinjection, והקרנת לייזר מקומית. מחט פצעה מקומי משבשת את הציפורן, האפידרמיס, ומטריצת חוץ-תאית הקשורים, וגם עלול לגרום נזק לרקמות פנימיות. תוצאות קרינת לייזר בנזק יותר מקומי. פציעה מפעילה רצף של תגובות assayed בקלות כולל אפידרמיס הגבוה Ca 2 + (שניות-דקות), היווצרות וסגירת טבעת המכיל אקטין באתר הפצע (1-2 שעות), שעתוק מוגבר של גני פפטיד מיקרוביאלית (2-24 שעה), והיווצרות צלקת. בעיקרו של דבר את כל בעלי החיים המבוגרים הסוג בר לשרוד פציעה, שבוכמוטציות פגומות תיקון פצע או תגובות אחרות מראים ירידה בהישרדות. פרוטוקולים מפורטים למחט ופציעת לייזר, ומבחנים לכימות והדמיה של תגובות פצע ותהליכי תיקון (דינמיקת Ca, אקטין דינמיקה, אינדוקציה פפטיד מיקרוביאלית, והישרדות) מוצגים.

לייזר או פציעת מחט יפעיל העלאה מהירה ומתמשכת ברמות Ca אפידרמיס, כמו דמיין עם חיישני Ca כגון GCaMPs (איור 1). העלאת Ca מתרחשת תוך שניות, ונשארה גבוה במשך עשרות דקות. מחט פצעה reproducibly תוצאות בהיווצרות של טבעות F- אקטין באתרי פצע (איור 2); אלה מופיעים בתוך דקות, ובהדרגה קרובים מעל 1-2 שעות לאחר פציעתם. טבעות אקטין פחות לעתים קרובות נוצרות לאחר פציעת לייזר מדויקת יותר. שתי פציעת המחט והלייזר לגרום לביטוי של פפטידים אפידרמיס מיקרוביאלית (אמפר) כגון NLP-29, שזוהו עם כתבי תעתיק (איור 3). האינדוקציה AMP ניכר בתוך 2-4 שעות לאחר הפציעה ונמשכת כ 24 שעות. פציעת מחט של הסוג בר לא אמורה להשפיע באופן משמעותי את הכדאיות (נמדדה ב 24 שעות לאחר פציעתם) או תוחלת חיים. <img alt="איור 1" src="/files/ftp_upload/51959/51959fig1highres.jpg" /> איור 1. פציעת לייזר יוצרת תגובת Ca 2 + C. האפידרמיס elegans. הקרינה עוריות GCaMP3 (-GCaMP3 P col-19 (juIs319)) רמות לאחר פציעת לייזר פמטו-שנייה (). תצוגה לרוחב של האפידרמיס בקדמי-גוף; x, פצע לייזר; N, גרעין אפידרמיס. תמונות מסתובבות דיסק confocal, קוד עוצמה. UW: unwounded, W:. פצוע (B) Quantitation של GCaMP3 ΔF / F 0 בגיל 20, 40, ו -60 מיקרומטר מאתר פצע; עקבות נציג. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/51959/51959fig2highres.jpg" /> 2. פציעת מחט איור מפעילה פילמור אקטין סביב אתר פצע. () </strong&gt; פצעי מחט עוריות לעורר היווצרות של טבעות אקטין בשוליים הפצע, דמיינו עם P col-19- GFP-moesin (juIs352). בקנה מידה: 10 מיקרומטר. UW: unwounded, W:.. Quantitation פצוע (ב) לקוטר טבעת אקטין מסריקות קו, 4 סריקות קו לחיים (מנוקדות קווים אדומים בפנל (), WT) <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/51959/51959fig3highres.jpg" /> איור 3. עוריות פציעה מפעילה תגובה חיסונית מולדת. נציג תמונות (WT unwounded, WT פצוע + 3 שעות) של NLP-29 -GFP (frIs7) אינדוקציה P אחרי פציעת מחט. בקנה מידה:. 200 מיקרומטר <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig3large.jpg" target="_blank">אנא לחץ כאן לצפייה</a>גרסה גדולה יותר של דמות זו. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> כתב </td><td> Transgene </td><td> הקרינה </td><td> אלל </td></tr><tr><td> סידן </td><td> Pcol-19-GCaMP3; Pcol-19-tdTomato </td><td> GFP / tdTomato </td><td> juIs319 X </td></tr><tr><td> אקטין </td><td> Pcol-19-GFP :: moesin </td><td> GFP </td><td> juIs352 אני </td></tr><tr><td> NLP-29 </td><td> Pnlp-29-GFP / Pcol-12-DsRed </td><td> GFP / DsRed </td><td> frIs7 IV </td></tr></tbody></table> Transgenes הטבלה 1. השתמשה במבחני תגובת פצע. טבלה זו מפרטת chromosomally משולבת transgenes זמין במרכז Caenorhabditis הגנטיקה (http://www.cbs.umn.edu/research/resources/cgc). <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> שם גן </td><td> רצף </td></tr><tr><td> NLP-29 </td><td> F: cttctcgcctgcttcatggc </td></tr><tr><td> R: gtccgtatccaccatatcctcc </td></tr><tr><td> NLP-30 </td><td> F: TTCTTCTCGCCTGCTTCATGG </td></tr><tr><td> R: CATAACCTCTACCATATCCACCG </td></tr><tr><td> cnc-1 </td><td> F: gccattgtcgccatttcctc </td></tr><tr><td> R: cctccatacattggatatcctc </td></tr><tr><td> cnc-5 </td><td> F: CTTCTTCTAGCAATGCTCGCTC </td></tr><tr><td> R: GTATCCTCCACCATACCCTCC </td></tr><tr><td> ama-1 </td><td> F: ACTCAGATGACACTCAACAC </td></tr><tr><td> R: GAATACAGTCAACGACGGAG </td></tr><tr><td> SNB-1 </td><td> F: tccagcagacacaagctcagg </td></tr><tr><td> R: gagacaacttctgatcacgctc </td></tr></tbody></table> Primers הטבלה 2. משמש לRT-PCR של תמלילי AMP. העבודה ריכוז היא 0.2 מיקרומטר. SNB-1 משמש כבקרה פנימית.

Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity.

שיטות לעור פציעה ומבחנים לתגובות פצע ב<em&gt; C. elegans</em

The C. elegans epidermis and cuticle form a simple yet sophisticated skin layer that can repair localized damage resulting from wounding. Studies of wound ...

methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans

Universidad San Sebastian

Research

JoVE Journal

Biology

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

10.3K Views.  University of California, San Diego. The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity. 

Video: Methods for Skin Wounding and Assays for Wound Responses in C. elegans

In vivo Laser Axotomy in C. elegans

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron is damaged by injury or disease, it may regenerate. Cell-intrinsic and extrinsic factors influence the ability of a neuron to regenerate and restore function. Recently, the nematode C. elegans has emerged as an excellent model organism to identify genes and signaling pathways that influence the regeneration of neurons1-6. The main way to initiate neuronal regeneration in C. elegans is laser-mediated cutting, or axotomy. During axotomy, a fluorescently-labeled neuronal process is severed using high-energy pulses. Initially, neuronal regeneration in C. elegans was examined using an amplified femtosecond laser5. However, subsequent regeneration studies have shown that a conventional pulsed laser can be used to accurately sever neurons in vivo and elicit a similar regenerative response1,3,7.
We present a protocol for performing in vivo laser axotomy in the worm using a MicroPoint pulsed laser, a turnkey system that is readily available and that has been widely used for targeted cell ablation. We describe aligning the laser, mounting the worms, cutting specific neurons, and assessing subsequent regeneration. The system provides the ability to cut large numbers of neurons in multiple worms during one experiment. Thus, laser axotomy as described herein is an efficient system for initiating and analyzing the process of regeneration.

In vivo Laser Axotomy in C. elegans

A protocol to cut neurons in C. elegans with a MicroPoint pulsed laser is presented. We describe setting up the system, immobilizing worms, and severing labeled neurons. Advantages include a relatively low-cost system and the ability to sever neuronal processes or ablate cells in vivo.

בשנת vivo לייזר Axotomy ב C. elegans

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron ...

Neuroscience

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to maintain cellular homeostasis. Puncture injury with glass needles provides a direct method to trigger a rapid epidermal wound response that activates wound transcriptional reporters, which can be visualized by a localized reporter signal in living embryos or larvae. Puncture or laser injury also provides signals that promote the recruitment of hemocytes to the wound site. Surprisingly, severe (through and through) puncture injury in late stage embryos only rarely disrupts normal embryonic development, as greater than 90% of such wounded embryos survive to adulthood when embryos are injected in an oil medium that minimizes immediate leakage of hemolymph from puncture sites. The wound procedure does require micromanipulation of the Drosophila embryos, including manual alignment of the embryos on agar plates and transfer of the aligned embryos to microscope slides. The Drosophila epidermal wound response assay provides a quick system to test the genetic requirements of a variety of biological functions that promote wound healing, as well as a way to screen for potential chemical compounds that promote wound healing. The short life cycle and easy culturing routine make Drosophila a powerful model organism. Drosophila clean wound healing appears to coordinate the epidermal regenerative response, with the innate immune response, in ways that are still under investigation, which provides an excellent system to find conserved regulatory mechanisms common to Drosophila and mammalian epidermal wounding.

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The embryonic epidermis of very late stage Drosophila embryos provides an in vivo system for rapid puncture wound response analysis and can be combined with genetic manipulations or chemical microinjection treatments to advance studies in wound healing for translation into mammalian models.

Assay וMicroinjection פצע<em&gt; בvivo</em&gt; לוקליזציה של עוריות פצע הכתבים תגובה ב<em&gt; דרוזופילה</em&gt; עוברים.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to ...

Bioengineering

A Device for Performing Cell Migration/Wound Healing in a 96-Well Plate

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor metastasis. In this assay, cells are grown to form a confluent monolayer and a mechanical wound is created by scratching with a device. Then the migration rate of the cells towards the denuded area can be monitored by imaging. Our 8-channel mechanical wounder is designed to tackle most of the problems associated with the cell migration assay. Firstly, our wounder can be easily sterilized by autoclaving or with common disinfectants. Secondly, the individual adjustable pins allow even contact with the cell culture plate so that sharp and reproducible wounds can be created. Thirdly, the guiding bars on both sides of the wounder ensure consistent wounding position in each well. The use of disposable plastic pipette tips for wounding can further provide better handling of the wounder as well as to minimize cross-contamination. In conclusion, our cell wounder can provide researchers with a user friendly and reproducible device for performing the cell migration assay using the standard 96-well culture plate.

Here, we present a protocol to perform a semi-high throughput cell migration assay on a 96-well cell culture plate. This protocol is a fast, simple and economical method to create consistent scratch wounds on a cell monolayer.

מכשיר לביצוע נדידת תאים / ריפוי פצעים צלחת 96-ובכן

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor ...

Developmental Biology

A Drosophila Model to Study Wound-induced Polyploidization

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it contains more than the diploid copy of its chromosomes, which is a result of endoreplication or cell fusion. In tissue repair, wound-induced polyploidization (WIP) has been found to be a conserved healing strategy from fruit flies to vertebrates. WIP has several advantages over cell proliferation, including resistance to oncogenic growth and genotoxic stress. The challenge has been to identify why polyploid cells arise and how these unique cells function. Provided is a detailed protocol to study WIP in the adult fruit fly epithelium where polyploid cells are generated within 2 days after a puncture wound. Taking advantage of D. melanogaster&#39;s extensive genetic tool kit, the genes required to initiate and regulate WIP, including Myc, have begun to be identified. Continued studies using this method can reveal how other genetic and physiological variables including sex, diet, and age regulate and influence WIP&#39;s function.

A Drosophila Model to Study Wound-induced Polyploidization

Wound-induced polyploidization is a conserved tissue repair strategy where cells grow in size instead of dividing to compensate for cell loss. Here is a detailed protocol on how to use the fruit fly as a model to measure ploidy and its genetic regulation in epithelial wound repair.

מודל Drosophila לחקר פוליפלואידים הנגרמים על ידי פצע

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it ...

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the influence of mechanical stress on cellular function is still poorly understood. In part, this knowledge gap exists because few tools enable simultaneous deformation of tissue and cells, imaging of cellular activity in live animals, and efficient restriction of motility in otherwise highly mobile model organisms, such as the nematode Caenorhabditis elegans. The small size of C. elegans makes them an excellent match to microfluidics-based research devices, and solutions for immobilization have been presented using microfluidic devices. Although these devices allow for high-resolution imaging, the animal is fully encased in polydimethylsiloxane (PDMS) and glass, limiting physical access for delivery of mechanical force or electrophysiological recordings. Recently, we created a device that integrates pneumatic actuators with a trapping design that is compatible with high-resolution fluorescence microscopy. The actuation channel is separated from the worm-trapping channel by a thin PDMS diaphragm. This diaphragm is deflected into the side of a worm by applying pressure from an external source. The device can target individual mechanosensitive neurons. The activation of these neurons is imaged at high-resolution with genetically-encoded calcium indicators. This article presents the general method using C. elegans strains expressing calcium-sensitive activity indicator (GCaMP6s) in their touch receptor neurons (TRNs). The method, however, is not limited to TRNs nor to calcium sensors as a probe, but can be expanded to other mechanically-sensitive cells or sensors.

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

New tools for mechanobiology research are needed to understand how mechanical stress activates biochemical pathways and elicits biological responses. Here, we showcase a new method for selective mechanical stimulation of immobilized animals with a microfluidic trap allowing high-resolution imaging of cellular responses.

שימוש בהתקן מיקרופלואידיקה גירוי מכני, רזולוציה גבוהה הדמיה של C. elegans

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the ...

Assessment of Acute Wound Healing using the Dorsal Subcutaneous Polyvinyl Alcohol Sponge Implantation and Excisional Tail Skin Wound Models.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine models provide valuable mechanistic insight into these processes; however, no single model fully addresses all aspects of the wound healing response. Instead, it is ideal to use multiple models to address the different aspects of wound healing. Here, two different methods that address diverse aspects of the wound healing response are described. In the first model, polyvinyl alcohol sponges are subcutaneously implanted along the mouse dorsum. Following sponge retrieval, cells can be isolated by mechanical disruption, and fluids can be extracted by centrifugation, thus allowing for a detailed characterization of cellular and cytokine responses in the acute wound environment. A limitation of this model is the inability to assess the rate of wound closure. For this, a tail skin excision model is utilized. In this model, a 10 mm x 3 mm rectangular piece of tail skin is excised along the dorsal surface, near the base of the tail. This model can be easily photographed for planimetric analysis to determine healing rates and can be excised for histological analysis. Both described methods can be utilized in genetically altered mouse strains, or in conjunction with models of comorbid conditions, such as diabetes, aging, or secondary infection, in order to elucidate wound healing mechanisms.

Here, two murine wound healing models are described, one designed to assess cellular and cytokine wound healing responses and the other to quantify the rate of wound closure. These methods can be used with complex disease models such as diabetes to determine mechanisms of various aspects of poor wound healing.

הערכה של ריפוי בפצע חריפה באמצעות השרכה העור מפוליויניל כוהל של הרקמה העורית והזנב Excisional הפצע מודלים.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine ...

Immunology and Infection

Scratch Migration Assay and Dorsal Skinfold Chamber for In Vitro and In Vivo Analysis of Wound Healing

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective treatment. Appropriate in vitro and in vivo approaches are essential for the identification of new target molecules for drug treatments to improve the skin wound healing process. We identified the &#946;3 subunit of voltage-gated calcium channels (Cav&#946;3) as a potential target molecule to influence the wound healing in two independent assays, i.e., the in vitro scratch migration assay and the in vivo dorsal skinfold chamber model. Primary mouse embryonic fibroblasts (MEFs) acutely isolated from wild-type (WT) and Cav&#946;3-deficient mice (Cav&#946;3 KO) or fibroblasts acutely isolated from WT mice treated with siRNA to down-regulate the expression of the Cacnb3 gene, encoding Cav&#946;3, were used. A scratch was applied on a confluent cell monolayer and the gap closure was followed by taking microscopic images at defined time points until complete repopulation of the gap by the migrating cells. These images were analyzed, and the cell migration rate was determined for each condition. In an in vivo assay, we implanted a dorsal skinfold chamber on WT and Cav&#946;3 KO mice, applied a defined circular wound of 2 mm diameter, covered the wound with a glass coverslip to protect it from infections and desiccation, and monitored the macroscopic wound closure over time. Wound closure was significantly faster in Cacnb3-gene-deficient mice. Because the results of the in vivo and the in vitro assays correlate well, the in vitro assay may be useful for the high-throughput screening before validating the in vitro hits by the in vivo wound healing model. What we have shown here for wild-type and Cav&#946;3-deficient mice or cells might also be applicable for specific molecules other than Cav&#946;3.

Here, we present a protocol for an in vitro scratch assay using primary fibroblasts and for an in vivo skin wound healing assay in mice. Both assays are straightforward methods to assess in vitro and in vivo wound healing.

שיטת העברת שריטות וחדר מתקפל לחלל מתורבת בניתוח Vivo של ריפוי פצעים

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective ...

Medicine

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed under anoxia for 20 hr&#160;(simulated ischemia), and subsequently moved to a normal atmosphere with food (simulated reperfusion). This experimental paradigm results in increased death and neuronal damage, and techniques are presented to assess organism viability, alterations to the morphology of touch neuron processes, as well as touch sensitivity, which represents the behavioral output of neuronal function. Finally, a method for constructing hypoxic incubators using common kitchen storage containers is described. The addition of a mass flow control unit allows for alterations to be made to the gas mixture in the custom incubators, and a circulating water bath allows for both temperature control and makes it easy to identify leaks. This method provides a low cost alternative to commercially available units.

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

A protocol is described that uses anoxia/starvation in C. elegans to model ischemia/reperfusion. Functional outcomes include increased mortality, visible abnormalities in GFP-labeled neuronal processes, and impaired behavioral responses that require neuronal function.

דגם אנוקסיה רעב לאיסכמיה / reperfusion ב<em&gt; ג elegans</em

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed ...

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

All animal organs, from the skin to eyes to intestines, are covered with sheets of epithelial cells that allow them to maintain homeostasis while protecting them from infection. Therefore, it is not surprising that the ability to repair epithelial wounds is critical to all metazoans. Epithelial wound healing in vertebrates involves overlapping processes, including inflammatory responses, vascularization, and re-epithelialization. Regulation of these processes involves complex interactions between epithelial cells, neighboring cells, and the extracellular matrix (ECM); the ECM contains structural proteins, regulatory proteins, and active small molecules. This complexity, together with the fact that most animals have opaque tissues and inaccessible ECMs, makes wound healing difficult to study in live animals. Much work on epithelial wound healing is therefore performed in tissue culture systems, with a single epithelial cell-type plated as a monolayer on an artificial matrix. Clytia hemisphaerica (Clytia) provides a unique and exciting complement to these studies, allowing epithelial wound healing to be studied in an intact animal with an authentic ECM. The ectodermal epithelium of Clytia is a single layer of large squamous epithelial cells, allowing high-resolution imaging using differential interfering contrast (DIC) microscopy in living animals. The absence of migratory fibroblasts, vasculature, or inflammatory responses makes it possible to dissect the critical events in re-epithelialization in vivo. The healing of various types of wounds can be analyzed, including single-cell microwounds, small and large epithelial wounds, and wounds that damage the basement membrane. Lamellipodia formation, purse string contraction, cell stretching, and collective cell migration can all be observed in this system. Furthermore, pharmacological agents can be introduced via the ECM to modify cell:ECM interactions and cellular processes in vivo. This work shows methods for creating wounds in live Clytia, capturing movies of healing, and probing healing mechanisms by microinjecting reagents into the ECM.

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

This paper describes a method to create wounds in the epithelium of a live Clytia hemisphaerica medusa and image wound healing at a high resolution in vivo. Additionally, a technique to introduce dyes and drugs to perturb signaling processes in the epithelial cells and extracellular matrix during wound healing is presented.

אפיון ריפוי פצעי אפיתל in vivo באמצעות אורגניזם המודל הקנידרי Clytia hemisphaerica

All animal organs, from the skin to eyes to intestines, are covered with sheets of epithelial cells that allow them to maintain homeostasis while ...

Epidermal Laser Wounding: Inducing Localized Damage to Examine Repair Processes in C. elegans

Source: Xu, S. and Chisholm, A. D. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/51959/methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans">Methods for Skin Wounding and Assays for Wound Responses in&#160;C. elegans.</a>&#160;J. Vis. Exp.&#160;(2014).
This video introduces a method of laser wounding, which is used to cause very precise injuries in the worm epidermis.&#160; The sample protocol is from a study of wound response and repair.

פגיעה בלייזר אפידרמיס: גרימת נזק מקומי לבחינת תהליכי תיקון ב- C. elegans

Source: Xu, S. and Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in&#160;C. elegans.&#160;J. Vis. Exp.&#160;(2014).
This video ...

שיטות לעור פציעה ומבחנים לתגובות פצע ב

Summary

Explore More Videos

Chapters in this video