Name: methods for skin wounding and assays for wound responses in c. elegans
Uploaded: 2014-12-03T13:00:00.000+00:00
Duration: 9 min 6 s
Description: Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Needle wounding methods for C. elegans were first developed by Nathalie Pujol and Jonathan Ewbank; we thank Nathalie Pujol for comments on the manuscript. Work in our laboratory on C. elegans epidermal wound repair is supported by a grant from the NIH to A.D.C. (R01 GM054657).

<ol>
	<li>Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair+and+regeneration.">Wound repair and regeneration.</a> Nature. 453, 314-321 (2008).</li><li>Sonnemann, K. J., Bement, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wound+repair:+toward+understanding+and+integration+of+single-cell+and+multicellular+wound+responses.">Wound repair: toward understanding and integration of single-cell and multicellular wound responses.</a> Annu Rev Cell Dev Biol. 27, 237-263 (2011).</li><li>Xu, S., Chisholm, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+G&#945;q-Ca2++signaling+pathway+promotes+actin-mediated+epidermal+wound+closure+in+C.+elegans.">A G&#945;q-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.</a> Curr Biol. 21, 1960-1967 (2011).</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+innate+immune+responses+to+infection+and+wounding+in+the+C.+elegans+epidermis.">Distinct innate immune responses to infection and wounding in the C. elegans epidermis.</a> Curr Biol. 18, 481-489 (2008).</li><li>Chisholm, A. D., Xu, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Caenorhabditis+elegans+epidermis+as+a+model+skin.+II:+differentiation+and+physiological+roles.">The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles.</a> Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook : the online review of C. elegans biology. , 1-11 .</li><li>Bargmann, C. I., Avery, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+killing+of+cells+in+Caenorhabditis+elegans.+Methods+in+cell+biology.">Laser killing of cells in Caenorhabditis elegans. Methods in cell biology.</a> 48, 225-250 .</li><li>Pujol, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-fungal+innate+immunity+in+C.+elegans+is+enhanced+by+evolutionary+diversification+of+antimicrobial+peptides.">Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.</a> PLoS Pathog. 4, (2008).</li><li>Tong, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+Caenorhabditis+elegans+epidermal+damage+responses+by+death-associated+protein+kinase.">Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase.</a> Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).</li><li>Zugasti, O., Ewbank, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroimmune+regulation+of+antimicrobial+peptide+expression+by+a+noncanonical+TGF-beta+signaling+pathway+in+Caenorhabditis+elegans+epidermis.">Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis.</a> Nat Immunol. 10, 249-256 (2009).</li><li>Zhao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip-based+C.+elegans+microinjection+system+for+investigating+cell-cell+communication+in+vivo.">Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo.</a> Biosensor., &amp; Bioelectronics. 50, 28-34 (2013).</li><li>Jansson, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adhesion+of+Conidia+of+Drechmeria+coniospora+to+Caenorhabditis+elegans+Wild+Type+and+Mutants.">Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants.</a> J Nematol. 26, 430-435 (1994).</li><li>Hodgkin, J., Kuwabara, P. E., Corneliussen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+bacterial+pathogen,+Microbacterium+nematophilum,+induces+morphological+change+in+the+nematode+C.+elegans.">A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans.</a> Curr Biol. 10, 1615-1618 (2000).</li><li>Hochbaum, D., Ferguson, A. A., Fisher, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+C.+elegans+by+biolistic+transformation.">Generation of transgenic C. elegans by biolistic transformation.</a> J Vis Exp. (42), (2010).</li><li>Hashmi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+nematodes+using+arrays+of+micromechanical+piercing+structures.">Genetic transformation of nematodes using arrays of micromechanical piercing structures.</a> BioTechniques. 19, 766-770 (1995).</li></ol>

The authors are not aware of any competing interests.

الأساليب المقدمة هنا للإبرة وجرح الليزر توفر نهج تكميلية لتقييم قدرة ظهارة البشرة لإصلاح الضرر. جرح الليزر محلية نسبيا و(اعتمادا على تكوين ليزر) يمكن أن تقتصر على البشرة، في حين جرح إبرة يعطل البشرة، بشرة، والمرجح الأغشية الطابق السفلي الداخلية. إبرة جرح قد تشبه بشكل أكثر دقة الجراح التي مسببات الأمراض أو الأضرار الميكانيكية في البيئة الطبيعية التي لحقت. وكقاعدة عامة، تتطلب جرح إبرة مزيد من الممارسة لتحقيق الجروح الدقيقة التي تتوافق مع بقاء الحيوان. والاستجابات الخلوية إلى إبرة والليزر عرض جرح أوجه التشابه كثيرة. ومع ذلك فإنه تجدر الإشارة إلى أن تشكيل حلقات الأكتين لا وحظ بتكاثر بعد الفيمتو ثانية جرح الليزر. وجود قيود على ثقب إبرة هو أنه ليس الجرح الدقيق: الإبرة أيضا الأنسجة الداخلية الأضرار التي لدودة مساهماتلم يتم التحقيق في البقاء على قيد الحياة. ومن شأن تعديل ممكن من هذا البروتوكول هو الجمع بين القائم ميكروفلويديك نظام حقن مكروي 11 و صحفيين الفلورسنت لأداء جرح المادية أكثر دقة. الطرق جرح إبرة والليزر مفصلة هنا هي بسيطة لكنها إلى حد ما على العمالة المكثفة، وفي أحسن الأحوال المتوسطة الإنتاجية، مما يجعل من الصعب استخدام النهج الجينومية أو البيوكيميائية لتوصيف استجابة الجرح. يمكن أن يتم تسليم بشرة اختراق مسببات الأمراض مثل الفطريات أو الطفيليات 12،13 إلى السكان أكبر من الحيوانات، والتي قد تؤدي الاستجابات التي تتداخل مع الاستجابة للإصابة، بعد إدخال تعقيدات إضافية من استجابات محددة الممرض. سوف تكون هناك حاجة إلى مزيد من العمل لاستكشاف ما إذا كانت أساليب غير الحيوية الأخرى مثل القصف الباليستي 14 أو صفائف هياكل ثقب الميكرو ميكانيكية 15 يمكن تكييفها لجرح على نطاق واسع.

آليات الشفاء الجلد الجروح ذات أهمية بيولوجية أساسية وذات الصلة بصحة الإنسان. ويضم التئام الجروح في الفقاريات والثدييات سلسلة معقدة من استجابات منسقة من أنسجة متعددة ويشير 1. كثير من الكائنات نموذج الجيني بسيطة هي أيضا قادرة على شفاء الجروح الجلدية 2. ولذلك من مصلحة لتحليل نماذج الانقياد وراثيا من إصلاح الجرح الجلد. نحن وغيرنا قد بدأت في استخدام انواع معينة ايليجانس نموذجا جديدا للشفاء الجرح الجلد 3،4. والهدف من هذا البروتوكول هو تمكين مجموعة أوسع من الباحثين لاستخدام C. ايليجانس كأداة للتحقيق في الآليات الجزيئية والخلوية من البشرة التئام الجروح. وC. ويضم ايليجانس الجلد البشرة (المعروف أيضا باسم اللحمة) وبشرة خارج الخلية 5. يتم تشكيل البشرة الكبار من عدد صغير من syncytia متعدد النوى، والتي من أكبر هو مخلى كnown كما hyp7. البشرة هي ظهارة البسيطة التي تفرز بشرة على سطحه قمي. الجلد يمكن أن يدافع بنشاط ضد مسببات الأمراض اختراق الجلد وإصلاح الجروح الصغيرة (4). إصلاح الجرح من C. ايليجانس الجلد هو قوي، وتقريبا جميع الحيوانات البرية نوع البقاء على قيد الحياة يمكن البقاء على قيد الحياة الجروح الصغيرة الناجمة عن الإبر، أو تلف الجلد المحلية التي تسببها أشعة الليزر. C. ايليجانس جرح الجلد مشغلات مجموعة من الردود، بما في ذلك البشرة استجابة فطرية المناعة، وإغلاق الجروح، وتشكيل ندبة 4. البشرة البالغين في مرحلة ما بعد الإنقسامية، وينطوي على التئام الجروح الاستجابات الخلوية المحلية في مقابل انتشار البشرة أو الهجرة الخلية. لقد أثبتنا أن جرح الجلد يتسبب في زيادة كبيرة ومطردة في البشرة الكالسيوم 2+، الأمر الذي يتطلب قناة TRPM غشاء تحويل الغاز إلى سوائل-2 والداخلية الكالسيوم 2+ مخازن 3. مطلوب البشرة الكالسيوم 2+ إشارة لتشكيل وإغلاق حلقات F-أكتين في التعليم الجامعيالموقع اوند. كما يدفع جرح الاستجابات المناعية الفطرية التي تنشط النسخ من المكاتب الإقليمية للمرأة مثل البرمجة اللغوية العصبية-29. النسخ الناجم عن جرح المكاتب الإقليمية للمرأة يعتمد على TIR-1 / PMK-1 P38 MAP كيناز سلسلة يتصرف بشكل مستقل في البشرة 4. سوف العيوب سواء في إشارة مسار الكالسيوم 2+ أو في الاستجابة المناعية الفطرية يؤدي إلى انخفاض البقاء على قيد الحياة بعد إصابة. هيكل بسيط نسبيا من C. ايليجانس البشرة، قابلية الإستطراق الجيني والمزايا لفي الجسم الحي التصوير تجعل من نظام ممتاز لدراسة جوانب متعددة من إصلاح الجرح. هنا نقدم بروتوكولات الطرق الشائعة اثنين من جرح: جرح إبرة وجرح الليزر. جرح إبرة لا يتطلب أي معدات متخصصة (غير مجتذب إبرة)، ومع خبرة لا يمكن أن يؤديها على مئات من الديدان يوميا. يتم تنفيذ جرح إبرة على الحيوانات التي تنمو على لوحات أجار. في المقابل، يتم إجراء جرح الليزر على أنيسالحيوانات thetized التي شنت على أجار منصات تحت ساترة، ومناسب للتصوير المباشر لالاستجابات الخلوية للتلف.

<table><tbody><tr><td>Agarose</td><td>Denville Scientific</td><td>CA3510-8</td><td></td></tr><tr><td>Plastic Petri plate</td><td>Tritech Research</td><td>T3308</td><td>60 mm</td></tr><tr><td>Levamisole</td><td>Sigma</td><td>L9756</td><td>12 mM</td></tr><tr><td>Borosilicate glass capillary</td><td>World Precision Instruments</td><td>1B100F-4</td><td></td></tr><tr><td>Needle puller</td><td>Sutter Instrument&amp;nbsp;</td><td>P-2000</td><td></td></tr><tr><td>Worm pick (platinum wire)</td><td>Tritech Research</td><td>PT-9010</td><td></td></tr><tr><td>M9 solution</td><td>Home-made</td><td></td><td>3 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 6 g Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;, 5 g NaCl, 1 ml 1 M MgSO&lt;sub&gt;4&lt;/sub&gt;, H&lt;sub&gt;2&lt;/sub&gt;O to 1 liter. Sterilize by autoclaving</td></tr><tr><td>Trizol</td><td>Invitrogen</td><td>15596026</td><td>Use 500 ml for 50 worms</td></tr><tr><td>iQ SYBR Green</td><td>Bio-Rad</td><td>1708882</td><td></td></tr><tr><td>SuperScript III</td><td>Invitrogen</td><td>18080-051</td><td></td></tr><tr><td>PCR machine</td><td>Bio-Rad</td><td>C1000/CFX96</td><td></td></tr><tr><td>96-well PCR tubes</td><td>Bio-Rad</td><td>MLL9601</td><td></td></tr><tr><td>Image analysis software</td><td>Molecular Devices</td><td>Metamorph</td><td></td></tr></tbody></table>

methods for skin wounding and assays for wound responses in c. elegans

وC. ايليجانس البشرة وبشرة تشكل طبقة الجلد بعد متطورة البسيطة التي يمكن إصلاح الأضرار المحلية الناجمة عن اصابة. لقد أضاءت الدراسات الردود الجرح وإصلاح في هذا النموذج فهمنا للهيكل الخلية وردود الجينومية إلى تلف الأنسجة. طريقتين الأكثر استخداما لالجرح C. ايليجانس الجلد البالغين من الغرزات مع الإبر حقن مكروي، وأشعة الليزر المحلي. إبرة اصابة محليا يعطل بشرة، البشرة، وما يرتبط بها من المصفوفة خارج الخلية، وأيضا قد تضر الأنسجة الداخلية. النتائج أشعة الليزر في الضرر أكثر محلية. جرح يتسبب في سلسلة من ردود يعاير بسهولة بما في ذلك البشرة مرتفعة الكالسيوم 2+ (ثواني دقيقة)، وتشكيل وإغلاق حلقة التي تحتوي على الأكتين في موقع الجرح (1-2 ساعة)، والنسخ مرتفعة من الببتيد الجينات المضادة للميكروبات (2-24 ساعة)، وتشكيل ندبة. أساسا كل نوع البرية الحيوانات الكبار البقاء على قيد الحياة جرح، حيثكما المسوخ المعيبة في إصلاح الجرح أو استجابات أخرى تظهر انخفاض البقاء على قيد الحياة. وتعرض بروتوكولات مفصلة لإبرة وجرح الليزر، وفحوصات لتحديد الكميات والتصور الردود الجروح والعمليات إصلاح (ديناميات الكالسيوم، وديناميات الأكتين، مضادات الميكروبات الببتيد الاستقراء، والبقاء على قيد الحياة).

سوف الليزر أو جرح إبرة يؤدي الارتفاع السريع والمستمر في البشرة مستويات الكالسيوم، كما تصور مع أجهزة استشعار الكالسيوم مثل GCaMPs (الشكل 1). يحدث ارتفاع الكالسيوم في غضون ثوان، ويبقى مرتفعا لعشرات من الدقائق. إبرة اصابة بتكاثر النتائج في تشكيل حلقات F-أكتين في مواقع الجرح (الشكل 2)؛ هذه تظهر في غضون دقائق، وتدريجيا على مقربة أكثر من 1-2 ساعة بعد اصابة. وكثير من الأحيان أقل شكلت حلقات الأكتين بعد إصابة الليزر أكثر دقة. كلا إبرة والليزر جرح تحفز التعبير عن البشرة الببتيدات المضادة للميكروبات (إس) مثل البرمجة اللغوية العصبية-29، الكشف مع الصحفيين النسخي (الشكل 3). AMP تحريض واضح خلال 2-4 ساعة بعد اصابة ويستمر حوالي 24 ساعة. جرح إبرة من النوع البري لا يجب أن تؤثر تأثيرا كبيرا الجدوى (قياس في 24 ساعة بعد إصابة) أو مدى الحياة. <img alt="الشكل (1)" src="/files/ftp_upload/51959/51959fig1highres.jpg" /> الشكل 1. الليزر جرح يتسبب في 2+ استجابة الكالسيوم في C. البشرة ايليجانس. (A) البشرة GCaMP3 مضان (P-19 عمود -GCaMP3 (juIs319)) مستويات بعد الفيمتو ثانية جرح الليزر. عرض الوحشي من البشرة في الأمامي للجسم. س، الجرح الليزر. N، البشرة النواة. الغزل القرص مبائر الصور، رمز الشدة. UW: المعافين، W: الجرحى (B) الكميات من GCaMP3 ΔF / F 0 في 20، 40، و 60 ميكرون من موقع الجرح. أثر تمثيلي. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig1large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/51959/51959fig2highres.jpg" /> الشكل 2. إبرة جرح مشغلات الأكتين البلمرة حول الموقع الجروح. (A) </sترونج&gt; الجراح إبرة البشرة تؤدي تشكيل حلقات الأكتين في هامش الجرح، وتصور مع P-19- العقيد GFP-moesin (juIs352). على نطاق و: 10 ميكرون. UW: المعافين، W:.. جريحا (B) الكميات من قطر حلقة الأكتين من مسح الخط، 4 بمسح خط لكل حيوان (منقط الخطوط الحمراء في لوحة (A)، WT) <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (3)" src="/files/ftp_upload/51959/51959fig3highres.jpg" /> الشكل 3. البشرة جرح ينشط الاستجابة المناعية الفطرية. صور الممثل (WT المعافين، وأصيب WT + 3 ساعة) من البرمجة اللغوية العصبية P-29 -GFP (frIs7) الحث بعد إصابة الإبرة. مقياس: 200 ميكرون <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51959/51959fig3large.jpg" target="_blank">الرجاء انقر هنا لعرض</a>نسخة أكبر من هذا الرقم. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> مراسل صحفي </td><td> التحوير </td><td> مضان </td><td> أليل </td></tr><tr><td> الكلسيوم </td><td> Pcol-19-GCaMP3، Pcol-19-tdTomato </td><td> GFP / tdTomato </td><td> juIs319 X </td></tr><tr><td> الأكتين </td><td> Pcol-19-GFP :: moesin </td><td> GFP </td><td> juIs352 I </td></tr><tr><td> البرمجة اللغوية العصبية-29 </td><td> Pnlp-29-GFP / Pcol-12-DsRed </td><td> GFP / DsRed </td><td> frIs7 IV </td></tr></tbody></table> الجدول 1. الجينات المحورة المستخدمة في المقايسات استجابة الجروح. هذا الجدول يسرد صبغويا الجينات المحورة المتاحة في مركز علم الوراثة انواع معينة (http://www.cbs.umn.edu/research/resources/cgc) متكاملة. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم الجين </td><td> تسلسل </td></tr><tr><td> البرمجة اللغوية العصبية-29 </td><td> F: cttctcgcctgcttcatggc </td></tr><tr><td> R: gtccgtatccaccatatcctcc </td></tr><tr><td> البرمجة اللغوية العصبية-30 </td><td> F: TTCTTCTCGCCTGCTTCATGG </td></tr><tr><td> R: CATAACCTCTACCATATCCACCG </td></tr><tr><td> التصنيع باستخدام الحاسب الآلي-1 </td><td> F: gccattgtcgccatttcctc </td></tr><tr><td> R: cctccatacattggatatcctc </td></tr><tr><td> التصنيع باستخدام الحاسب الآلي-5 </td><td> F: CTTCTTCTAGCAATGCTCGCTC </td></tr><tr><td> R: GTATCCTCCACCATACCCTCC </td></tr><tr><td> AMA-1 </td><td> F: ACTCAGATGACACTCAACAC </td></tr><tr><td> R: GAATACAGTCAACGACGGAG </td></tr><tr><td> البنك المركزي السويسري-1 </td><td> F: tccagcagacacaagctcagg </td></tr><tr><td> R: gagacaacttctgatcacgctc </td></tr></tbody></table> الجدول 2. الاشعال تستخدم لRT-PCR النصوص AMP. تركيز العمل هو 0.2 ميكرومتر. ويقدم البنك الوطني السويسري-1 كما الرقابة الداخلية.

Watch this Scientific Journal Video about Methods for Skin Wounding and Assays for Wound Responses in C. elegans at JoVE.com

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity.

طرق للبشرة إصابة وفحوصات لالردود الجرح في<em&gt; C. ايليجانس</em

The C. elegans epidermis and cuticle form a simple yet sophisticated skin layer that can repair localized damage resulting from wounding. Studies of wound ...

methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans

Universidad San Sebastian

Research

JoVE Journal

Biology

Methods for Skin Wounding and Assays for Wound Responses in C. elegans

10.3K Views.  University of California, San Diego. The adult C. elegans skin is a tractable model for studies of epithelial wound responses, including wound closure, scar formation, and innate immunity. 

Video: Methods for Skin Wounding and Assays for Wound Responses in C. elegans

In vivo Laser Axotomy in C. elegans

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron is damaged by injury or disease, it may regenerate. Cell-intrinsic and extrinsic factors influence the ability of a neuron to regenerate and restore function. Recently, the nematode C. elegans has emerged as an excellent model organism to identify genes and signaling pathways that influence the regeneration of neurons1-6. The main way to initiate neuronal regeneration in C. elegans is laser-mediated cutting, or axotomy. During axotomy, a fluorescently-labeled neuronal process is severed using high-energy pulses. Initially, neuronal regeneration in C. elegans was examined using an amplified femtosecond laser5. However, subsequent regeneration studies have shown that a conventional pulsed laser can be used to accurately sever neurons in vivo and elicit a similar regenerative response1,3,7.
We present a protocol for performing in vivo laser axotomy in the worm using a MicroPoint pulsed laser, a turnkey system that is readily available and that has been widely used for targeted cell ablation. We describe aligning the laser, mounting the worms, cutting specific neurons, and assessing subsequent regeneration. The system provides the ability to cut large numbers of neurons in multiple worms during one experiment. Thus, laser axotomy as described herein is an efficient system for initiating and analyzing the process of regeneration.

In vivo Laser Axotomy in C. elegans

A protocol to cut neurons in C. elegans with a MicroPoint pulsed laser is presented. We describe setting up the system, immobilizing worms, and severing labeled neurons. Advantages include a relatively low-cost system and the ability to sever neuronal processes or ablate cells in vivo.

في Axotomy الليزر المجراة في C. ايليجانس

Neurons communicate with other cells via axons and dendrites, slender membrane extensions that contain pre- or post-synaptic specializations. If a neuron ...

Neuroscience

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to maintain cellular homeostasis. Puncture injury with glass needles provides a direct method to trigger a rapid epidermal wound response that activates wound transcriptional reporters, which can be visualized by a localized reporter signal in living embryos or larvae. Puncture or laser injury also provides signals that promote the recruitment of hemocytes to the wound site. Surprisingly, severe (through and through) puncture injury in late stage embryos only rarely disrupts normal embryonic development, as greater than 90% of such wounded embryos survive to adulthood when embryos are injected in an oil medium that minimizes immediate leakage of hemolymph from puncture sites. The wound procedure does require micromanipulation of the Drosophila embryos, including manual alignment of the embryos on agar plates and transfer of the aligned embryos to microscope slides. The Drosophila epidermal wound response assay provides a quick system to test the genetic requirements of a variety of biological functions that promote wound healing, as well as a way to screen for potential chemical compounds that promote wound healing. The short life cycle and easy culturing routine make Drosophila a powerful model organism. Drosophila clean wound healing appears to coordinate the epidermal regenerative response, with the innate immune response, in ways that are still under investigation, which provides an excellent system to find conserved regulatory mechanisms common to Drosophila and mammalian epidermal wounding.

Microinjection Wound Assay and In vivo Localization of Epidermal Wound Response Reporters in Drosophila Embryos.

The embryonic epidermis of very late stage Drosophila embryos provides an in vivo system for rapid puncture wound response analysis and can be combined with genetic manipulations or chemical microinjection treatments to advance studies in wound healing for translation into mammalian models.

حقن مكروي الجرح الفحص و<em&gt; في الجسم الحي</em&gt; توطين البشرة الجرح مراسلون الاستجابة في<em&gt; ذبابة الفاكهة</em&gt; الأجنة.

The Drosophila embryo develops a robust epidermal layer that serves both to protect the internal cells from a harsh external environment as well as to ...

Bioengineering

A Device for Performing Cell Migration/Wound Healing in a 96-Well Plate

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor metastasis. In this assay, cells are grown to form a confluent monolayer and a mechanical wound is created by scratching with a device. Then the migration rate of the cells towards the denuded area can be monitored by imaging. Our 8-channel mechanical wounder is designed to tackle most of the problems associated with the cell migration assay. Firstly, our wounder can be easily sterilized by autoclaving or with common disinfectants. Secondly, the individual adjustable pins allow even contact with the cell culture plate so that sharp and reproducible wounds can be created. Thirdly, the guiding bars on both sides of the wounder ensure consistent wounding position in each well. The use of disposable plastic pipette tips for wounding can further provide better handling of the wounder as well as to minimize cross-contamination. In conclusion, our cell wounder can provide researchers with a user friendly and reproducible device for performing the cell migration assay using the standard 96-well culture plate.

Here, we present a protocol to perform a semi-high throughput cell migration assay on a 96-well cell culture plate. This protocol is a fast, simple and economical method to create consistent scratch wounds on a cell monolayer.

جهاز لأداء الهجرة خلية / شفاء الجروح في لوحة 96-حسنا

The cell migration/wounding assay is a commonly used method to study cell migration and other biological processes, such as angiogenesis and tumor ...

Developmental Biology

A Drosophila Model to Study Wound-induced Polyploidization

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it contains more than the diploid copy of its chromosomes, which is a result of endoreplication or cell fusion. In tissue repair, wound-induced polyploidization (WIP) has been found to be a conserved healing strategy from fruit flies to vertebrates. WIP has several advantages over cell proliferation, including resistance to oncogenic growth and genotoxic stress. The challenge has been to identify why polyploid cells arise and how these unique cells function. Provided is a detailed protocol to study WIP in the adult fruit fly epithelium where polyploid cells are generated within 2 days after a puncture wound. Taking advantage of D. melanogaster&#39;s extensive genetic tool kit, the genes required to initiate and regulate WIP, including Myc, have begun to be identified. Continued studies using this method can reveal how other genetic and physiological variables including sex, diet, and age regulate and influence WIP&#39;s function.

A Drosophila Model to Study Wound-induced Polyploidization

Wound-induced polyploidization is a conserved tissue repair strategy where cells grow in size instead of dividing to compensate for cell loss. Here is a detailed protocol on how to use the fruit fly as a model to measure ploidy and its genetic regulation in epithelial wound repair.

نموذج دروسوفيليا لدراسة البوليسبليد الناجم عن الجروح

Polyploidy is a frequent phenomenon whose impact on organismal health and disease is still poorly understood. A cell is defined as polyploid if it ...

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the influence of mechanical stress on cellular function is still poorly understood. In part, this knowledge gap exists because few tools enable simultaneous deformation of tissue and cells, imaging of cellular activity in live animals, and efficient restriction of motility in otherwise highly mobile model organisms, such as the nematode Caenorhabditis elegans. The small size of C. elegans makes them an excellent match to microfluidics-based research devices, and solutions for immobilization have been presented using microfluidic devices. Although these devices allow for high-resolution imaging, the animal is fully encased in polydimethylsiloxane (PDMS) and glass, limiting physical access for delivery of mechanical force or electrophysiological recordings. Recently, we created a device that integrates pneumatic actuators with a trapping design that is compatible with high-resolution fluorescence microscopy. The actuation channel is separated from the worm-trapping channel by a thin PDMS diaphragm. This diaphragm is deflected into the side of a worm by applying pressure from an external source. The device can target individual mechanosensitive neurons. The activation of these neurons is imaged at high-resolution with genetically-encoded calcium indicators. This article presents the general method using C. elegans strains expressing calcium-sensitive activity indicator (GCaMP6s) in their touch receptor neurons (TRNs). The method, however, is not limited to TRNs nor to calcium sensors as a probe, but can be expanded to other mechanically-sensitive cells or sensors.

Using a Microfluidics Device for Mechanical Stimulation and High Resolution Imaging of C. elegans

New tools for mechanobiology research are needed to understand how mechanical stress activates biochemical pathways and elicits biological responses. Here, we showcase a new method for selective mechanical stimulation of immobilized animals with a microfluidic trap allowing high-resolution imaging of cellular responses.

استخدام جهاز ميكروفلويديكس لتحفيز الميكانيكية وتصوير قرار عالية من C. ايليجانس

One central goal of mechanobiology is to understand the reciprocal effect of mechanical stress on proteins and cells. Despite its importance, the ...

Assessment of Acute Wound Healing using the Dorsal Subcutaneous Polyvinyl Alcohol Sponge Implantation and Excisional Tail Skin Wound Models.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine models provide valuable mechanistic insight into these processes; however, no single model fully addresses all aspects of the wound healing response. Instead, it is ideal to use multiple models to address the different aspects of wound healing. Here, two different methods that address diverse aspects of the wound healing response are described. In the first model, polyvinyl alcohol sponges are subcutaneously implanted along the mouse dorsum. Following sponge retrieval, cells can be isolated by mechanical disruption, and fluids can be extracted by centrifugation, thus allowing for a detailed characterization of cellular and cytokine responses in the acute wound environment. A limitation of this model is the inability to assess the rate of wound closure. For this, a tail skin excision model is utilized. In this model, a 10 mm x 3 mm rectangular piece of tail skin is excised along the dorsal surface, near the base of the tail. This model can be easily photographed for planimetric analysis to determine healing rates and can be excised for histological analysis. Both described methods can be utilized in genetically altered mouse strains, or in conjunction with models of comorbid conditions, such as diabetes, aging, or secondary infection, in order to elucidate wound healing mechanisms.

Here, two murine wound healing models are described, one designed to assess cellular and cytokine wound healing responses and the other to quantify the rate of wound closure. These methods can be used with complex disease models such as diabetes to determine mechanisms of various aspects of poor wound healing.

تقييم التئام الجروح الحادة باستخدام دورسال تحت الجلد بوليفينيل الكحول الإسفنج زرع واستئصال الذيل نماذج الجرح الجلد.

Wound healing is a complex process that requires the orderly progression of inflammation, granulation tissue formation, fibrosis, and resolution. Murine ...

Immunology and Infection

Scratch Migration Assay and Dorsal Skinfold Chamber for In Vitro and In Vivo Analysis of Wound Healing

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective treatment. Appropriate in vitro and in vivo approaches are essential for the identification of new target molecules for drug treatments to improve the skin wound healing process. We identified the &#946;3 subunit of voltage-gated calcium channels (Cav&#946;3) as a potential target molecule to influence the wound healing in two independent assays, i.e., the in vitro scratch migration assay and the in vivo dorsal skinfold chamber model. Primary mouse embryonic fibroblasts (MEFs) acutely isolated from wild-type (WT) and Cav&#946;3-deficient mice (Cav&#946;3 KO) or fibroblasts acutely isolated from WT mice treated with siRNA to down-regulate the expression of the Cacnb3 gene, encoding Cav&#946;3, were used. A scratch was applied on a confluent cell monolayer and the gap closure was followed by taking microscopic images at defined time points until complete repopulation of the gap by the migrating cells. These images were analyzed, and the cell migration rate was determined for each condition. In an in vivo assay, we implanted a dorsal skinfold chamber on WT and Cav&#946;3 KO mice, applied a defined circular wound of 2 mm diameter, covered the wound with a glass coverslip to protect it from infections and desiccation, and monitored the macroscopic wound closure over time. Wound closure was significantly faster in Cacnb3-gene-deficient mice. Because the results of the in vivo and the in vitro assays correlate well, the in vitro assay may be useful for the high-throughput screening before validating the in vitro hits by the in vivo wound healing model. What we have shown here for wild-type and Cav&#946;3-deficient mice or cells might also be applicable for specific molecules other than Cav&#946;3.

Here, we present a protocol for an in vitro scratch assay using primary fibroblasts and for an in vivo skin wound healing assay in mice. Both assays are straightforward methods to assess in vitro and in vivo wound healing.

فحص الهجرة الصفر وغرفة الجلد السمرة لتحليل في المختبر وفي الجسم الحي للشفاء الجروح

Impaired cutaneous wound healing is a major concern for patients suffering from diabetes and for elderly people, and there is a need for an effective ...

Medicine

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed under anoxia for 20 hr&#160;(simulated ischemia), and subsequently moved to a normal atmosphere with food (simulated reperfusion). This experimental paradigm results in increased death and neuronal damage, and techniques are presented to assess organism viability, alterations to the morphology of touch neuron processes, as well as touch sensitivity, which represents the behavioral output of neuronal function. Finally, a method for constructing hypoxic incubators using common kitchen storage containers is described. The addition of a mass flow control unit allows for alterations to be made to the gas mixture in the custom incubators, and a circulating water bath allows for both temperature control and makes it easy to identify leaks. This method provides a low cost alternative to commercially available units.

An Anoxia-starvation Model for Ischemia/Reperfusion in C. elegans

A protocol is described that uses anoxia/starvation in C. elegans to model ischemia/reperfusion. Functional outcomes include increased mortality, visible abnormalities in GFP-labeled neuronal processes, and impaired behavioral responses that require neuronal function.

نموذج نقص الأكسجين المجاعة لنقص التروية / ضخه في<em&gt; C. ايليجانس</em

Protocols for anoxia/starvation in the genetic model organism C. elegans simulate ischemia/reperfusion. Worms are separated from bacterial food and placed ...

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

All animal organs, from the skin to eyes to intestines, are covered with sheets of epithelial cells that allow them to maintain homeostasis while protecting them from infection. Therefore, it is not surprising that the ability to repair epithelial wounds is critical to all metazoans. Epithelial wound healing in vertebrates involves overlapping processes, including inflammatory responses, vascularization, and re-epithelialization. Regulation of these processes involves complex interactions between epithelial cells, neighboring cells, and the extracellular matrix (ECM); the ECM contains structural proteins, regulatory proteins, and active small molecules. This complexity, together with the fact that most animals have opaque tissues and inaccessible ECMs, makes wound healing difficult to study in live animals. Much work on epithelial wound healing is therefore performed in tissue culture systems, with a single epithelial cell-type plated as a monolayer on an artificial matrix. Clytia hemisphaerica (Clytia) provides a unique and exciting complement to these studies, allowing epithelial wound healing to be studied in an intact animal with an authentic ECM. The ectodermal epithelium of Clytia is a single layer of large squamous epithelial cells, allowing high-resolution imaging using differential interfering contrast (DIC) microscopy in living animals. The absence of migratory fibroblasts, vasculature, or inflammatory responses makes it possible to dissect the critical events in re-epithelialization in vivo. The healing of various types of wounds can be analyzed, including single-cell microwounds, small and large epithelial wounds, and wounds that damage the basement membrane. Lamellipodia formation, purse string contraction, cell stretching, and collective cell migration can all be observed in this system. Furthermore, pharmacological agents can be introduced via the ECM to modify cell:ECM interactions and cellular processes in vivo. This work shows methods for creating wounds in live Clytia, capturing movies of healing, and probing healing mechanisms by microinjecting reagents into the ECM.

Characterizing Epithelial Wound Healing In Vivo Using the Cnidarian Model Organism Clytia hemisphaerica

This paper describes a method to create wounds in the epithelium of a live Clytia hemisphaerica medusa and image wound healing at a high resolution in vivo. Additionally, a technique to introduce dyes and drugs to perturb signaling processes in the epithelial cells and extracellular matrix during wound healing is presented.

توصيف التئام الجروح الظهارية في الجسم الحي باستخدام الكائن الحي النموذجي Cnidarian Clytia hemisphaerica

All animal organs, from the skin to eyes to intestines, are covered with sheets of epithelial cells that allow them to maintain homeostasis while ...

Epidermal Laser Wounding: Inducing Localized Damage to Examine Repair Processes in C. elegans

Source: Xu, S. and Chisholm, A. D. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/51959/methods-for-skin-wounding-and-assays-for-wound-responses-in-c-elegans">Methods for Skin Wounding and Assays for Wound Responses in&#160;C. elegans.</a>&#160;J. Vis. Exp.&#160;(2014).
This video introduces a method of laser wounding, which is used to cause very precise injuries in the worm epidermis.&#160; The sample protocol is from a study of wound response and repair.

جرح البشرة بالليزر: إحداث ضرر موضعي لفحص عمليات الإصلاح في C. ايليجانس

Source: Xu, S. and Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in&#160;C. elegans.&#160;J. Vis. Exp.&#160;(2014).
This video ...

طرق للبشرة إصابة وفحوصات لالردود الجرح في

Summary

Explore More Videos

Chapters in this video