Name: methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum
Uploaded: 2015-12-04T14:00:00.000+00:00
Duration: 10 min 22 s
Description: Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Erhalten Malariaparasiten in asexuellen Kultur 29. HINWEIS: Die erforderliche Kulturgröße wird von der gewünschten Anwendung variieren; jedoch eine 10 ml Kultur bei 3-5% Parasitämie und 5% Hämatokrit bietet ausreichend RNA für Echtzeit-PCR (RT-PCR). Die Technik wurde ursprünglich für asynchrone Kulturen optimiert, aber wenn bestimmten Zeitpunkten während des Infektionszyklus gewünscht werden, können Ringstadium-Parasiten von Sorbit Synchronisierung nicht später als 10-12 Stunden nach der Invasion synchronisiert werden. Synchronisierung nach Ablauf eines Zyklus (ca. 48 h) 29 wiederholt werden. </li><li> Pool infizierten Zellen zusammen (ca. 5 x 10 9 RBCs bei 3-5% Parasitämie) und füllen kaltem PBS an die Spitze des Rohres und Zentrifugieren bei 800 xg für 5 min ohne Bremse zu Pellet der roten Blutkörperchen. </li><li> Nach der Zentrifugation, entfernen Sie den Überstand vorsichtig mit Hilfe eines Ansaugpipette, befestigtauf ein Vakuum, da die Erythrozyten-Pellet ist leicht zu entfernen. Nochmals mit kaltem 1x PBS Waschen des Pellets. </li><li> Resuspendieren Zellpellet in kaltem 0,15% Saponin (in 1x PBS) und auf Eis für 30 min. </li><li> Centrifuge Zellen bei 1.500 × g für 12 min bei 4 ° C, zu entfernen Überstand (die dunkel in der Farbe rot sein wird) und Pellet in kaltem PBS. Wiederholen Sie diesen Schritt noch einmal. ANMERKUNG: Um sicherzustellen, dass die vorliegenden mikroRNAs waren reflektierend mikroRNAs innerhalb Parasiten und nicht erythrozytären Kontamination ist eine Anzahl von Parasiten Isolationsbedingungen wurden getestet: 1) Saponin Lyse, 2) Saponin Lyse mit RNaseA Behandlung der Wirtszelle miRNAs und 3 kombiniert ) Methyl-beta-Cyclodextrin-Behandlung, um die Parasiten aus der Wirts Erythrozyten zu entfernen. Alle Behandlungen ergaben ähnliche Ergebnisse. </li><li> Lyse der isolierte Parasiten Pellet mit den empfohlenen 600 &amp; mgr; l Lysepuffer. Dieses Volumen Lysepuffer genügt Kulturen bis zu ~ 30 ml von 2% Hämatokrit und 5% Parasitämie. HINWEIS: Für größere Parasiten Kulturen, kann dieses Volumen erhöht werden. Es ist wichtig, um eine vollständige Lyse der Parasitenpellet durch gründliches Vortexen für mindestens 1 min zu gewährleisten. Auch zur Vereinfachung der Extraktion, die lysierten Proben können in einem 1,7 ml Mikrozentrifugenröhrchen übertragen. </li><li> Mit 60 &amp; mgr; l oder 1/10 Volumen Lysepuffer in Schritt 6 verwendet, Homogenat Additiv (2 M Natriumacetat, pH 4). </li><li> Lassen Proben auf Eis für 10 min. </li><li> Mit 600 &amp; mgr; l oder ein Volumen gleich der Menge Lysepuffer in Schritt 6 zu jeder Probe und Vortex für 1 min zugegeben saurer Phenol choloroform. </li><li> Trennen der wässrigen und organischen Phasen durch Zentrifugation der Proben bei 10000 × g für 5 min. Diese Drehung ist länger als die durch den Bausatz vorgeschlagen, um sicherzustellen, dass alle Hämoglobin / Hämozoins ist in der organischen Phase. </li><li> Sammeln Sie die obere (wässrige) Schicht und überträgt es in ein frisches Röhrchen. Wiederholen Sie die Schritte 9 und 10, wenn die wässrige Phase ist weiß oder (wahrscheinlicher) Braun in der Farbe, die pro schlägttein Verschmutzung. </li><li> Bestimmen das Volumen des resultierenden Überstands mit einer Pipette und fügen 1,25 Volumina 100% Ethanol (~ 800 &amp; mgr; l) und durch Umschütteln 1,7 ml Mikrozentrifugenröhrchen 5 mal. </li><li> Passieren jede Probe durch ein bereitgestellt RNA-bindende Filterpatrone (von denen mehrere verschiedene im Handel erhältlich sind) entweder durch Zentrifugation bei 14.000 × g für 1 min oder durch Verwendung einer Vakuumkammer. </li><li> Waschen Sie die Filterpatrone mit 700 ul der miRNA-Waschpuffer 1 unter Verwendung einer Mikrozentrifuge, Spinning bei 14.000 × g für 1 min. </li><li> Zweimal durch Zentrifugieren bei 14.000 · g für jeweils 1 min Waschen Sie die Filterpatrone mit 500 ul Waschpuffer 2/3. </li><li> Eluieren RNA mit 100 ul DEPC-Wasser, das auf 95 ºC vorgewärmt wurde, in zwei Wäschen von 50 &amp; mgr; l, Zentrifugieren bei 14.000 xg für jeweils 1 min. Messung der Konzentration von RNA durch UV-Absorption bei 260 nm. HINWEIS: Ein RNA-Gel (entweder TBE-Harnstoff-Acrylamid oder denaturierenden Formaldehyd-Agarose-Gel) kann be verwendet, um die Größenverteilung der isolierten RNAs beurteilen. HINWEIS: Diese RNA ist für die Analyse von Mikroarray, RNA-Sequenzierung, Northern Blot und Ribonuklease Protection Assay. </li></ol> 2: Quantifizierung von kleinen RNAs, die von P. falciparum Während des IDC <ol><li> Bestimmen Sie die Konzentration der einzelnen Proben in Schritt 1 getrennt mit UV-Spektrophotometrie bei 260 nm. </li><li> Erzeugen Echtzeit-PCR-Primer für den gewünschten RNA-Spezies. Für miRNA allein haben wir vorgefertigte miRNA qPCR-Assays, während für mRNAs oder Fusions miRNA-mRNA wir entwickelt Primer für SYBR grün. Für die Fusions RNAs, der Vorwärtsprimer war der miRNA-Sequenz selbst (miR-451: AAACCGTTACCATTACTGAGTT), während die Rückseite war eine genspezifische Primer ~ 100 bp stromabwärts von dem miRNA in der mRNA-Sequenz (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Machen cDNA aus den RNA-Proben unter Verwendung von entweder einer Haarnadelprimer für miRNAs (verwenden 20-40 ng RNA) alleine oder zufälligen Hexameren für mRNA und / oder miRNA-mRNA Fusions Arten (unter Verwendung von 1 &amp; mgr; g RNA). Mischungs RNA und Primer für 5 min bei 65 ° C, dann auf Raumtemperatur abkühlen. Anschließend fügen reverse Transkriptase-Mix (0.5 &amp; mgr; l reverse Transkriptase, 0,5 ul RNase Inhibitor, 1 ul dNTPs (jeweils 2,5 mM), 4 &amp; mgr; l 5x-Puffer, 2 &amp; mgr; l 0,1 M DTT, 1 &amp; mgr; l H 2 O). <ol><li> Führen Proben auf einem Thermocycler zum Aufspüren von entweder SYBR grün oder TaqMan-Sonden. SYBR green quantitative PCR 30 für spezifische Gene wurde als ein 3-Schritt-PCR, 95 ° C für 15 sec, niedrigsten Primerannealing Temperatur minus 5 ° C für 30 s ausgeführt wird, und 68 ° C für 30 Sekunden, für 40 Zyklen unter Verwendung eines Handels SYBR Green Master Mix. miRNA Echtzeit-PCR wurde als eine Zwei-Schritt-PCR für 1 min laufen, 95 ° C für 15 sec und 60 ° C für 40 Zyklen. </li><li> Quantifizierung Assays unter Verwendung des ΔΔCt Verfahren und normalisieren sie entweder gegen Rab GTPase (PF08_0110) oder 18S rRNA 31. </li></ol></li></ol> 3: Einführungvon kleinen RNAs in Malaria-Erregern <ol><li> Pellet 300 ul rote Blutkörperchen pro Transfektion durch Zentrifugation bei 800 × g bei Bremse 1 (250 ul von RBCs etwa 1,5 x 10 9 Zellen, schließlich verwendet werden) in komplettem Malariamittel für 5 min. </li><li> Zweimaliges Waschen der Erythrozyten mit RPMI und resuspendieren in komplettem cytomix (120 mM KCl; 0,15 mM CaCl2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl 2; pH mit KOH nach dem Zentrifugieren bei 800 xg für 5 Minuten bei Bremse 1 eingestellt) bei 50% Hämatokrit. </li><li> Übertragen Sie die Zellen bis zu einer 0,2 cm Elektroporationsküvette. </li><li> In 10 ug oder entsprechenden Betrag, der kundenspezifische synthetische Oligonukleotide an die Küvetten und Resuspendieren der Kulturen. </li><li> Stellen Sie die Elektroporator bis 310 V / 950 &amp; mgr; F und liefern einen Impuls zu jeder Küvette. </li><li> Resuspendieren der 300 ul RBC in der Küvette in vorgewärmten komplette malArie Medien und platten sie in 24-Well-Platten und Inkubieren bei 37 ° C in einem luftdichten Behälter mit Malaria Blutgasgemisch (3% O 2, 5% CO 2). </li><li> Nach 4 Stunden, infizieren transfizierten RBCs mit synchronisierten späte Trophozoiten auf eine ungefähre endgültige Parasitämie von 1%. </li><li> In frisch transfiziert RBCs alle 4-6 Tage, um infizierten Kulturen und bestimmen Sie die% Parasitämie durch FACS mit Jo-Jo-1-Färbung, wie in Abschnitt 4 angegeben. </li></ol> 4: Bestimmung der Erythrozyten-microRNAs Wirkung auf Parasiteninfektion bewerten <ol><li> Nehmen Sie 100 ul der resuspendierten Kultur durch Mikropipette und in ein 1,7 ml Mikrozentrifugenröhrchen. Zweimaliges Waschen mit 1 ml 1 × PBS und zentrifugieren in einer Tischmikrozentrifuge durch Zentrifugation bei 800 × g für 5 min. </li><li> Pellet in 1 ml 0,025% Glutaraldehyd. Proben, 20 min bei RT. HINWEIS: Proben können hier für mehrere Wochen bei 4 ° C gelagert werden. Danach pelletieren die infizierte RBCs durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. </li><li> Pellet in 1 ml 0,015% Saponin. Inkubieren bei 4 ° C für 15 min. Pellet infizierter Erythrozyten durch Zentrifugation bei 800 × g für 5 min. Waschen zweimal mit 1 ml 1x PBS. Repeat.4.3. Die Zellen in 1 ml 1 × PBS, enthaltend 1 ul (1,000x) DNA-Farbstoff. </li><li> Bestimmen den Grad der Parasitämie auf einem Durchflusszytometer, bei 488 nM Anregung und ~ 530 nm (FL-1) Emission. </li><li> Zuerst Gate das Durchflusszytometer basierend auf FSC und SSC auf Erythrozyten zu konzentrieren. Dann messen Sie den Grad der Parasitämie (infizierten Erythrozyten) in der gesperrten RBC durch Fluoreszenz in der FL-1-Kanal. HINWEIS: später Parasiten sind 10X mehrere fluoreszierende als früher Parasiten und ~ 100X oben nicht infizierten Erythrozyten. Auch das Sammeln bei niedriger Geschwindigkeit neigt dazu, Rauschen zu reduzieren. Schließlich hat diese Herangehensweise an 3 H-Hypoxanthin Einbau und Giemsa sowohl wie zuvor berichtet 13, sowie alle Techniken gav verglichenE ähnliche Ergebnisse. </li></ol> 5: Biotin-Tagging und Elution von miRNA-mRNA Fusion Produkte <ol><li> Direkt bestellen kundenspezifische synthetische RNA-Oligonukleotide mit Desthiobiotin (DB), die kovalent an das 5&#39;-Ende verbunden sind. </li><li> Transfektion von nicht-infizierten roten Blutkörperchen mit Desthiobiotin konjugierten (DB-) miRNA und unmodifizierten miRNA (negative Kontrolle), wie in Schritt 3 dargestellt. </li><li> Infizieren transfiziert RBCs mit P. falciparum-Parasiten zu einer Start Parasitämie von 0,5% (Schritt 1.1). </li><li> Auszug Parasiten RNA 4 Tage (96 Stunden) später, wie oben in Schritt 1 beschrieben. </li><li> Inkubieren 10 ug Parasiten RNA mit 50 &amp; mgr; l Streptavidin-Kügelchen gepackt, aufgenommen mittels Mikropipette, und drehen sich auf einem Mikrozentrifugenröhrchen Rotator für 1 Stunde bei 4 ° C. </li><li> Pellet die Kügelchen bei 800 · g für 30 Sekunden und Waschen mit 20 mM KCl und 1 / 1.000 RNase Inhibitor. </li><li> Eluieren RNAs aus den Perlen durch Konkurrenz mit 2 mM Biotin und mit 200 &amp; mgr; l RNA-Capture-Elutionspuffer (20 mM KCl, 1/1000 RNase Inhibitor und 2 mM Biotin) bei 4 ° C über Nacht mit Rotation. </li><li> Bestimmen den Grad der Anreicherung angegeben P. falciparum Transkripte mit SYBR green qRT-PCR und microRNA-Anreicherung (positive Kontrolle) durch TaqMan qPCR wie in Schritt 2 angegeben. </li></ol> 6: Polysomen Trennung an die ribosomale Belegung von P. Bestimmen falciparum <ol><li> Platzieren von 5 ml 15% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase-Inhibitor und 15% Saccharose ) in einem SW41 Ultrazentrifugenröhrchen (14 x 89 mm). </li><li> Unter Verwendung einer 5 ml Spritze mit 5 ml 50% Saccharose-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, und 50% Saccharose) unterhalb der 15% Saccharose mit einem langen Stahlnadel, dann entfernen Sie die Nadel. </li><li&gt; Verschließen Sie die Oberseite des Gradienten Rohr mit Parafilm, kippen Sie den Schlauch langsam auf die Seite, in einer stabilen Position gegen Wegrollen, so dass es horizontal auf der Tischplatte. Halten des Rohres auf seiner Seite für mindestens 2 Std. Während der Wartezeit, beginnen Sie mit Schritt 6.5. </li><li> Nach 2 Stunden langsam kippen Sie das Rohr wieder aufrecht und übertragen Sie das Rohr auf Eis, so dass sie für mindestens 15 Minuten vor der Probenbeladung (Schritt 14) zu kühlen. </li><li> Sammeln Sie genug Plasmodium infizierte Blutstadium Kultur 100-500 ug Gesamt-RNA, oder ungefähr 100 ml asynchronen Kultur bei 3-5% Parasitämie zu generieren. Hinzuzufügen 1/10 dem Volumen des Kulturmediums, das 10-fach (2 mM) Cycloheximid (CHX) und bei 37 ° C für 10 min. <ol><li> Pellet Kulturen durch Zentrifugation bei 500 g für 7 min mit der Zentrifuge (Bremse 1), dann zweimal waschen mit Raumtemperatur 1x PBS, das 200 uM CHX. Resuspendieren der Parasitenkulturen in 1x PBS, das 200 uM CHX und speichern Sie auf dem Eis. </li></ol></li&gt; <li> Schätzen Sie das Volumen der RBC-Pellet. Hinzufügen Lysepuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, und 0,5% (w / v) DOC) in die RBC-Pellet bis zu einem Endvolumen von 4,25 ml. Inkubieren des Lysats bei 4 ° C für 10 Minuten unter Rotation. </li><li> Transfer des Lysats auf Mikrozentrifugenröhrchen und anschließend zentrifugiert werden die Proben in einer Mikrozentrifuge bei 16.000 × g und 4 ° C für 10 min. </li><li> Vorbereitung Saccharosekissen durch Pipettieren von 1,25 ml kaltem 0,5 M Saccharose-Kissen-Lösung (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor und 0,5 M Saccharose) in einem SW55 Ultrazentrifugenröhrchen (13 x 51 mm). </li><li> Sorgfältig Schicht 3,75 ml Lysatüberstand (aus Schritt 7) auf der Oberseite des Saccharose-Kissen unter Verwendung einer Spritze und kleine (~ 27) Gauge-Nadel. Store die verbleibende Lysat (~ 500 &amp; mgr; l) bei -80 ° C, um die Gesamt-RNA Niveaus zu extrahieren, wie in Abschnitt 1 angegeben. </li><li> Laden der Proben in der Ultrazentrifuge Rotor vorgekühlter bis 4 ° C, das 13,2-ml-Röhrchen aufnehmen kann. Zentrifugieren der Proben bei 366.000 × g und 4 ° C für 146 min. </li><li> Mit einer Pipette den Überstand in ein 15 ml konischen Röhrchen. Lagern Sie den Überstand bei -80 ° C für die RNA-Isolierung von freiem (ungebundenem von Ribosomen) RNAs. </li><li> Resuspendieren Ribosom-Pellet in 500 ul Ribosomen Resuspensionspuffer (400 mM Kaliumacetat, 25 mM Kalium HEPES, pH 7,2, 15 mM Magnesiumacetat, 200 &amp; mgr; M Cycloheximid, 1 mM DTT, 1 mM PMSF, und 40 U / ml RNase-Inhibitor) durch Pipettieren von 5 min. </li><li> Zentrifugieren der Proben in einer Mikrozentrifuge bei 16.000 × g und 4 &#160; ° C für 10 min. </li><li> Während die Gradienten von Schritt 4 auf Eis, entfernen Sie die Parafilm, dann vorsichtig Schicht das Ribosom Suspension oben auf dem Gradienten using eine Spritze und kleine (~ 27) Nadel. </li><li> Legen Sie den Schlauch in ein vorgekühltes Ultrazentrifuge Rotor und Zentrifuge die geladenen Farbverläufe bei 200.000 xg und 4 ° C für 180 min. Wenn der Spin beendet ist, zentrifugiert store Gradienten bei 4 ° C, bis Sie sie auf den Fraktionator zu laden. </li><li> Legen Sie eine leere Ultrazentrifugenröhrchen in die Gradienten Fraktionator (dies kann ein Rohr in einem vorherigen Durchlauf verwendet werden kann), dann mit RNase-freiem Wasser waschen für 5 min bei 100 x 10 Geschwindigkeit. </li><li> Während des Wasch in Schritt 6.16, stellen Sie die Empfindlichkeit des UV-Absorptionsdetektor. Ein guter Ausgangsempfindlichkeit liegt bei 0,2, aber dies möglicherweise in späteren läuft auf der A 254-Signal (die auf Parasiten Nummer usw. auf Basis variiert), je nach eingestellt werden. </li><li> Sobald die Detektorempfindlichkeit eingestellt ist, stellen Sie die Grundliniensignal auf Null, während Wasser durch den Detektor strömt. </li><li> Nach dem Waschen der Fraktionssammler, kehren Sie den Flüssigkeitsstrom, bis die Leitungen leer sind und dann remove, das leere Ultrazentrifugenröhrchen. </li><li> Führen Sie 60% Saccharose-Lösung durch den Fraktionator bis zum Nadelgerät verlässt. </li><li> Legen Sie die Röhrchen mit dem ersten Gradienten an der Spitze der Ladekammer und die Dichtung festziehen, dabei nicht zu fest anziehen. Dann durchstechen die Unterseite des Rohres mit der Nadel. </li><li> Setzen Sie die Flüssigkeitsströmungsgeschwindigkeit von 12,5 x 10 (von der Strömungsgeschwindigkeit Drehknopf auf der Vorderseite der Pumpe gesteuert wird), legen Sie dann den automatischen Fraktionssammler bis 18 sec Fraktionen zu sammeln (~ 330 &amp; mgr; l / Fraktion) in Mikrozentrifugenröhrchen. </li><li> Start vorwärts Fluss der 60% Saccharose-Lösung. </li><li> Wenn der erste Tropfen des Gradienten-Lösung fällt in den Mikrozentrifugenröhrchen, sofort beginnen sowohl die Fraktionssammlung und Live-Mitschnitt der A 254-Signal. </li><li> Nach einem starken Rückgang in der A 254-Signal beobachtet, entsprechend der Schnittstelle zwischen 50% und 60% Saccharose-Lösungen, zu stoppen sowohl die Fluidströmung und A 254 </sub&gt; Aufnahme. </li><li> Bewahren Sie die Gradientenfraktionen bei -80 &#160; ° C für die spätere Verwendung. </li><li> Kehren Sie den Flüssigkeitsstrom bei 100 x 10-fach, bis das 60% Saccharose-Lösung leert sich der Ultrazentrifugenröhrchen. </li><li> Wenn es zusätzliche Gradienten zu fraktionieren, entfernen Sie die leere Ultrazentrifugenröhrchen aus der Ladekammer und starten Sie mit Schritt 6.21. Wenn alle Proben abgeschlossen sind, waschen Sie die Vorrichtung wurde in Schritten 6.16 und 6.19 durchgeführt. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS ist eine der häufigsten Hämoglobinvarianten in Malaria-endemischen Gebieten, vor allem, weil er Schutz gegen schwere Malaria durch P. verursacht falciparum. Die Techniken erforderlich, um die Rolle des menschlichen MikroRNA in der Genregulation P. charakterisieren falciparum werden in diesem Manuskript beschrieben. Durch Extraktion der Gesamt-RNA in einer solchen Weise, dass alle kleinen RNAs umfassen, und durch Ausführen einer relativ einfachen Parasiten Lyseverfahren waren diese Fusions RNAs in der Lage, durch eine Vielzahl von unabhängigen Techniken identifiziert werden. Diese Schritte sind relativ einfach, aber empfindlich auf Probleme und Kontamination nicht ordnungsgemäß durchgeführt. Während der Parasit Extraktion, ist es kritisch, Saponin Lyse durchzuführen, um verunreinigende Wirts Erythrozyten. Dies gilt insbesondere während der Saponin Lyse der RNA-Isolierung. Die miRNA-Komponente der Host roten Blutkörperchen ist mehrere Größenordnungen größere als diejenige des Parasiten, was teilweise auf die meisten der roten Blutzellen, die nicht-infizierte, so ist es wichtig, so viel erythrozytären Verunreinigung wie möglich zu entfernen. Es ist auch wichtig, die Malaria Kultur in einem gesunden und richtigen Stadium aufrechtzuerhalten (wenn ein bestimmter Punkt im Infektionszyklus erforderlich ist), um eine genaue miRNA Profil zu erhalten. In ähnlicher Weise während des Phenol-Chloroform-Extraktion, ist es von entscheidender Bedeutung, um sicherzustellen, dass die wässrigen Phasen sind klar, und falls nicht, wiederholen Sie den Phenol-Chloroform-Extraktion, um alle verbleibenden Verunreinigungen zu vermeiden. Auch in dem Desthiobiotin Einfangexperiment, ist es wichtig, mit einem Überschuss von Biotin zu eluieren und um die minimale von Streptavidin-Kügelchen zu verwenden, um eine ordnungsgemäße spezifische Elution sicherzustellen. Die Elution der gebundenen RNAs durch die Konkurrenz mit Biotin, anstatt vollständige Denaturierung der Perlen selbst, diente dazu, drastisch reduzieren die Hinter RNA-Anreicherung. Schließlich wurde das Desthiobiotin Einfangexperiment hervorgehoben as ein wichtiger Weg, um zu zeigen, wie diese miRNAs wurden gefangen genommen, aber mehrere andere Techniken wurden auch in den früheren Studien verwendet, um diese Fusion RNAs, wie Northern-Blots und Ribonuklease-Schutzassays 29 zu demonstrieren. Solche Verfahren zur Verwendung der transfizierten mikroRNAs die modifizierten Transkripte abrufen kann eine breitere Anwendung, wie zum Beispiel die Reinigung der assoziierten Proteinkomplexen, die den Transport und die Verarbeitung der transfizierten miRNAs vermitteln kann. Während verschiedene genomweite Ansätze wurden verwendet, um die Malaria Proteom und Transkriptom 22-25 studieren, gibt es nur wenige Methoden, um global zu untersuchen Translationsregulation in P. falciparum 21,26. Diese methodische Einschränkung schließt die globale Analyse der Translationsregulation in P. falciparum. Einer der häufigsten experimentelle Ansätze zur Translationsregulation zu untersuchen ist Polysom ​​Profiling, das Gesamtübersetzungs bewertetal-Aktivität auf der Grundlage der Ribosomen auf spezifische mRNAs von Interesse geladen. Detaillierte in dieser Handschrift ist eine optimierte Polysom ​​Profilierungsverfahren zur Verwendung in Malaria-Parasiten, die sowohl den infizierten Erythrozyten und den Parasiten innerhalb lysiert. Bisherige Verfahren nicht die Mehrheit der Polysomen erholen und machte es scheinen, als ob Malaria-Parasiten nicht erhebliche Populationen von Polysomen haben. Die Verwendung eines Lysepuffers mit einer hohen Konzentration von Kaliumacetat und Magnesium machte es möglich, sowohl die roten Blutkörperchen zu lysieren und Parasiten während solubilisierende membrangebundenen Ribosomen an die Erfassung von intakten Polysomen gestatten. Diese kostengünstige Methode der ribosomalen Reinigung und Profilierung wird dazu beitragen, die Lücke in der vorhandenen Wissens zwischen der Malaria Transkriptom und Proteom zu überbrücken und aktivieren Sie die genomweite Analyse der Translationszustand P. falciparum. Dieser Ansatz wurde verwendet, um den Übersetzungszustand der frühen und späten Phase b vergleichenlood Stadium-Parasiten 28, die Genexpression eng koordiniert haben. Daten über die ribosomalen Beladung Transkripte leicht erhalten und analysiert werden, um die Dichte der Ribosomen über spezifische mRNAs bestimmen. Weiterhin wird bei der Synchronisierung mit Sorbit kombiniert, Veränderungen der ribosomalen Dichte kann verwendet werden, um festzustellen, wie die Übersetzung im gesamten Lebenszyklus des Parasiten geregelt werden. Isolierung der Ribosomen unter Verwendung dieses Ansatzes erfordert eine große Menge der Kultur, die leider begrenzt die Stadien des Malaria-Lebenszyklus, in dem sie ausgeführt werden können. Die große Menge an Inputmaterial wird auch seine Verwendung sowohl zu begrenzen, um in vitro Labor Stämme von Plasmodium falciparum und kann ihre Anwendbarkeit auf andere infektiöse Organismen zu beschränken. Jeder, der dieses Verfahren wird auch in der Lage, nach Genen, die ungewöhnliche Übersetzung Profilen, insbesondere Transkripte, die nicht mit Ribosomen assoziiert sind, was auf alternative Formen der Genregulation zeigen, zu screenen. Endlich,Dieser Ansatz ermöglicht es uns, zu bewerten, wie neuartige Antimalariamittel beeinflussen Proteintranslation und auf Übersetzungen basierten Mechanismen der Arzneimittelresistenz zu identifizieren. Diese Pipeline hat großen Nutzen bei der Identifizierung und Bestimmung der posttranskriptionellen Regulation in vielen experimentellen Systemen.

Malaria, durch apicomplexan Parasiten der Gattung Plasmodium verursacht, ist die häufigste menschliche parasitäre Erkrankung, weltweit zu infizieren rund 200 Millionen Menschen jedes Jahr und verursacht etwa 600.000 Todesfälle 1. Von den fünf Plasmodium-Arten, die Menschen infizieren, die relevant für die menschliche Krankheit sind P. falciparum und P. vivax, die aufgrund ihrer weit verbreiteten Distributionen und Potenzial für schwere Malaria Komplikationen. Der Lebenszyklus des Malaria-Parasiten-Infektion erfordert beider Mücken und Menschen. Wenn eine infizierte Mückenstiche einen Menschen, die Parasiten reisen durch den Blutstrom in die Leber, wo eine erste Runde der Replikation erfolgt. Nach Merozoiten Bruch von der Host-Hepatozyten, infizieren sie in der Nähe von roten Blutzellen, die Einleitung entweder asexuell oder sexueller Replikation. Die asexuelle Phase der Replikation, die 48 Stunden in P. dauert falciparum ist der Schwerpunkt dieser Studie, da es sowohl die Quelle der meisten malArie Symptome und ist leicht in vitro rekapituliert. Während eine Reihe von öffentlichen Gesundheitsinitiativen, einschließlich der Verbesserung der Anti-Malaria-Therapien haben etwas reduziert die Belastung durch Malaria weltweit, die anhaltende Entstehung von arzneimittelresistenten Parasiten stellt ein Problem für Malaria-Kontrolle Anstrengungen. Ein Bereich, der neue Therapieansätze vorschlagen kann, ist die Studie darüber, wie verschiedene genetische Varianten Resistenz gegen Malaria. In malariaendemischen Gebieten, eine Vielzahl von Erythrozyten-Polymorphismen sind durchaus üblich 2,3. Diese Mutationen, mit Sichelzell wobei vielleicht das bekannteste, sind oft mit erheblichen Resistenz gegen den Ausbruch der symptomatischen Malariainfektion 4 verbunden. Die zugrunde liegenden Mechanismen, durch die sie verursachen Erythrozyten an Malaria-Infektion zu widerstehen sind unvollständig verstanden. Parasitierten Erythrozyten mit Hämoglobin-Mutationen sind, gelten verstärkte Phagozytose durch verbesserte zelluläre Steifigkeit und Dehydrierung, diemit verringerten Invasion von P. zugeordnet falciparum 5. HBC Allel betrifft auch Protein-Expression auf der Erythrozytenoberfläche und mit dem Umbau des Zytoskeletts, ferner Hemmung Parasitenentwicklung 6,7. Schließlich P. falciparum wächst schlecht in homozygoter Sichel (HBSS) Erythrozyten 8,9 in vitro, was darauf hindeutet, intrinsische erythrozytären Faktoren Malariaresistenz. Doch während all dieser Mechanismen scheinen eine Rolle zu spielen, sie nicht vollständig erklären die Mechanismen hinter Sichelzelle Resistenz gegen Malaria. Ein möglicher Satz von Erythrozyten-Faktoren, die schlecht verstanden, bleiben die großen Pool von miRNA vorhanden innerhalb von reifen Erythrozyten. MicroRNAs sind kleine nicht-kodierende RNAs, 19-25 nt in der Größe, die Übersetzung und / oder Stabilität der Ziel-mRNAs durch Basenpaarung in der 3&#39;-UTR zu vermitteln. Sie haben bei der Steuerung der Immunantwort von Säugetieren in Verbindung gebracht worden, einschließlich der Unterdrückung of die Virusreplikation 10 und gezeigt wurden, um Resistenz gegen Viren in Pflanzen Sie haben auch gezeigt, dass mehrere Erythrozyten-Prozesse, einschließlich Erythropoese 11,12 und Eisenstoffwechsel 13 regulieren. Frühere Studien identifiziert eine reiche und vielfältige Bevölkerung von Erythrozyten-miRNAs, deren Expression dramatisch in HBSS verändert Erythrozyten 14,15. Da reifen Erythrozyten mangelt aktive Transkription und Translation, bleibt die funktionelle Bedeutung dieser Erythrozyten miRNAs unklar. Als wesentliche Stoffaustausch zwischen der Wirtszelle und P. auftritt falciparum während der intraerythrozytären Entwicklungszyklus (IDC) 16, wurde spekuliert, dass die veränderte miRNA Profil innerhalb HbS Erythrozyten direkt mit zell intrinsische Malaria Festigkeit beizutragen. Diese Studien schließlich zur Entwicklung einer Pipeline führte zu isolieren, zu identifizieren und funktionell untersuchen die Rolle des menschlichen miRNA innerhalb der malaria Parasiten P. falciparum, die ergab, dass diejenigen Host / menschlichen miRNAs letztendlich kovalent Sicherung und dann translational verdrängen Parasiten mRNA-Transkripte 17. Dies war ein Beispiel für den ersten Quer Spezies chimäre Transkripte Transspleiß gebildet und impliziert, dass dieser miRNA-mRNA Fusion könnte in anderen Spezies, einschließlich anderer Parasiten auftreten werden. Alle trypanosome mRNAs Transspleißprodukten mit einer Splice-Leader (SL), um die Trennung der polycistronische Transkripte 18 regulieren. Da P. falciparum fehlt Orthologe für Dicer / Ago 19,20 ist es möglich, dass Erythrozyten-miRNAs entführen ähnliche SL Maschinen in P. falciparum in Zielgenen zu integrieren. Jüngste Studien in P. falciparum haben in der Tat zeigte die Anwesenheit von 5&#39;-Spleißstelle Leader-Sequenzen 21. Diese Studie beschreibt die Verfahren, die zur Entdeckung der menschlichen Parasit miRNA-mRNA Fusionstranskripte geführt, die sowohl transkriptomischen und Übersettionalen Regeltechnik. Die allgemeinen Ziele dieser Methoden sind, um die Auswirkungen von kleinen RNAs in der Genregulation Phänotypen und Übersetzungs Potential von P. untersuchen falciparum Transkripte. Die anfängliche Identifizierung von Menschenparasit chimären Transkripten geltend gemachten Benutzung RNA Analysetechniken, wie beispielsweise Echtzeit-PCR, Transkriptom-Sequenzierung und EST-Bibliothek zu erfassen, die sowohl insgesamt und kleinen RNAs, anstatt mit Hilfe von Techniken, die nur vereinzelt kleine RNAs enthalten. Isolieren aller RNA zusammen in einem großen Pool, anstatt separat, erlaubte die Identifizierung beider transloziert menschlichen kleine RNAs im Parasiten sowie das Vorhandensein dieser kleinen RNA-Sequenzen als Teil einer größeren Sequenz. Dies erforderte dann eine Analyse der Übersetzungszustand dieser Fusions mRNAs, die funktionellen Konsequenzen dieser Fusionen bestimmen. Während umfangreiche Bemühungen auf Charakterisierung des Parasiten Genom eind Transkriptom haben zum Verständnis der Biologie des Parasiten 22-25 hinzugefügt wird, wird weit weniger über die Translationsregulation der mRNA Transkriptom über den Lebenszyklus von P. bekannt falciparum 26. Diese begrenzte Verständnis des Parasiten Proteom hat sowohl Verständnis des Parasiten der Biologie und die Fähigkeit, neue Ziele für die nächste Generation von Anti-Malaria-Therapeutika identifizieren behindert. Diese Lücke im Verständnis der Zellbiologie des Parasiten wurde vor allem aufgrund der Mangel an geeigneten Techniken beibehalten, um Translationsregulation in P. untersuchen falciparum. Ein aktuelles Papier beschrieben die Verwendung von ribosomalen Footprinting von P. falciparum, die globale Übersetzungsstatus 21 zu bestimmen. Eine gut etablierte Messtranslations Potential von Transkripten ist die Anzahl der von Polysomen-Profiling bestimmt zugeordnet Ribosomen. Jedoch, wenn diese Technik auf P. angewendet falciparum &lt;/ em&gt;, ist es nicht in der Lage, die meisten Polysomen erholen und fängt vorwiegend monosomes. In jüngerer Zeit haben mehrere Gruppen 27,28 P. optimiert falciparum Polysom ​​Techniken durch Lyse der Erythrozyten und Parasiten gleichzeitig, um die Polysomen zu bewahren und zu charakterisieren, die ribosomale Belegung und translationalen Potenzial dieser Malaria-Parasiten während ihrer asexuelle Entwicklung in Wirts roten Zellen 28. Zusammen zeigen diese Verfahren, dass die beobachtete Fusion von menschlichen miRNA und Parasiten mRNAs moduliert Parasitenprotein Übersetzung dieser Fusions mRNAs, die unter Verwendung von zuvor beschriebenen Verfahren 27 gezeigt wurde, und ist eine wichtige Determinante der Malaria Widerstand HbAS und HbSS Erythrozyten 17. Diese Methoden sinnvoll in einem System suchen zu identifizieren und funktionell zu erforschen RNA-Splicing Ereignisse sein, ob diese Fusion RNAs sind in P. falciparum oder andere eukaryotische Systeme.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS-All reagents must be RNAse-free.&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>Sigma</td><td>D5758</td><td>DEPC</td></tr><tr><td>DEPC-treated water (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Yoyo-1 DNA fluorescent dye</td><td>Thermo Fisher</td><td></td><td></td></tr><tr><td>Gene Pulser II electroporator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>0.2 cm Electroporation cuvettes</td><td></td><td></td><td></td></tr><tr><td>4 M potassium acetate</td><td>Mallinckrodt</td><td>6700</td><td></td></tr><tr><td>2 M potassium HEPES</td><td>Sigma</td><td>H0527</td><td>pH 7.2</td></tr><tr><td>1 M magnesium acetate</td><td>Sigma</td><td>M-2545</td><td></td></tr><tr><td>1 M dithiothreitol</td><td>Research Products International</td><td>D11000</td><td>DTT</td></tr><tr><td>100 mM phenylmethylsulfonate fluoride</td><td>Sigma</td><td>P7626</td><td>PMSF, dissolved in isopropanol</td></tr><tr><td>10% (v/v) Igepal CA-630</td><td>Sigma-Aldrich</td><td>I3021</td><td></td></tr><tr><td>10% (w/v) sodium deoxycholate</td><td>Sigma</td><td>D-6750</td><td>DOC</td></tr><tr><td>Cycloheximide</td><td>Sigma</td><td>C-7698</td><td>CHX</td></tr><tr><td>Sucrose</td><td>Mallinckrodt</td><td>8360-04</td><td></td></tr><tr><td>RNAseOUT (Invitrogen, cat. no. 100000840)</td><td>Invitrogen</td><td>100000840</td><td></td></tr><tr><td>RPMI-1640 w/ L-glutamine</td><td>Cellgro</td><td>10-040-CV</td><td></td></tr><tr><td>10% AlbuMAX I</td><td>Invitrogen</td><td>11020-039</td><td>w/v in sterile water</td></tr><tr><td>Gentamicin</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>HT supplement (100x) (Invitrogen, cat. no. 11067030)</td><td></td><td></td><td></td></tr><tr><td>45% (w/v) sucrose (Sigma, cat no. G8769)</td><td></td><td></td><td></td></tr><tr><td>1 M HEPES buffer (Gibco, cat. no. 15630-080)</td><td></td><td></td><td></td></tr><tr><td>1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td><td></td><td></td><td></td></tr><tr><td>Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td><td></td><td></td><td></td></tr><tr><td>Glass slides (VWR, cat. no. 48311-702)</td><td></td><td></td><td></td></tr><tr><td>Giemsa stain (50X) (VWR, cat no. m708-01)</td><td></td><td></td><td></td></tr><tr><td>mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td><td></td><td></td><td></td></tr><tr><td>5&#039; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td><td></td><td></td><td></td></tr><tr><td>Biotin powder (Sigma-Aldrich)</td><td></td><td></td><td></td></tr><tr><td>1 M Potassium Chloride</td><td></td><td></td><td></td></tr><tr><td>Streptavidin Sepharose High Performance Beads (GE Healthcare)</td><td></td><td></td><td></td></tr><tr><td>Ribosome resuspension buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Lysis buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose cushion (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose chase solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Plasmodium cell culture media (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA capture Wash Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA Elution Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENT SETUP&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>500 ml RPMI-1640 w/ L-glutamine</td><td></td><td></td><td></td></tr><tr><td>0.5 ml gentamicin</td><td></td><td></td><td></td></tr><tr><td>5 ml HT supplement</td><td></td><td></td><td></td></tr><tr><td>2.5 ml 45% glucose</td><td></td><td></td><td></td></tr><tr><td>25 ml 10% AlbuMAX I</td><td></td><td></td><td></td></tr><tr><td>12.5 ml 1 M HEPES</td><td></td><td></td><td></td></tr><tr><td>Sterile filter with 0.2 mm vacuum filter flask.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media containing 10x CHX&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as Plasmodium cell culture media above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM cycloheximide</td><td></td><td></td><td></td></tr><tr><td>Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;1x PBS containing cycloheximide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 &lt;sup&gt;O&lt;/sup&gt;C until use.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Ribosome resuspension buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>400 mM potassium acetate</td><td></td><td></td><td></td></tr><tr><td>25 mM potassium HEPES, pH 7.2</td><td></td><td></td><td></td></tr><tr><td>15 mM magnesium acetate</td><td></td><td></td><td></td></tr><tr><td>200 mM cycloheximide (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM DTT (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM PMSF (add fresh)</td><td></td><td></td><td></td></tr><tr><td>40 U/ml RNaseOUT (add fresh)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>1% (v/v) Igepal CA-630</td><td></td><td></td><td></td></tr><tr><td>0.5% (w/v) DOC</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Sucrose solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose to make 15% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose to make 50% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose to make 0.5 M sucrose cushion</td><td></td><td></td><td></td></tr><tr><td>As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td><td></td><td></td><td></td></tr><tr><td>The 60% sucrose chase solution requires only sucrose and water, no other components</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>20 mM&amp;nbsp; KCl</td><td></td><td></td><td></td></tr><tr><td>5 unit/ml Rnase Out (Invitrogen)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Elution Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as RNA Capture Wash Buffer, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM Biotin</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td><td></td><td></td><td></td></tr><tr><td>SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td><td></td><td></td><td></td></tr><tr><td>Ultra-Clear&lt;sup&gt;TM&lt;/sup&gt; &amp;frac12; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td><td></td><td></td><td></td></tr><tr><td>Polyallomer 9/16 x 3 &amp;frac12; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td><td></td><td></td><td></td></tr><tr><td>L8-80M ultracentrifuge (Beckman)</td><td></td><td></td><td></td></tr><tr><td>Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)</td><td></td><td></td><td></td></tr><tr><td>1 ml syringe with 27 G&amp;frac12; needle (Becton Dickinson, cat no. 309623)</td><td></td><td></td><td></td></tr><tr><td>5 ml syringe (Becton Dickinson, cat. no. 309646)</td><td></td><td></td><td></td></tr><tr><td>Parafilm</td><td></td><td></td><td></td></tr><tr><td>Tube rotator, end-over-end</td><td></td><td></td><td></td></tr><tr><td>Microcentrifuge, refrigerated</td><td></td><td></td><td></td></tr><tr><td>Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td><td></td><td></td><td></td></tr><tr><td>TracerDAQ (Measurement Computing)</td><td></td><td></td><td></td></tr><tr><td>Eppendorf 5810R centrifuge</td><td></td><td></td><td></td></tr><tr><td>Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td><td></td><td></td><td></td></tr></tbody></table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

Die genetische Variation für die Sichelzell Allel verantwortlich (HBS) ermöglicht Erythrozyten auf eine Infektion durch den Malaria-Parasiten, P. wider falciparum. Die molekulare Grundlage dieses Widerstands, von dem bekannt ist multifaktoriell, bleibt unvollständig verstanden. Jüngste Studien festgestellt, dass die unterschiedliche Expression von Erythrozyten microRNAs, einmal in Malaria-Parasiten transloziert, wirken sich sowohl auf die Genregulation und Parasitenwachstum. Diese miRNAs wurden später gezeigt, um mRNA-Translation durch Bildung einer chimären RNA-Transkript über 5 &#39;RNA-Fusion mit diskreten Teilmengen von Parasiten mRNAs hemmen. Hierbei sind die Techniken, die verwendet wurden, um die funktionelle Rolle und putative Mechanismus zugrunde liegende Erythrozyten mikroRNAs an der Genregulation und Translations Potential von P. studieren falciparum, einschließlich der Transfektion von modifizierten synthetischen mikroRNAs in Wirts Erythrozyten, werden detailliert beschrieben. Schließlich wird eine Polysomen-Gradientenverfahren verwendet, um das Ausmaß zu bestimmen translation dieser Transkripte. Gemeinsam dürfen diese Techniken uns zu zeigen, dass die fehlregulierte Ebenen der Erythrozyten microRNAs tragen zur Zell intrinsische Malaria Widerstand der Sichel-Erythrozyten.

Globale Profilierung der menschlichen microRNA in P. falciparum Die hier vorgestellten Techniken wurden verwendet, um Mikro-RNAs von Parasiten in einer Vielzahl von Bedingungen zu extrahieren. Eine Sache zu beachten ist, dass RNA-Extraktionen für die nicht infizierten Erythrozyten wurden durchgeführt, wie in 32, die oft als Bezugspunkt für die microRNA Daten sowohl in diesem Artikel und der ursprünglichen Studie 29 vorgestellt serviert angezeigt. Diese früheren Studien zeigten auch, dass HbSS Erythrozyten besitzen weit größere Konzentration bestimmter miRNAs, miR-451 im Besonderen. Die oben angegebenen Techniken waren ausreichend, um die Veränderungen in der miRNA Fluss in HBS (HBAs oder HBSS) infizierenden Parasiten demonstrieren. RNA-Proben wurden wie oben entnommen und normalisiert gegen 18S rRNA angegeben. Parasiten Proben aus HbSS RBCs, zum Beispiel, zeigen einen signifikanten Anstieg des Niveaus von mehreren mikroRNAs einschließlich miR-451 (Abbildung 1). Die Aufnahme von miRNA aus der Wirts erythrocyte steht auch im Einklang mit früheren Studien 34,35. Transfektion von HbAA Erythrozyten mit miR-451 erhöhte HbAA miR-451 auf ein Niveau ähnlich HbSS Erythrozyten (Abbildung 1). Durchflusszytometrie wurde dann auf Parasiteninfektion zu messen, um die Auswirkungen der miRNA-Translokation bei Parasitenwachstum bewerten verwendet. Basierend auf, dass, HbAA Erythrozyten mit miR-451, miR-223 und miR-181a transfiziert, zusammen mit einer ssDNA Oligo wurden die Auswirkungen von microRNAs auf Parasitenwachstum untersucht. Transfektion von ssDNA oder miR-181a hatte keine Wirkung auf die Parasitämie (2A - D) während der Transfektion mit miR-451 deutlich reduziert Parasitämie, die nur durch abgemildert werden könnte Cotransfektion eines antisense miR-451 Oligo. Sperrung von microRNAs durch Transfektion von 2&#39;-O-Me-Antisense-microRNAs zeigten eine Wechselwirkung. HbSS Erythrozyten, mit natürlich höheren miR-451 Ebenen wurden transfizierte<html> mit Antisense-miR-451 oder 2&#39;-O-Methyl-Oligonucleotide (Figur 3). Hemmung von miR-451 erhöht Parasitenwachstum in beiden HbSS Erythrozyten (3C - F). Parasiten Prozentsätze wurden aus mindestens 3 unabhängigen Transfektionen berechnet, dann gemittelt und als fache Veränderung relativ zu HbSS Wachstum (3F) dargestellt. Erfassung von miRNA-mRNA-Fusion RNAs durch Biotin-Capture-Assay Nach der Transfektion von 5&#39;-Desthiobiotin-miR-451 (5&#39;Db-miR-451) und 5&#39;Db-miR-181, wie in Methoden Abschnitt 5 angegeben, es wurde festgestellt, dass die beobachtete miRNA-Sequenz stammt von menschlichen microRNA. qRT-PCR-Analyse zeigte, daß die Transfektion von 5&#39;Db-miR-451 führte zu einer Anreicherung der PKA-R Fusionstranskripte (Abbildung 4). Polysom ​​Trennung, die ribosomale Belegung von P. bestimmen falciparum Zelt &quot;&gt; Ein typisches A 254 Trace ist in 5A (mit Nord Bestätigung der rRNA-Gehalt in 5B) gezeigt, wobei die Fraktion Dichte erhöht wird von links nach rechts in der Grafik (dh leichteren Fraktionen nach links). Den ersten A 254 ist recht hoch, da die Absorption durch das Hämoglobin in den frühen Fraktionen, aber schnell sinkt auf der Basislinie. Die erste kleine Peak entspricht der kleinen ribosomalen Untereinheit (40S), schnell gefolgt von der zweiten Spitze, der etwas größer ist, und entspricht der große ribosomalen Untereinheit (60S). Die dritte Spitze, die in der Regel ist die größte für P. falciparum, entspricht der monosome Peak (80S). Aufgrund seiner Höhe sollten die 80S als Leitfaden verwendet werden, um die Empfindlichkeit des UV-Detektors einzustellen für nachfolgende Durchläufe (Schritt 6.17). Auch aufgrund der Größe des 80S-Peak, ist es üblich, den 60er Jahren zu signalisieren, wie eine &quot;Schulter&quot; zu Beginn des monosome Spitzen verwischen, wenn beide den 60er und 80er JahrenSignale groß sind. Im Anschluss an die Spitzen monosome sind die Peaks, die Polysomen. Jeder aufeinanderfolgende Peak repräsentiert eine Polysomen-Anteil für progressiv größere Zahl von Ribosomen (2, 3, 4, etc.). Jedes Polysom ​​Peak ist auch kleiner als der bisherige Spitzenwert, Abnahme in der Höhe von 2-3 fach mit jedem aufeinanderfolgenden Polysom ​​Nummer. Typische Läufe werden die Auflösung der Polysomen von 5-7 Ribosomen zusammengesetzt erlauben, obwohl Auflösung von bis zu einem 9-mer Polysom ​​in einigen Durchläufen mit einer großen Menge an Ausgangsmaterial beobachtet. Höherer Ordnung Polysomen bilden den Rest der Spur, und können nicht unter diesen Gradientenbedingungen gelöst werden. <img alt="Abbildung 1" src="/files/ftp_upload/53214/53214fig1.jpg" /> Abbildung 1: MiR-451 werden in HBSS Erythrozyten erhöht Intraparasitic miR-451 Ebenen, wie Echtzeit-PCR und bestimmt normiert gegen 18S rRNA, von Parasiten aus dem angegeben isoliert.Erythrozyten Typen. Die Werte sind Mittelwerte ± SE. <img alt="Figur 2" src="/files/ftp_upload/53214/53214fig2.jpg" /> Abbildung 2: Überexpression von miR-451 im normalen Erythrozyten hemmt das Wachstum des Parasiten (A - C) Repräsentative FACS Plots anzeigt Infektionsraten, als Prozentsatz der Gesamt RBC, werden von m1 angedeutet, für die gezeigten Erythrozytenarten.. (D) Composite-Infektionsraten von FACS abgeleitet und normalisiert gegen untransfizierte HbAA RBCs. Werte im Bedienfeld AC sind repräsentative FACS Plots während D Mittelwert ± SE. <img alt="Figur 3" src="/files/ftp_upload/53214/53214fig3.jpg" /> Abb. 3: Die Hemmung der miR-451 in Sichelzellen Erythrozyten erhöht Parasitenwachstum (A - E) Repräsentative FACS Plots anzeigt Infektionsraten, als Prozentsatz der Gesamt RBC, werden von m1 angegeben, für die er gezeigtythrocyte Typen. (F) Composite-Infektionsraten von FACS abgeleitet und als normalisierter Wert gegenüber untransfizierten HbAA RBCs aufgetragen. Werte im Bedienfeld AE sind repräsentative FACS Plots ist F Mittelwert ± SE. <img alt="Figur 4" src="/files/ftp_upload/53214/53214fig4.jpg" /> Abbildung 4: Transfektion von miR-451 bereichert für PKA-R Fusionstranskripte und zeigt, dass das fusionierte miRNA ist erythrozytären Ursprungs Anreicherung der angegebenen Desthiobiotin konjugierten miRNA-mRNA-Transkripte, die durch Fusion Streptavidin gefangen genommen wurden.. Werte wurden mittels real-time PCR gemessen und als relativer Wert im Vergleich zu nicht-transfizierten Parasiten. Die Werte sind Mittelwerte ± SE. <img alt="Figur 5" src="/files/ftp_upload/53214/53214fig5.jpg" /> Abbildung 5:. Parasite Ribosomen über Saccharose-Gradienten isoliert werden (A - B) Blutzuckerwerle Spuren einer Polysom ​​Profil von Plasmodium falciparum extrahiert. (A) Spur eines Polysom ​​Profil von Plasmodium falciparum extrahiert, mit den 40S, 60S, 80S und Polysomen Peaks (mit # s, die die Anzahl von Ribosomen assoziiert) angezeigt. (B) Northern Blot von 18S und 28S rRNA für die ribosomale Fraktionen. Die Werte sind Mittelwerte ± SE.

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Aufrufe.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Serie: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Neuartige RNA-bindende Proteine ​​Isolation durch die rasche Methodik

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Forschung

Genetik

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

Biochemie

Improving Small RNA-seq: Less Bias and Better Detection of 2'-O-Methyl RNAs

The study of small RNAs (sRNAs) by next-generation sequencing (NGS) is challenged by bias issues during library preparation. Several types of sRNA such as plant microRNAs (miRNAs) carry a 2&#39;-O-methyl (2&#39;-OMe) modification at their 3&#39;&#160;terminal nucleotide. This modification adds another difficulty as it inhibits 3&#39;&#160;adapter ligation. We previously demonstrated that modified versions of the &#39;TruSeq (TS)&#39;&#160;protocol have less bias and an improved detection of 2&#39;-OMe RNAs. Here we describe in detail protocol &#39;TS5&#39;, which showed the best overall performance. TS5 can be followed either using homemade reagents or reagents from the TS kit, with equal performance.

We present a detailed small RNA library reparation protocol with less bias than standard methods and an increased sensitivity for 2&#39;-O-methyl RNAs. This protocol can be followed using homemade reagents to save cost or using kits for convenience.

Verbesserung der kleinen RNA-Seq: Weniger Voreingenommenheit und bessere Detektion von 2'-O-Methyl RNAs

The study of small RNAs (sRNAs) by next-generation sequencing (NGS) is challenged by bias issues during library preparation. Several types of sRNA such as ...

Studying RNA Interactors of Protein Kinase RNA-Activated during the Mammalian Cell Cycle

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral RNAs. When bound to viral double-stranded RNAs (dsRNAs), PKR undergoes dimerization and subsequent autophosphorylation. Phosphorylated PKR (pPKR) becomes active and induces phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2&#945;) to suppress global translation. Increasing evidence suggests that PKR can be activated under physiological conditions such as during the cell cycle or under various stress conditions without infection. However, our understanding of the RNA activators of PKR is limited due to the lack of a standardized experimental method to capture and analyze PKR-interacting dsRNAs. Here, we present an experimental protocol to specifically enrich and analyze PKR bound RNAs during the cell cycle using HeLa cells. We utilize the efficient crosslinking activity of formaldehyde to fix PKR-RNA complexes and isolate them via immunoprecipitation. PKR co-immunoprecipitated RNAs can then be further processed to generate a high-throughput sequencing library. One major class of PKR-interacting cellular dsRNAs is mitochondrial RNAs (mtRNAs), which can exist as intermolecular dsRNAs through complementary interaction between the heavy-strand and the light-strand RNAs. To study the strandedness of these duplex mtRNAs, we also present a protocol for strand-specific qRT-PCR. Our protocol is optimized for the analysis of PKR-bound RNAs, but it can be easily modified to study cellular dsRNAs or RNA-interactors of other dsRNA binding proteins.

We present experimental approaches for studying RNA-interactors of double-stranded RNA binding protein kinase RNA-activated (PKR) during the mammalian cell cycle using HeLa cells. This method utilizes formaldehyde to crosslink RNA-PKR complexes and immunoprecipitation to enrich PKR-bound RNAs. These RNAs can be further analyzed through high-throughput sequencing or qRT-PCR.

Studium der RNA Interaktoren des RNA während der Säugetier-Zelle Zyklus aktiviert Proteinkinase

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral ...

MS2-Affinity Purification Coupled with RNA Sequencing in Gram-Positive Bacteria

Although small regulatory RNAs (sRNAs) are widespread among the bacterial domain of life, the functions of many of them remain poorly characterized notably due to the difficulty of identifying their mRNA targets. Here, we described a modified protocol of the MS2-Affinity Purification coupled with RNA Sequencing (MAPS) technology, aiming to reveal all RNA partners of a specific sRNA in vivo. Broadly, the MS2 aptamer is fused to the 5&#8217; extremity of the sRNA of interest. This construct is then expressed in vivo, allowing the MS2-sRNA to interact with its cellular partners. After bacterial harvesting, cells are mechanically lysed. The crude extract is loaded into an amylose-based chromatography column previously coated with the MS2 protein fused to the maltose binding protein. This enables the specific capture of MS2-sRNA and interacting RNAs. After elution, co-purified RNAs are identified by high-throughput RNA sequencing and subsequent bioinformatic analysis. The following protocol has been implemented in the Gram-positive human pathogen Staphylococcus aureus and is, in principle, transposable to any Gram-positive bacteria. To sum up, MAPS technology constitutes an efficient method to deeply explore the regulatory network of a particular sRNA, offering a snapshot of its whole targetome. However, it is important to keep in mind that putative targets identified by MAPS still need to be validated by complementary experimental approaches.

MAPS technology has been developed to scrutinize the targetome of a specific regulatory RNA in vivo. The sRNA of interest is tagged with a MS2 aptamer enabling the co-purification of its RNA partners and their identification by RNA sequencing. This modified protocol is particularly suited for Gram-positive bacteria.&#160;

MS2-Affinitätsreinigung gekoppelt mit RNA-Sequenzierung in grampositiven Bakterien

Although small regulatory RNAs (sRNAs) are widespread among the bacterial domain of life, the functions of many of them remain poorly characterized ...

MicroRNA-based Regulation of Picornavirus Tropism

Cell-specific restriction of viral replication without concomitant attenuation can benefit vaccine development, gene therapy, oncolytic virotherapy, and understanding the biological properties of viruses. There are several mechanisms for regulating viral tropism, however they tend to be virus class specific and many result in virus attenuation. Additionally, many viruses, including picornaviruses, exhibit size constraints that do not allow for incorporation of large amounts of foreign genetic material required for some targeting methods. MicroRNAs are short, non-coding RNAs that regulate gene expression in eukaryotic cells by binding complementary target sequences in messenger RNAs, preventing their translation or accelerating their degradation. Different cells exhibit distinct microRNA signatures and many microRNAs serve as biomarkers. These differential expression patterns can be exploited for restricting gene expression in cells that express specific microRNAs while maintaining expression in cells that do not. In regards to regulating viral tropism, sequences complementary to specific microRNAs are incorporated into the viral genome, generally in the 3' non-coding regions, targeting them for destruction in the presence of the cognate microRNAs thus preventing viral gene expression and/or replication. MicroRNA-targeting is a technique that theoretically can be applied to all viral vectors without altering the potency of the virus in the absence of the corresponding microRNAs. Here we describe experimental methods associated with generating a microRNA-targeted picornavirus and evaluating the efficacy and specificity of that targeting in vitro. This protocol is designed for a rapidly replicating virus with a lytic replication cycle, however, modification of the time points analyzed and the specific virus titration readouts used will aid in the adaptation of this protocol to many different viruses.

We describe here a method for regulating picornavirus tropism by incorporating sequences complementary to specific microRNAs into the viral genome. This protocol can be adapted to all different classes of viruses with modifications based upon the length and nature of their life cycle.

MicroRNA-basierten Regulation der Picornavirus Tropism

Cell-specific restriction of viral replication without concomitant attenuation can benefit vaccine development, gene therapy, oncolytic virotherapy, and ...

Immunologie und Infektion

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent<em&gt; In Situ</em&gt; Hybridisierung (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

Biologie

A Non-Coding Small RNA MicC Contributes to Virulence in Outer Membrane Proteins in Salmonella Enteritidis

A non-coding small RNA (sRNA) is a new factor to regulate gene expression at the post-transcriptional level. A kind of sRNA MicC, known in Escherichia coli and Salmonella Typhimurium, could repress the expression of outer membrane proteins. To further investigate the regulation function of micC in Salmonella Enteritidis, we cloned the micC gene in the Salmonella Enteritidis strain 50336, and then constructed the mutant 50336&#916;micC by the &#955; Red-based recombination system and the complemented mutant 50336&#916;micC/pmicC carrying recombinant plasmid pBR322 expressing micC. qRT-PCR results demonstrated that transcription of ompD in 50336&#916;micC was 1.3-fold higher than that in the wild type strain, while the transcription of ompA and ompC in 50336&#916;micC were 2.2-fold and 3-fold higher than those in the wild type strain. These indicated that micC represses the expression of ompA and ompC. In the following study, the pathogenicity of 50336&#916;micC was detected by both infecting 6-week-old Balb/c mice and 1-day-old chickens. The result showed that the LD50 of the wild type strain 50336, the mutants 50336&#916;micC and 50336&#916;micC/pmicC for 6-week-old Balb/c mice were 12.59 CFU, 5.01 CFU, and 19.95 CFU, respectively. The LD50 of the strains for 1-day-old chickens were 1.13 x 109 CFU, 1.55 x 108 CFU, and 2.54 x 108 CFU, respectively. It indicated that deletion of micC enhanced virulence of S. Enteritidis in mice and chickens by regulating expression of outer membrane proteins.

A Non-Coding Small RNA MicC Contributes to Virulence in Outer Membrane Proteins in Salmonella Enteritidis

An &#955;-Red-mediated recombination system was used to create a deletion mutant of a small non-coding RNA micC.

Eine nicht-kodierende kleine RNA MicC trägt zur Virulenz von Proteinen der äußeren Membran in Salmonella enteritidis bei

A non-coding small RNA (sRNA) is a new factor to regulate gene expression at the post-transcriptional level. A kind of sRNA MicC, known in Escherichia ...

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular biology has been greatly fueled by the discovery of noncoding RNAs as major players in post-transcriptional regulation. Such a revolutionary perspective has been accompanied and triggered by the development of powerful technologies for profiling short RNAs expression, both at the high-throughput level (genome-wide identification) or as single-candidate analysis (steady state accumulation of specific species). Although several state-of-art strategies are currently available for dosing or visualizing such fleeing molecules, Northern Blot assay remains the eligible approach in molecular biology for immediate and accurate evaluation of RNA expression. It represents a first step toward the application of more sophisticated, costly technologies and, in many cases, remains a preferential method to easily gain insights into RNA biology. Here we overview an efficient protocol (Enhanced Northern Blot) for detecting weakly expressed microRNAs (or other small regulatory RNA species) from Drosophila melanogaster whole embryos, manually dissected larval/adult tissues or in vitro cultured cells. A very limited amount of RNA is required and the use of material from flow cytometry-isolated cells can be also envisaged.

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

The aim of this publication is to visualize and discuss the operative steps of an Enhanced Northern Blot protocol on RNA extracted from Drosophila melanogaster embryos, cells, and tissues. This protocol is particularly useful for the efficient detection of small RNA species.

Verbesserte Northern Blot Detektion von kleinen RNA-Spezies in<em&gt; Drosophila melanogaster</em

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Neuartige RNA-bindende Proteine Isolation durch die rasche Methodik

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Verbesserung der kleinen RNA-Seq: Weniger Voreingenommenheit und bessere Detektion von 2'-O-Methyl RNAs

Studium der RNA Interaktoren des RNA während der Säugetier-Zelle Zyklus aktiviert Proteinkinase

MS2-Affinitätsreinigung gekoppelt mit RNA-Sequenzierung in grampositiven Bakterien

MicroRNA-basierten Regulation der Picornavirus Tropism

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent

Eine nicht-kodierende kleine RNA MicC trägt zur Virulenz von Proteinen der äußeren Membran in Salmonella enteritidis bei

Verbesserte Northern Blot Detektion von kleinen RNA-Spezies in

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Methoden, um die regulatorische Rolle kleiner RNAs und Ribosomal Belegung von Untersuchen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Neuartige RNA-bindende Proteine ​​Isolation durch die rasche Methodik

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Verbesserung der kleinen RNA-Seq: Weniger Voreingenommenheit und bessere Detektion von 2'-O-Methyl RNAs

Studium der RNA Interaktoren des RNA während der Säugetier-Zelle Zyklus aktiviert Proteinkinase

MS2-Affinitätsreinigung gekoppelt mit RNA-Sequenzierung in grampositiven Bakterien

MicroRNA-basierten Regulation der Picornavirus Tropism

Analyse von Einzel-Zell-Gene Transkription durch RNA-Fluorescent

Eine nicht-kodierende kleine RNA MicC trägt zur Virulenz von Proteinen der äußeren Membran in Salmonella enteritidis bei

Verbesserte Northern Blot Detektion von kleinen RNA-Spezies in

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Neuartige RNA-bindende Proteine Isolation durch die rasche Methodik