This research was supported by start-up funds from Northwestern University and a National Science Foundation CAREER Award (IOS-1751035), both granted to E.C.A.

<ol>
	<li>Fr&#233;zal, L., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+outside+the+Petri+dish.">C. elegans outside the Petri dish.</a> eLife. 4, 05849 (2015).</li><li>Sivasundar, A., Hey, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+from+natural+populations+with+RNAI+reveals+high+outcrossing+and+population+structure+in+Caenorhabditis+elegans.">Sampling from natural populations with RNAI reveals high outcrossing and population structure in Caenorhabditis elegans.</a> Current Biology: CB. 15 (17), 1598-1602 (2005).</li><li>Kiontke, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogeny+and+molecular+barcodes+for+Caenorhabditis,+with+numerous+new+species+from+rotting+fruits.">A phylogeny and molecular barcodes for Caenorhabditis, with numerous new species from rotting fruits.</a> BMC Evolutionary Biology. 11, 339 (2011).</li><li>Petersen, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ten+years+of+life+in+compost:+temporal+and+spatial+variation+of+North+German+Caenorhabditis+elegans+populations.">Ten years of life in compost: temporal and spatial variation of North German Caenorhabditis elegans populations.</a> Ecology and Evolution. 5 (16), 3250-3263 (2015).</li><li>Richaud, A., Zhang, G., Lee, D., Lee, J., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+local+coexistence+pattern+of+selfing+genotypes+in+Caenorhabditis+elegans+natural+metapopulations.">The local coexistence pattern of selfing genotypes in Caenorhabditis elegans natural metapopulations.</a> Genetics. 208 (2), 807-821 (2018).</li><li>Ferrari, C., Salle, R., Callemeyn-Torre, N., Jovelin, R., Cutter, A. D., Braendle, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ephemeral-habitat+colonization+and+neotropical+species+richness+of+Caenorhabditis+nematodes.">Ephemeral-habitat colonization and neotropical species richness of Caenorhabditis nematodes.</a> BMC Ecology. 17 (1), 43 (2017).</li><li>Crombie, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sampling+of+Hawaiian+Caenorhabditis+elegans+reveals+high+genetic+diversity+and+admixture+with+global+populations.">Deep sampling of Hawaiian Caenorhabditis elegans reveals high genetic diversity and admixture with global populations.</a> eLife. 8, 50465 (2019).</li><li>Crombie, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+adaptation+and+spatiotemporal+patterns+of+genetic+diversity+revealed+by+repeated+sampling+of+Caenorhabditis+elegans+across+the+Hawaiian+Islands.">Local adaptation and spatiotemporal patterns of genetic diversity revealed by repeated sampling of Caenorhabditis elegans across the Hawaiian Islands.</a> bioRxiv. , (2021).</li><li>Noble, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selfing+is+the+safest+sex+for+Caenorhabditis+tropicalis.">Selfing is the safest sex for Caenorhabditis tropicalis.</a> eLife. 10, 62587 (2021).</li><li>Cutter, A. D., Morran, L. T., Phillips, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Males,+Outcrossing,+and+Sexual+Selection+in+Caenorhabditis+Nematodes.">Males, Outcrossing, and Sexual Selection in Caenorhabditis Nematodes.</a> Genetics. 213 (1), 27-57 (2019).</li><li>Petersen, C., Dirksen, P., Schulenburg, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Why+we+need+more+ecology+for+genetic+models+such+as+C.+elegans.">Why we need more ecology for genetic models such as C. elegans.</a> Trends in Genetics: TIG. 31 (3), 120-127 (2015).</li><li>Haber, M., Sch&#252;ngel, M., Putz, A., M&#252;ller, S., Hasert, B., Schulenburg, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+history+of+Caenorhabditis+elegans+inferred+from+microsatellites:+evidence+for+spatial+and+temporal+genetic+differentiation+and+the+occurrence+of+outbreeding.">Evolutionary history of Caenorhabditis elegans inferred from microsatellites: evidence for spatial and temporal genetic differentiation and the occurrence of outbreeding.</a> Molecular Biology and Evolution. 22 (1), 160-173 (2005).</li><li>Barri&#232;re, A., F&#233;lix, M. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+C.+elegans+and+Related+Nematodes.">Isolation of C. elegans and Related Nematodes.</a> WormBook. , (2018).</li><li>Poullet, N., Braendle, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+and+isolation+of+C.+elegans+from+the+natural+habitat.">Sampling and isolation of C. elegans from the natural habitat.</a> Methods in Molecular Biology. 1327, 221-229 (2015).</li><li>Di Bernardo, M., Crombie, T. A., Cook, D. E., Andersen, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=easyFulcrum:+An+R+package+to+process+and+analyze+ecological+sampling+data+generated+using+the+Fulcrum+mobile+application.">easyFulcrum: An R package to process and analyze ecological sampling data generated using the Fulcrum mobile application.</a> PloS one. 16 (10), 0254293 (2021).</li><li>. Mobile data collection &amp; workflow automation in NCAP Available from: <a target="_blank" href="https://www.fulcrumapp.com/">https://www.fulcrumapp.com/</a> (2021)</li><li>. Nematode Isolation Application Available from: <a target="_blank" href="https://www.fulcrumapp.com/apps/nematode-isolation">https://www.fulcrumapp.com/apps/nematode-isolation</a> (2021)</li><li>. Nematode Field Sampling Application Available from: <a target="_blank" href="https://www.fulcrumapp.com/apps/nematode-field-sampling">https://www.fulcrumapp.com/apps/nematode-field-sampling</a> (2021)</li><li>. JOVE wild_isolate-genotyping-template Available from: <a target="_blank" href="https://docs.google.com/spreadsheets/d/1oEP40jy6_K6Wkwn7Qm4iF58rTUe4JWk2zhJ20-keoOk/edit">https://docs.google.com/spreadsheets/d/1oEP40jy6_K6Wkwn7Qm4iF58rTUe4JWk2zhJ20-keoOk/edit</a> (2021)</li><li>. Nucleotide BLAST: Search nucleotide databases using a nucleotide query Available from: <a target="_blank" href="https://blast.ncbi.nim.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch">https://blast.ncbi.nim.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch</a> (2021)</li><li>Andersen, E. C., Bloom, J. S., Gerke, J. P., Kruglyak, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variant+in+the+neuropeptide+receptor+npr-1+is+a+major+determinant+of+Caenorhabditis+elegans+growth+and+physiology.">A variant in the neuropeptide receptor npr-1 is a major determinant of Caenorhabditis elegans growth and physiology.</a> PLoS Genetics. 10 (2), 1004156 (2014).</li><li>Tuli, M. A., Daul, A., Schedl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WormBook:+Caenorhabditis+Nomenclature.">WormBook: Caenorhabditis Nomenclature.</a> WormBook. , (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WormBook:+Maintenance+of+C.+Elegant.">WormBook: Maintenance of C. Elegant.</a> WormBook. , (2006).</li></ol>

The authors report no conflicts of interest.

This protocol contains critical steps that must be executed with caution. For example, it is important that the field and isolation teams are careful to select the correct collection project in the application prior to collecting samples from the field or isolating nematodes from the samples in the laboratory. In the event that the wrong collection project is selected, the errant data records are best corrected in the Fulcrum database using the record editing tools online. This process can be tedious for many misplaced records. However, the database retains any changes to records so that a complete auditing of collection and isolation records is possible. The other critical steps in this protocol involve the handling of samples from the field and the nematodes isolated from those samples. To ensure Caenorhabditis nematodes survive the sampling and shipment steps, the temperature of samples should be maintained between 4 &#176;C and 25 &#176;C. Temperatures above 25 &#176;C can cause sterility in C. elegans14. Ensure samples are transferred from collection bags to collection plates within five days whenever possible to minimize the loss to nematodes. After nematodes are isolated, it is critical that they are genotyped and cryopreserved before they perish. It is difficult to find living nematodes on S-plates that are more than two to three weeks old because fungal and bacterial contamination can make the S-plates inhospitable.
This protocol can be modified easily to accommodate different types of data that researchers may want to collect while in the field. For example, it is easy to customize the &#39;Nematode field sampling&#39; application with new data entry fields using Fulcrum&#39;s online GUI for application editing. Moreover, the data analysis package, easyFulcrum, can accommodate these edits when processing the new data15. Another modification users may find appealing is to use a different sampling method in the field. Rather than sampling discrete substrates, researchers may desire to sample larger areas containing multiple substrate types. These larger samples are best processed in the laboratory using the Baermann funnel or tray extraction methods13. Importantly, the use of C-labels and S-labels still apply for these techniques and are therefore compatible with mobile applications.
The primary limitations of this protocol relate to the handling time of nematodes prior to isolation in the laboratory. First, the lag time between sample collection and nematode isolation makes it impossible to record the developmental stages of nematodes on a given sample at the time of collection. Second, the frequency of males and outcrossing in nature are key evolutionary questions for selfing Caenorhabditis nematodes10. This method is not well suited to addressing these questions because nematodes are likely to have gone through multiple generations prior to isolation. Delayed isolation means that direct evidence of male frequency in nature is impossible. Furthermore, the multi-generational delay during the genotyping steps means that genomic evidence of outcrossing (heterozygosity) will be eroded before a nematode strain can be sequenced. To identify heterozygosity in nature, the offspring produced by a nematode directly isolated from nature are used for sequencing2. Another potential limitation of this protocol is that it is biased toward the identification of selfing Caenorhabditis. This is because isolated nematodes of selfing species have a greater chance of proliferating than obligate outcrossers, which will only proliferate if a fertilized female is isolated.
This collection method is based on existing collection protocols13,14. The major advancement of this technique is the use of mobile technology and customized software to facilitate the organization of vast quantities of ecological and molecular data associated with large-scale collection projects. The ecological data generated using this collection protocol can be used to address outstanding questions for natural populations of Caenorhabditis species. For example, data generated with this method have been used to discover niche preferences for the species across the Hawaiian Islands. Moreover, by sequencing the genomes of cryopreserved nematodes, researchers can investigate how patterns of genetic variation are correlated with ecological data. Research of this kind can uncover signatures of local adaptation in Caenorhabditis populations and provide important insights into the relevance of genetic variation in natural contexts8. To gain a functional understanding of many genes in Caenorhabditis nematodes, ecological studies are likely required11. Even for C. elegans a large fraction of genes lacks functional annotations, despite it being the first multicellular animal to be sequenced and one of the most thoroughly studied animals on Earth. This collection protocol was developed to help address this knowledge gap by facilitating the collection of wild Caenorhabditis nematodes and the study of their ecology and natural genetic diversity.

The last two decades have brought an increased interest in the ecology of Caenorhabditis nematodes. From these studies, we know that the free-living Caenorhabditis species can be isolated from ephemeral micro-habitats in both temperate and tropical regions, where they feed on microbial blooms associated with decomposing plant material, sometimes in sympatry1,2,3,4,5,6,7,8. We have also learned that convergent evolution of self-fertilization has occurred in the genus three times, and selfing is the dominant mode of reproduction for C. briggsae, C. elegans, and C. tropicalis9,10. Among these selfers, C. elegans is one of the most widely studied animals on Earth and has been used by researchers to make critical advances in biology. Importantly, the other selfing Caenorhabditis species share many of C. elegans experimental advantages and are rapidly advancing comparative studies in the genus. However, the cryptic nature of these nematodes in the wild makes it difficult to study their ecology and natural diversity, which is critical for understanding the biological functions of their genes and the ways in which evolution has shaped genetic diversity among the species10,11.
The greatest challenge to studying the ecology of selfing Caenorhabditis nematodes in the wild is their small size; adult nematodes are often 1 mm in length or less. This challenge requires that researchers sample substrates from the wild and attempt to separate nematodes of interest from the substrates in the laboratory without the ability to observe animals in the wild. Because even trained experts find it difficult to discriminate selfing Caenorhabditis nematodes from other free-living nematodes under the microscope, nematodes are typically removed from the substrate, isolated, and left to proliferate before they are identified by sequence identity using established molecular barcodes3,12,13,14. The time and effort required to process each nematode in this way present an organizational challenge, as researchers must be able to trace the identity of each nematode isolated in the laboratory back to the exact substrate and associated ecological data sampled in the field. Here, we describe a step-by-step process to efficiently collect and identify selfing Caenorhabditis nematodes from the field and faithfully link these isolates with their associated spatial and ecological data at a high scale.
This collection method increases the scale and accuracy of ecological surveys by using mobile data collection platforms, cloud-based databases, and the R software environment. Fulcrum is a customizable data-collection platform that works with most mobile devices and allows users to build custom applications to gather and organize location-based data (https://www.fulcrumapp.com). This protocol provides detailed instructions on how to use customized data-collection applications to organize spatially explicit ecological data from the field and accurately link those data with the identity of nematodes isolated in the laboratory. The protocol also explains how to efficiently identify selfing&#160;Caenorhabditis nematodes using established molecular barcodes. The data from these methods can be processed simply and reproducibly with the accompanying R software package easyFulcrum15 to explore the ecology and genetic diversity of natural Caenorhabditis populations.

<table><tbody><tr><td>Adhesive labels</td><td>Avery</td><td>61533</td><td>Printing the C-labels and S-labels</td></tr><tr><td>Agarose</td><td>Thomas Scientific</td><td>C748D75</td><td>agarose gel preparation</td></tr><tr><td>Backpack</td><td></td><td></td><td>A backpack for each team member to hold equipment, samples, food, and water for the day.</td></tr><tr><td>Cardboard boxes</td><td>Fisher Scientific</td><td>AS261</td><td>Storage of S-plates</td></tr><tr><td>Centrifuge</td><td>NA</td><td>NA</td><td>Neamtode lysis, SSU and ITS2 PCR</td></tr><tr><td>Collection bags</td><td>Zip-lock</td><td>NA</td><td>Collection of substrates</td></tr><tr><td>Digital temperature/humidity meter</td><td>Preciva</td><td>HT-86</td><td>Measurement of ambient temperature and humidity</td></tr><tr><td>Disecting scope</td><td>NA</td><td>NA</td><td>Nematode isolation, lysis</td></tr><tr><td>Disposible reservoirs</td><td>USA Scientific</td><td>1306-1010</td><td>Aliquoting PCR master mixes and loading dye</td></tr><tr><td>DNA ladder, 1 KB plus</td><td>Thermo Scientific</td><td>SM0243</td><td>Visualizing SSU and ITS2 PCR products</td></tr><tr><td>dNTPs</td><td>Thomas Scientific</td><td>CB4430-2</td><td>PCR master mix component</td></tr><tr><td>easyFulcrum R package</td><td>NA</td><td>NA</td><td>An R package for processing collection data http://andersenlab.org/easyfulcrum/articles/easyFulcrum.html</td></tr><tr><td>EDTA solution (0.5 M pH 8.0)</td><td>NA</td><td>NA</td><td>See supplemental table 3 for recipe</td></tr><tr><td>Ethanol (95%)</td><td>NA</td><td>NA</td><td>Plating out samples, spoon sterilization</td></tr><tr><td>Ethidium bromide solution (10 mg/mL)</td><td>VWR</td><td>97064-602</td><td>Visualizing SSU and ITS2 PCR products</td></tr><tr><td>External battery charger for mobile device</td><td>NA</td><td>NA</td><td>External battery charger and charging cable for iPhone or Android</td></tr><tr><td>Flask (500 mL)</td><td>Fisher Scientific</td><td>FB501500</td><td>agarose gel preparation</td></tr><tr><td>Food</td><td>NA</td><td>NA</td><td>Pack accordingly</td></tr><tr><td>Gel electrophoresis apparatus</td><td>Thermo Scientific</td><td>B2</td><td>Visualizing SSU and ITS2 PCR products</td></tr><tr><td>Gel electrophoresis power supply</td><td>BioRad</td><td>1645050</td><td>Visualizing SSU and ITS2 PCR products</td></tr><tr><td>Gel loading dye, 6x</td><td>NEB</td><td>B7022S</td><td>Visualizing SSU and ITS2 PCR products</td></tr><tr><td>ITS2 primer set</td><td>NA</td><td>NA</td><td>oECA1687 = forward primer CTGCGTTACTTACCACGAATTG&lt;br/&gt; CARAC, oECA202 = reverse primer GCGGTATTTGCTACTACCAYYAM&lt;br/&gt; GATCTGC</td></tr><tr><td>ITS2 sequencing primer</td><td>NA</td><td>NA</td><td>oECA306 = forward primer CACTTTCAAGCAACCCGAC</td></tr><tr><td>Lysis buffer</td><td>NA</td><td>NA</td><td>Nematode lysis, see protocol for recipe</td></tr><tr><td>Microwave</td><td>NA</td><td>NA</td><td>agarose gel preparation</td></tr><tr><td>Mobile device</td><td>NA</td><td>NA</td><td>Charged phone in airplane mode. The Fulcrum app GPS positions are inaccurate compared to the GPS positions extracted from pictures. This setting ensures that you use less power and get more precise GPS measurements.</td></tr><tr><td>NGMA plates, 10 cm</td><td>Fisher Scientific</td><td>FB0875713</td><td>C-plates, see Andersen et al. 2014 for NGMA plate protocol.</td></tr><tr><td>NGMA plates, 3.5 cm</td><td>Greiner Bio-One</td><td>5662-7102Q</td><td>S-plates, see Andersen et al. 2014 for NGMA plate protocol.</td></tr><tr><td>Non-contact infrared thermometer</td><td>Etekcity</td><td>B00837ZGRY</td><td>Measurement of substrate temperature</td></tr><tr><td>Paper towels</td><td>NA</td><td>NA</td><td>Paper towels for absorbing excess moisture in a bagged sample.</td></tr><tr><td>Parafilm</td><td>Fisher Scientific</td><td>13-374-12</td><td>Plate sealing</td></tr><tr><td>PCR adhesive foil</td><td>VWR</td><td>60941-126</td><td>PCR adhesive foil</td></tr><tr><td>PCR buffer (10x)</td><td>Thomas Scientific</td><td>CB3702-7</td><td>PCR master mix component</td></tr><tr><td>PCR plates (96-well)</td><td>Thomas Scientific</td><td>1149K04</td><td>SSU and ITS2 PCRs</td></tr><tr><td>Pencil</td><td>NA</td><td>NA</td><td></td></tr><tr><td>Plastic spoons</td><td>NA</td><td>NA</td><td>Plating out samples</td></tr><tr><td>Platinum pick</td><td>NA</td><td>NA</td><td>Nematode isolation, lysis</td></tr><tr><td>Pre-labeled ziplock collection bags</td><td>NA</td><td>NA</td><td>Bundles of zip-lock plastic bags pre-labelled with C-label barcodes. Each bundle should contain 25 barcoded bags wrapped with a rubber band.</td></tr><tr><td>Proteinase K</td><td>Sigma</td><td>3115879001</td><td>Nematode lysis, added to lysis buffer just prior to use</td></tr><tr><td>R software</td><td>NA</td><td>NA</td><td>R software: A language and environment for statistical computing https://www.R-project.org/</td></tr><tr><td>Soft cooler bag and ice pack</td><td>NA</td><td>NA</td><td>Collection coolers and cooler packs to keep samples cool when ambient temperature is above 25 &amp;deg;C.</td></tr><tr><td>Spare batteries</td><td>NA</td><td>NA</td><td>Extra batteries for sampling equipment</td></tr><tr><td>SSU primer set</td><td>NA</td><td>NA</td><td>oECA1271 = forward primer TACAATGGAAGGCAGCAGGC, oECA1272 = reverse primer CCTCTGACTTTCGTTCTTGATTAA</td></tr><tr><td>Strip tube caps (12-well)</td><td>Thomas Scientific</td><td>1159V29</td><td>Nematode lysis</td></tr><tr><td>Strip tubes (12-well)</td><td>Thomas Scientific</td><td>1159V31</td><td>Nematode lysis</td></tr><tr><td>TAE buffer (1x)</td><td>NA</td><td>NA</td><td>Visualizing SSU and ITS2 PCR products. See supplemental table 3 for recipe</td></tr><tr><td>Taq polymerase</td><td>Thomas Scientific</td><td>C775Y45</td><td>PCR master mix component</td></tr><tr><td>Thermocycler</td><td>NA</td><td>NA</td><td>Neamtode lysis, SSU and ITS2 PCR</td></tr><tr><td>Water</td><td>NA</td><td>NA</td><td>Pack accordingly</td></tr></tbody></table>

a highly scalable approach to perform ecological surveys of selfing caenorhabditis nematodes

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative sparsity of information about C. elegans in its natural context comes from the challenges involved in the identification of the small nematode in nature. Despite these challenges, an increasing focus on the ecology of C. elegans has caused a wealth of new information regarding its life outside of the laboratory. The intensified search for C. elegans in nature has contributed to the discovery of many new Caenorhabditis species and revealed that congeneric nematodes frequently cohabitate in the wild, where they feed on microbial blooms associated with rotting plant material. The identification of new species has also revealed that the androdioecious mating system of males and self-fertilizing hermaphrodites has evolved three times independently within Caenorhabditis. The other two selfing species, C. briggsae and C. tropicalis, share the experimental advantages of C. elegans and have enabled comparative studies into the mechanistic basis of important traits, including self-fertilization. Despite these advances, much remains to be learned about the ecology and natural diversity of these important species. For example, we still lack functional information for many of their genes, which might only be attained through an understanding of their natural ecology. To facilitate ecological research of selfing Caenorhabditis nematodes, we developed a highly scalable method to collect nematodes from the wild. Our method makes use of mobile data collection platforms, cloud-based databases, and the R software environment to enhance researchers&#39; ability to collect nematodes from the wild, record associated ecological data, and identify wild nematodes using molecular barcodes.

This protocol has been used to collect Caenorhabditis nematodes from multiple locations, including Hawaii and California. The isolation success rate for Caenorhabditis nematodes varies with collection location, climate, sampling experience, and substrate types sampled. The protocol has been used to extensively sample the Hawaiian Islands, where nine collection projects have been conducted over multiple years and seasons. The isolation success rates for selfing Caenorhabditis species are nearly identical for C. briggsae (162 of 4,506 samples, 3.6%) and C. elegans (163 of 4,506 samples, 3.6%), and much lower for C. tropicalis (26 of 4,506 samples, 0.58%)8. Each of the selfing species is enriched on rotting fruit and flower substrates relative to the other substrate categories. Sample rotting fruit and flower substrates if the researcher is attempting to maximize the success rate rather than characterize substrate preferences. However, the success rate varies with the quality of the substrate selected. For example, among fruit and flower substrates, those substrates that are too dry, wet, or fresh will likely not yield Caenorhabditis nematodes.
The scalability of this collection protocol is evident from the number of collections a single pair of researchers can collect from the wild. For example, in October of 2018, a pair of researchers using this collection protocol was able to collect a total of over 1,000 samples in 7 days from multiple locations on two Hawaiian Islands. This field team shipped the samples overnight to the laboratory, where a team of eight researchers isolated over 2,000 nematodes from the samples as they arrived. A key advantage of this protocol is that it minimizes the cost associated with sampling in remote locations by reducing the equipment and personnel required in the field. Using this protocol, a small field team can focus on sampling while the isolation team can process the samples at their home institution using fragile and heavy equipment like dissecting microscopes and agar plates for isolating nematodes. Moreover, the implementation of the mobile data-collection application allows all the field data associated with the samples to be linked directly to the C-label, which enables the isolation team to work independently from the field team while processing samples.
Researchers that use this collection protocol must consider the effort that is required to isolate nematodes prior to a collection project. The isolation and identification steps are rate-limiting, and a small collection team can quickly overwhelm isolators with samples. Moreover, the laboratory space required to process many collections can interfere with ongoing research (Figure 3). Additionally, some isolated nematodes require additional effort to genotype. For example, approximately 2% of isolates fail to amplify with the SSU PCR primer set after the first lysis attempt and must be re-lysed to ensure that the lysis material is suitable for amplification with the ITS2 primer set (Figure 8). Furthermore, approximately 3% of isolates fail to produce quality sequences after an initial round of Sanger sequencing. For these isolates, another round of lysis, ITS2 PCR, and Sanger sequencing is often required, which can increase handing time for the isolation team. Importantly, sequence identity alone is not sufficient evidence to justify a new Caenorhabditis species (Figure 7). To properly justify raising an isolate as a new Caenorhabditis species, additional effort must be made to perform mating experiments and establish a typed specimen13. A formal morphological description of the typed specimen is also preferred but not required3. Together, these considerations suggest that researchers adopting this collection protocol will benefit from trial tests of the isolation and identification steps to ensure resources are properly allocated before a collection project begins. Importantly, even small collection projects can benefit from this protocol because the process is highly reproducible, and the data can easily be audited for quality control purposes across laboratory groups.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63486/63486fig01.jpg" /> 
Figure 1: Substrate examples. (A) An ideal rotting fruit is shown in the center of the image (1), the fruit is almost unrecognizable. Less rotted fruit is shown nearby; avoid sampling freshly fallen fruits (2). (B) An ideally decomposed flower is shown at the top (3). Avoid sampling freshly fallen flowers (4). (C) The dark leaf litter under the top layer of dry leaves is ideal when sampling for selfing Caenorhabditis nematodes (5). Avoid sampling dry leaf litter (6). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63486/63486fig02.jpg" /> 
Figure 2: The Nematode Field Sampling mobile application. (A) The initial screen after opening the Nematode Field Sampling application on an Apple device in Fulcrum. The red arrow in the lower right points to the + button used to create a new collection record. (B) An example of a new collection record shown on an Apple device. The red arrow points to the &#39;Project&#39; field at the top of the collection record screen. Be sure to select the correct project when sampling in the field. The project field will default to the last project used when creating subsequent collection records. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63486/63486fig03.jpg" /> 
Figure 3: Collection bags and collection plates organized prior to plating out samples. This figure shows the samples in C-labeled collection bags on the left. Each collection bag has a matching C-labeled 10 cm plate on top of it. On the right are 10 cm collection plates that contain sample material after it was transferred from the collection bags. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63486/63486fig04.jpg" /> 
Figure 4: A collection plate (C-plate) with properly a transferred sample. A 10 cm C-plate with decomposing fruit placed on the edge of the bacterial lawn. The C-label is attached to the plate lid. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63486/63486fig05.jpg" /> 
Figure 5: The Nematode isolation mobile application. (A) The application selection screen in the Fulcrum mobile application. The red arrow points to the Nematode Isolation application. (B) The initial screen after opening the Nematode Isolation application on an Apple device in Fulcrum. The red arrow in the lower right points to the + button used to create a new isolation record. (C) An example of a new isolation record shown on an Apple device. The red arrow points to the &#39;Project&#39; field at the top of the isolation record screen. Be sure to select the correct project when isolating. The project field will default to the last project used when creating subsequent isolation records. (D) After tapping the Select field under C-label, users will tap the search button (red arrow) to find the C-label from which they are isolating nematodes. (E) After the C-label is selected, users will photograph the C-plate using the device camera. (F) Users then input whether there are nematodes on the C-plate or not. S-labels are added to the isolation record if there are nematodes to be isolated. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/63486/63486fig06.jpg" /> 
Figure 6: NCBI BLAST results page. (1) The drop-down menu used to view the BLAST results for all sequences. (2) The description of the current sequence selected from the drop-down. In this case the results for S-label S-05554 are shown. (3) The top BLAST hit for S-05554 is shown. The purple text indicates the link to visualize this alignment has been clicked. Please be sure to inspect the alignments by eye to identify possible new Caenorhabditis species, see step 9.8 above. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/63486/63486fig07.jpg" /> 
Figure 7: NCBI BLAST alignment visualization examples. (A) An example of an isolate&#39;s ITS2 query sequence aligned to a C. kamaaina subject sequence. (1) The percent identity of the alignment (89%), which is low for a top BLAST hit. (2) A mismatch between the query and subject sequence (G to A). (3) A four base pair gap in the subject sequence made by the alignment algorithm; gaps in the query or subject indicate poor alignment. (4) A generalized region in the center of the alignment with many mismatches and gaps. A region like this one suggests that the query sequence might come from a new Caenorhabditis species. Shown is an actual alignment example of a new species, C. oiwi, that was discovered in 2017. (B) An example of a good alignment between an isolate&#39;s ITS2 query sequence and a subject sequence. (5) The percent identity of the alignment (99%), which usually means the query sequence comes from an isolate of the same species as the subject. (6) A central region of the alignment with perfect identity. A region like this one suggests that the query isolate is likely the same species as the subject. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig07large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/63486/63486fig08.jpg" /> 
Figure 8: SSU and ITS2 PCR products. The top gel shows PCR products generated with the SSU primer set for 12 representative samples. A DNA ladder is included on the left as a reference. The SSU PCR products for Caenorhabditis nematodes are approximately 500 bp in length. Samples 2-12 amplified with the SSU primer set but sample one did not. The absence of a 500 bp SSU amplicon for sample one suggests that the lysis material was of poor quality and the sample must be re-lysed. The bottom gel shows PCR products generated with the ITS2 primer set for the same 12 Samples shown in the top gel. The ladder and samples are in the same orientation for both gels. Six of the 12 samples did not amplify with the ITS2 primer set. The samples with SSU and ITS2 bands are Sanger sequenced and identified by sequence similarity using the NCBI BLAST algorithm. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/63486fig08large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplemental File 1: C-labels. A PDF file containing 2500 unique C-labels. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/C-labels.pdf" target="_blank">Please click here to download this File.</a>
Supplemental File 2: S-labels. A PDF file containing 5000 unique S-labels. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/S-labels.pdf" target="_blank">Please click here to download this File.</a>
Supplemental Table 1: Field Materials. A packing list of materials used in the field to sample nematodes. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/Supplemental_Table_1.xlsx" target="_blank">Please click here to download this Table.</a>
Supplemental Table 2: PCR recipes and thermocycler conditions. A table of PCR recipes and thermocycler conditions for the ITS2 and SSU PCRs. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/Supplemental_Table_2.xlsx" target="_blank">Please click here to download this Table.</a>
Supplemental Table 3: Electrophoresis buffer recipes. A recipe for 0.5 M pH 8.0 Ethylenediaminetetraacetic acid solution (EDTA) and the TRIS-acetate-EDTA (TAE) buffer solution. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/63486/Supplemental_Table_3.xlsx" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes at JoVE.com

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

This protocol can be used to perform large-scale ecological surveys of selfing Caenorhabditis nematodes. The primary advantage of this method is the efficient organization and analysis of ecological and molecular data associated with the nematodes collected from nature.

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Caenorhabditis elegans is one of the major model organisms in biology, but only recently have researchers focused on its natural ecology. The relative ...

a-highly-scalable-approach-to-perform-ecological-surveys-selfing

Universidad San Sebastian

Research

JoVE Journal

Biology

2.5K Views.  Northwestern University. This protocol can be used to perform large-scale ecological surveys of selfing Caenorhabditis nematodes. The primary advantage of this method is the efficient organization and analysis of ecological and molecular data associated with the nematodes collected from nature.

Video: A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Automated Analysis of a Nematode Population-based Chemosensory Preference Assay

The nematode, Caenorhabditis elegans' compact nervous system of only 302 neurons underlies a diverse repertoire of behaviors. To facilitate the dissection of the neural circuits underlying these behaviors, the development of robust and reproducible behavioral assays is necessary. Previous C. elegans behavioral studies have used variations of a "drop test", a "chemotaxis assay", and a "retention assay" to investigate the response of C. elegans to soluble compounds. The method described in this article seeks to combine the complementary strengths of the three aforementioned assays. Briefly, a small circle in the middle of each assay plate is divided into four quadrants with the control and experimental solutions alternately placed. After the addition of the worms, the assay plates are loaded into a behavior chamber where microscope cameras record the worms' encounters with the treated regions. Automated video analysis is then performed and a preference index (PI) value for each video is generated. The video acquisition and automated analysis features of this method minimizes the experimenter's involvement and any associated errors. Furthermore, minute amounts of the experimental compound are used per assay and the behavior chamber's multi-camera setup increases experimental throughput. This method is particularly useful for conducting behavioral screens of genetic mutants and novel chemical compounds. However, this method is not appropriate for studying stimulus gradient navigation due to the close proximity of the control and experimental solution regions. It should also not be used when only a small population of worms is available. While suitable for assaying responses only to soluble compounds in its current form, this method can be easily modified to accommodate multimodal sensory interaction and optogenetic studies. This method can also be adapted to assay the chemosensory responses of other nematode species.

We present a behavior recording setup and protocol that enables automated analysis of the nematode, Caenorhabditis elegans' preference for soluble compounds in a population-based assay. This article describes the construction of a behavior chamber, the behavioral assay protocol, and video analysis software usage.

The nematode, Caenorhabditis elegans' compact nervous system of only 302 neurons underlies a diverse repertoire of behaviors. To facilitate the dissection ...

Behavior

Culture and Assay of Large-Scale Mixed-Stage Caenorhabditis elegans Populations

Caenorhabditis elegans (C. elegans) has been and remains a valuable model organism to study developmental biology, aging, neurobiology, and genetics. The large body of work on C. elegans makes it an ideal candidate to integrate into large-population, whole-animal studies to dissect the complex biological components and their relationships with another organism. In order to use C. elegans in collaborative -omics research, a method is needed to generate large populations of animals where a single sample can be split and assayed across diverse platforms for comparative analyses.
Here, a method to culture and collect an abundant mixed-stage C. elegans population on a large-scale culture plate (LSCP) and subsequent phenotypic data is presented. This pipeline yields sufficient numbers of animals to collect phenotypic and population data, along with any data needed for -omics experiments (i.e., genomics, transcriptomics, proteomics, and metabolomics). In addition, the LSCP method requires minimal manipulation to the animals themselves, less user preparation time, provides tight environmental control, and ensures that handling of each sample is consistent throughout the study for overall reproducibility. Lastly, methods to document population size and population distribution of C. elegans life stages in a given LSCP are presented.

Culture and Assay of Large-Scale Mixed-Stage Caenorhabditis elegans Populations

To use Caenorhabditis elegans (C. elegans) in omics research, a method is needed to generate large populations of worms where a single sample can be measured across platforms for comparative analyses. Here, a method to culture C. elegans populations on large-scale culture plates (LSCPs) and to document population growth is presented.

Caenorhabditis elegans (C. elegans) has been and remains a valuable model organism to study developmental biology, aging, neurobiology, and genetics. The ...

Genetics

Rapid Isolation of Wild Nematodes by Baermann Funnel

Beyond being robust experimental model organisms, Caenorhabditis elegans and its relatives are also real animals that live in nature. Studies of wild nematodes in their natural environments are valuable for understanding many aspects of biology, including the selective regimes in which distinctive genomic and phenotypic characters evolve, the genetic basis for complex trait variation, and the natural genetic diversity fundamental to all animal populations. This manuscript describes a simple and efficient method for extracting nematodes from their natural substrates, including rotting fruits, flowers, fungi, leaf litter, and soil. The Baermann funnel method, a classical nematology technique, selectively isolates active nematodes from their substrates. Because it recovers nearly all active worms from the sample, the Baermann funnel technique allows for the recovery of rare and slow-growing genotypes that co-occur with abundant and fast-growing genotypes, which might be missed in extraction methods that involve multiple generations of reproduction. The technique is also well suited to addressing metagenetic, population-genetic, and ecological questions. It captures the entire population in a sample simultaneously, allowing an unbiased view of the natural distribution of ages, sexes, and genotypes. The protocol allows for deployment at scale in the field, rapidly converting substrates into worm plates, and the authors have validated it through fieldwork on multiple continents.

This protocol outlines a method for efficiently extracting live nematodes from natural substrates in the field.

Beyond being robust experimental model organisms, Caenorhabditis elegans and its relatives are also real animals that live in nature. Studies of wild ...

Surveying Low-Cost Methods to Measure Lifespan and Healthspan in Caenorhabditis elegans

The discovery and development of Caenorhabditis elegans as a model organism was influential in biology, particularly in the field of aging. Many historical and contemporary studies have identified thousands of lifespan-altering paradigms, including genetic mutations, transgenic gene expression, and hormesis, a beneficial, low-grade exposure to stress. With its many advantages, including a short lifespan, easy and low-cost maintenance, and fully sequenced genome with homology to almost two-thirds of all human genes, C. elegans has quickly been adopted as an outstanding model for stress and aging biology. Here, several standardized methods are surveyed for measuring lifespan and healthspan that can be easily adapted into almost any research environment, especially those with limited equipment and funds. The incredible utility of C. elegans is featured, highlighting the capacity to perform powerful genetic analyses in aging biology without the necessity of extensive infrastructure. Finally, the limitations of each analysis and alternative approaches are discussed for consideration.

Surveying Low-Cost Methods to Measure Lifespan and Healthspan in Caenorhabditis elegans

Caenorhabditis elegans serve as an excellent model system with robust and low-cost methods for surveying healthspan, lifespan, and resilience to stress.

The discovery and development of Caenorhabditis elegans as a model organism was influential in biology, particularly in the field of aging. Many ...

Caenorhabditis Sieve: A Low-tech Instrument and Methodology for Sorting Small Multicellular Organisms

Caenorhabditis elegans (C. elegans) is a well-established model organism used across a range of basic and biomedical research. Within the nematode research community, there is a need for an affordable and effective way to maintain large, age-matched populations of C. elegans. Here, we present a methodology for mechanically sorting and cleaning C. elegans. Our aim is to provide a cost-effective, efficient, fast, and simple process to obtain animals of uniform sizes and life stages for their use in experiments. This tool, the Caenorhabditis Sieve, uses a custom-built lid system that threads onto common conical lab tubes and sorts C. elegans based on body size. We also demonstrate that the Caenorhabditis Sieve effectively transfers animals from one culture plate to another allowing for a rapid sorting, synchronizing, and cleaning without impacting markers of health, including motility and stress-inducible gene reporters. This accessible and innovative tool is a fast, efficient, and non-stressful option for maintaining C. elegans populations.

Caenorhabditis Sieve: A Low-tech Instrument and Methodology for Sorting Small Multicellular Organisms

The current protocol includes a methodology for the sorting and cleaning of age-matched populations of Caenorhabditis elegans. It uses a simple, inexpensive, and efficient custom-made tool to obtain a large experimental population of nematodes for research.

Caenorhabditis elegans (C. elegans) is a well-established model organism used across a range of basic and biomedical research. Within the nematode ...

Developmental Biology

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates movement. Additionally, gravity sensation, which occurs in the mammalian inner ear, is closely related to hearing - thus, understanding this process has implications for auditory and vestibular research. Gravitaxis assays exist for some model organisms, including Drosophila. Single worms have previously been assayed for their orientation preference as they settle in solution. However, a reliable and robust assay for Caenorhabditis gravitaxis has not been described. The present protocol outlines a procedure for performing gravitaxis assays that can be used to test hundreds of Caenorhabditis dauers at a time. This large-scale, long-distance assay allows for detailed data collection, revealing phenotypes that may be missed on a standard plate-based assay. Dauer movement along the vertical axis is compared with horizontal controls to ensure that directional bias is due to gravity. Gravitactic preference can then be compared between strains or experimental conditions. This method can determine molecular, cellular, and environmental requirements for gravitaxis in worms.

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

The present protocol outlines methods for conducting a large-scale gravitaxis assay with Caenorhabditis dauer larvae. This protocol allows for better detection of gravitaxis behavior compared with a plate-based assay.

Gravity sensation is an important and relatively understudied process. Sensing gravity enables animals to navigate their surroundings and facilitates ...

Automated Behavioral Analysis of Large C. elegans Populations Using a Wide Field-of-view Tracking Platform

Caenorhabditis elegans is a well-established animal model in biomedical research, widely employed in functional genomics and ageing studies. To assess the health and fitness of the animals under study, one typically relies on motility readouts, such as the measurement of the number of body bends or the speed of movement. These measurements usually involve manual counting, making it challenging to obtain good statistical significance, as time and labor constraints often limit the number of animals in each experiment to 25 or less. Since high statistical power is necessary to obtain reproducible results and limit false positive and negative results when weak phenotypic effects are investigated, efforts have recently been made to develop automated protocols focused on increasing the sensitivity of motility detection and multi-parametric behavioral profiling. In order to extend the limit of detection to the level needed to capture the small phenotypic changes that are often crucial in genetic studies and drug discovery, we describe here a technological development that enables the study of up to 5,000 individual animals simultaneously, increasing the statistical power of the measurements by about 1,000-fold compared to manual assays and about 100-fold compared to other available automated methods.

Automated Behavioral Analysis of Large C. elegans Populations Using a Wide Field-of-view Tracking Platform

We describe protocols for using the wide field-of-view nematode tracking platform (WF-NTP), which enables high-throughput phenotypic characterization of large populations of Caenorhabditis elegans. These protocols can be used to characterize subtle behavioral changes in mutant strains or in response to pharmacological treatment in a highly scalable fashion.

Caenorhabditis elegans is a well-established animal model in biomedical research, widely employed in functional genomics and ageing studies. To assess the ...

Immunology and Infection

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

Automating Aggregate Quantification in Caenorhabditis elegans

A rise in the prevalence of neurodegenerative protein conformational diseases (PCDs) has fostered a great interest in this subject over the years. This increased attention has called for the diversification and improvement of animal models capable of reproducing disease phenotypes observed in humans with PCDs. Though murine models have proven invaluable, they are expensive and are associated with laborious, low-throughput methods. Use of the Caenorhabditis elegans nematode model to study PCDs has been justified by its relative ease of maintenance, low cost, and rapid generation time, which allow for high-throughput applications. Additionally, high conservation between the C. elegans and human genomes makes this model an invaluable discovery tool. Nematodes that express fluorescently tagged tissue-specific polyglutamine (polyQ) tracts exhibit age- and polyQ length-dependent aggregation characterized by fluorescent foci. Such reporters are often employed as proxies to monitor changes in proteostasis across tissues. Manual aggregate quantification is time-consuming, limiting experimental throughput. Furthermore, manual foci quantification can introduce bias, as aggregate identification can be highly subjective. Herein, a protocol consisting of worm culturing, image acquisition, and data processing was standardized to support high-throughput aggregate quantification using C. elegans that express intestine-specific polyQ. By implementing a C. elegans-based image processing pipeline using CellProfiler, an image analysis software, this method has been optimized to separate and identify individual worms and enumerate their respective aggregates. Though the concept of automation is not entirely unique, the need to standardize such procedures for reproducibility, elimination of bias from manual counting, and increase throughput is high. It is anticipated that these methods can drastically simplify the screening process of large bacterial, genomic, or drug libraries using the C. elegans model.

Automating Aggregate Quantification in Caenorhabditis elegans

The following protocol describes the development and optimization of a high-throughput workflow for worm culturing, fluorescence imaging, and automated image processing to quantify polyglutamine aggregates as an assessment of changes in proteostasis.

A rise in the prevalence of neurodegenerative protein conformational diseases (PCDs) has fostered a great interest in this subject over the years. This ...

High-Throughput Screening of Microbial Isolates with Impact on Caenorhabditis elegans Health

With its small size, short lifespan, and easy genetics, Caenorhabditis elegans offers a convenient platform to study the impact of microbial isolates on host physiology. It also fluoresces in blue when dying, providing a convenient means of pinpointing death. This property has been exploited to develop high-throughput label-free C. elegans survival assays (LFASS). These involve time-lapse fluorescence recording of worm populations set in multiwell plates, from which population median time of death can be derived. The present study adopts the LFASS approach to screen multiple microbial isolates at once for the effects on C. elegans susceptibility to severe heat and oxidative stresses. Such microbial screening pipeline, which can notably be used to prescreen probiotics, using severe stress resistance as a proxy for host health is reported here. The protocol describes how to grow both C. elegans gut microbiota isolate collections and synchronous worm populations in multiwell arrays before combining them for the assays. The example provided covers the testing of 47 bacterial isolates and one control strain on two worm strains, in two stress assays in parallel. However, the approach pipeline is readily scalable and applicable to the screening of many other modalities. Thus, it provides a versatile setup to rapidly survey a multiparametric landscape of biological and biochemical conditions that impact C. elegans health.

High-Throughput Screening of Microbial Isolates with Impact on Caenorhabditis elegans Health

Gut microbes may positively or negatively impact the health of their host via specific or conserved mechanisms. Caenorhabditis elegans is a convenient platform to screen for such microbes. The present protocol describes high-throughput screening of 48 bacterial isolates for impact on nematode stress resistance, used as a proxy for worm health.

With its small size, short lifespan, and easy genetics, Caenorhabditis elegans offers a convenient platform to study the impact of microbial isolates on ...

A Highly Scalable Approach to Perform Ecological Surveys of Selfing Caenorhabditis Nematodes

Summary

Explore More Videos

Chapters in this video

Automated Analysis of a Nematode Population-based Chemosensory Preference Assay

Culture and Assay of Large-Scale Mixed-Stage Caenorhabditis elegans Populations

Rapid Isolation of Wild Nematodes by Baermann Funnel

Surveying Low-Cost Methods to Measure Lifespan and Healthspan in Caenorhabditis elegans

Caenorhabditis Sieve: A Low-tech Instrument and Methodology for Sorting Small Multicellular Organisms

Large-Scale Gravitaxis Assay of Caenorhabditis Dauer Larvae

Automated Behavioral Analysis of Large C. elegans Populations Using a Wide Field-of-view Tracking Platform

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Automating Aggregate Quantification in Caenorhabditis elegans

High-Throughput Screening of Microbial Isolates with Impact on Caenorhabditis elegans Health