Name: preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue
Uploaded: 2019-05-09T14:45:00.000+00:00
Duration: 7 min 9 s
Description: Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

The authors wish to acknowledge the students at Longwood University in BIOL 324 (Genetics) and the students in CHEM 403 (Advanced Chemical Laboratory Problem Solving) who were involved in the initial preparation and testing of the antimony and lead biosensors. The idea for MicRoboCop was conceived at the GCAT SynBIO workshop (summer 2014), which is funded by NSF and Howard Hughes Medical Institute and hosted by the University of Maryland Baltimore County. The authors also acknowledge funding received from Longwood University&#8217;s Cook-Cole College of Arts and Sciences and the GCAT SynBio Alumni Grant.

NOTE: Synthesis of E. coli expressing RFP is presented.
1. Preparation of plasmid DNA from E. coli
<ol>
	<li>Thaw E.coli containing a plasmid with an RFP gene and ampicillin resistance gene and grow the E.coli on Luria Broth (LB) agar plates containing 100 &#181;g/mL ampicillin at 37 &#176;C for 24 h. For example, use the J10060 plasmid from the registry of standard biological parts used for synthetic biology (see Table of Materials). The J10060 plasmid includes a gene for RFP (red fluorescent protein) under the control of a pBad promoter region and an ampicillin resistance gene. Alternatively, transform E.coli (refer to step 3.2) with the plasmid prior to growth on the LB agar plates.</li>
	<li>Follow a standard miniprep protocol (see Table of Materials) to isolate DNA from 1 mL of an E. coli culture that contains the J10060 plasmid. The purpose of the following protocol is to remove the pBad promoter and replace it with the desired promoter for the device.</li>
	<li>Following the plasmid miniprep, store DNA in the freezer until ready for digestion.</li>
</ol>
2. Restriction enzyme digestion
<ol>
	<li>Set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 &#956;L of J10060 plasmid DNA (isolated in step 1), 8 &#956;L of water, and 1 &#956;L each of EcoRI and NheI enzymes pre-mixed with 1 &#956;L of buffer (see Table of Materials).</li>
	<li>For the promoter DNA, set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 &#956;L of annealed promoter DNA sequences (8 &#956;L of water, and 1 &#956;L each of EcoRI and NheI enzymes pre-mixed with 1 &#956;L of buffer.
	<ol>
		<li>For Sb-, Pb-, or TNT-RFP (see Table of Materials), dissolve the oligonucleotides in buffer (30 mM HEPES, pH 7.5; 100 mM potassium acetate), incubate in equal molar concentrations, heat to 94 &#176;C for 2 min, and gradually cool at room temperature).</li>
	</ol>
	</li>
	<li>Mix the samples by pipetting gently up and down with the pipette set to 10 &#956;L.</li>
	<li>Incubate for 30 min at 37 &#176;C.</li>
	<li>Heat inactivate the enzymes at 80 &#176;C for 5 min.</li>
	<li>Store the digested DNA in the freezer until ready for the next step.</li>
</ol>
3. Ligation and transformation
<ol>
	<li>Ligation
	<ol>
		<li>Using the plasmid and promoter DNA that were double digested with EcoRI and NheI in step 2, set up the reaction mixture shown in Table 1 in a microcentrifuge tube on ice; add the T4 DNA Ligase last. 
		NOTE: Table 1 shows a ligation using a molar ratio of 1:3 vector to insert for the indicated DNA sizes.</li>
		<li>Gently mix the reaction by pipetting up and down and microcentrifuge briefly.</li>
		<li>Incubate at room temperature for 10 min.</li>
		<li>Heat inactivate at 65 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Transformation
	<ol>
		<li>Thaw a tube with 20 &#181;L of DH5-alpha Competent E. coli cells on ice until the last ice crystals disappear.</li>
		<li>Add 5 &#181;L of plasmid DNA to the cell mixture. Carefully flick the tube 4-5 times to mix the cells and DNA.</li>
		<li>Place the mixture on ice for 2 min.</li>
		<li>Heat shock at exactly 42 &#176;C for exactly 30 s. Do not mix.</li>
		<li>Place on ice for 2 min. Do not mix.</li>
		<li>Pipette 380 &#181;L of room temperature SOC into the mixture. Immediately spread onto an LB agar plate containing ampicillin (100 &#181;g/mL) and incubate overnight at 37 &#176;C.</li>
		<li>Check the plates within 24 h for growth.</li>
		<li>Seal the plates with sealing film and store in the refrigerator until ready for next step.</li>
	</ol>
	</li>
</ol>
4. Colony PCR
<ol>
	<li>Add to a PCR tube (set up 4 reaction tubes) the reaction mixtures shown in Table 2.</li>
	<li>Gently mix the reactions by pipetting up and down.</li>
	<li>Using a yellow pipette tip, scrape a colony (or very small region) of the transformed E. coli. Transfer a swipe of this E. coli onto a new LB/ampicillin/agar plate that has been sectioned off, and then insert the pipette tip into the PCR tube. Shake the pipette tip to mix the E. coli with the PCR mix. Repeat three more times for additional colonies. Transfer the PCR tubes to a PCR machine and begin thermocycling using the program shown in Table 3.</li>
	<li>Run gel electrophoresis using a 2% agarose gel in TAE to determine which colonies have the best ligation into the plasmid and grow those colonies on a new plate.</li>
	<li>Store the plates in the refrigerator until ready for testing. Prepare a liquid culture in Luria broth with 100 &#181;g/mL ampicillin added for chemical testing.</li>
</ol>
5. DNA Sequencing
<ol>
	<li>For each sample, add 5 &#181;L of plasmid, 4 &#181;L of the sequencing primer, and 3 &#181;L of deionized water.</li>
	<li>Place this mixture into a tube and send it for DNA sequencing (see Table of Materials).</li>
	<li>Analyze DNA sequence data to compare the expected and observed DNA sequences using DNA sequence analysis software to ensure that there is no mutation and that the genes were correctly inserted. 
	NOTE: Using E. coli as a chemical sensor is presented below.</li>
</ol>
6. Preparation of E. coli cultures
<ol>
	<li>Prepare LB with 100 &#181;g/mL ampicillin for liquid cultures.</li>
	<li>Prepare liquid cultures of the sensor bacteria, the positive control* bacteria and the negative control** bacteria. 
	NOTE: *Positive control bacteria: E. coli containing a plasmid with the RFP gene under control of a constitutive promoter; plasmid E1010 from the registry of standard biological parts used for synthetic biology (see Table of Materials) was used in this work. 
	**Negative control bacteria: E. coli containing a plasmid with the RFP gene under control of a different promoter, such as the pBad promoter (plasmid J10060 from the registry of standard biological parts used for synthetic biology (see Table of Materials)) or a plasmid that does not have the RFP gene.</li>
	<li>Place the cultures into a shaking incubator at 37 &#176;C and 220 rpm for a minimum of 8 h, maximum of 18 h. Cloudy broth indicates bacterial growth.</li>
</ol>
7. Titrating E. coli to check function of device
NOTE: Once the sensors have been titrated to check function, this step does not need to be repeated. A positive control in the form of addition of lead, antimony, and 2,4-DNT or 1,3-dinitrobenzene (1,3-DNB) can check the function of the devices for each use without the need for the full titration.
<ol>
	<li>Prepare a stock solution of the analyte(s) of interest at a concentration of 10 ppm in water. If solubility is an issue, use a 50/50 water/methanol mixture.</li>
	<li>Using Table 4 as a guide, label the appropriate number of sterile culture tubes and place 2 mL of the cultured broth (from protocol step 6) into each tube. 
	NOTE: In order to determine a general analytical range, do at least three different levels of an analyte with the sensor bacteria, one level with the negative control, and one level with the positive control. There should also be one tube of each of the bacteria that has no added metal (another type of negative control). To more accurately determine analytical range and limits of detection, use a larger range of analyte concentrations.</li>
	<li>Add analyte stock solution to the tubes containing 2 mL of broth as noted in Table 4, place the snap caps on the culture tube so that they are loose (to allow air flow into the tube), and vortex the culture tube.</li>
	<li>Leaving the snap caps loosely on the culture tubes, place into a shaking incubator at 220 rpm and 37 &#176;C for at least 24 h.</li>
	<li>Remove the tubes from the incubator, snap the caps onto the tubes tightly, and store the tubes in the refrigerator until ready for fluorescence analysis.</li>
</ol>
8. Using E. coli as chemical sensor for GSR
<ol>
	<li>Using an ethanol-based wipe designed for removing lead (see Table of Materials), wipe all surfaces of the hands, including between the fingers. Use a separate wipe for each hand. Store the wipes in an appropriately labelled sealable baggie until analysis.</li>
	<li>For surfaces to be tested: use an alcohol-based wipe for large surfaces or a cotton swab moistened with ethanol for small surfaces. 
	NOTE: To demonstrate the sensors&#8217; response to GSR, the inside of a spent .40 caliber cartridge casing was swabbed with an ethanol moistened cotton swab.</li>
	<li>Wearing clean gloves and using scissors that have been cleaned with alcohol, cut an approximately 1 cm2 section out of the center of the wipe.</li>
	<li>Place the cut piece of the hand wipe or the cotton swab directly into a culture tube that contains 2 mL of the sensor bacteria, ensuring that it is submerged in the broth.</li>
	<li>Proceed as described above in steps 7.4 &#8211; 7.5.</li>
</ol>
9. Fluorescence analysis using portable spectrometer (see Table of Materials)
<ol>
	<li>Use a vortex mixer to shake the tubes.</li>
	<li>Prepare the spectrometer to collect fluorescence emission at the appropriate wavelength for your RFP variant with an excitation wavelength of 500 nm.</li>
	<li>Use the Luria broth to record a blank spectrum.</li>
	<li>Carefully transfer each supernatant to a low volume cuvette and collect the emission intensity.</li>
</ol>
10. Fluorescence analysis using 96-well plate reader (see Table of Materials)
<ol>
	<li>Use a vortex mixer to shake the tubes.</li>
	<li>Transfer 200 mL of the broth to a well in the well plate. Record which samples went into each well of the plate.</li>
	<li>Set up the fluorimeter to collect the emission intensity at the appropriate wavelength for the RFP variant.</li>
</ol>
11. Data analysis
<ol>
	<li>Using the signal obtained from all negative controls (RFP negative bacteria or sensor bacteria with no analyte added), calculate an average fluorescence signal for the background.</li>
	<li>Subtract the average background signal from each fluorescence signal obtained for the sensor bacteria to get a background corrected fluorescence intensity.</li>
	<li>Estimate the signal-to-noise (S/N) ratio by dividing the background corrected fluorescence intensity by the average background signal. If the S/N ratio is greater than 3, the test is positive.</li>
</ol>

<ol>
	<li>Eschner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;The+Story+of+the+Real+Canary+in+the+Coal+Mine.&#34;.">&#34;The Story of the Real Canary in the Coal Mine.&#34;.</a> The Smithsonian Magazine. , (2016).</li><li>Roda, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+chemical+luminescence-based+biosensors:+A+critical+review.">Progress in chemical luminescence-based biosensors: A critical review.</a> Biosensors &#38; Bioelectronics. 76, 164-179 (2016).</li><li>He, W., Yuan, S., Zhong, W. H., Siddikee, M. A., Dai, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+genetically+engineered+microbial+whole-cell+biosensors+for+combined+chemosensing.">Application of genetically engineered microbial whole-cell biosensors for combined chemosensing.</a> Applied Microbiology and Biotechnology. 100 (3), 1109-1119 (2016).</li><li>Dalby, O., Butler, D., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Gunshot+Residue+and+Associated+Materials-A+Review.">Analysis of Gunshot Residue and Associated Materials-A Review.</a> Journal of Forensic Sciences. 55 (4), 924-943 (2010).</li><li>Bell, S., Seitzinger, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+binary+presumptive+assays+to+probabilistic+assessments:+Differentiation+of+shooters+from+non-shooters+using+IMS,+OGSR,+neural+networks,+and+likelihood+ratios.">From binary presumptive assays to probabilistic assessments: Differentiation of shooters from non-shooters using IMS, OGSR, neural networks, and likelihood ratios.</a> Forensic Science International. 263, 176-185 (2016).</li><li>O&#39;Mahony, A. M., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+Detection+of+Gunshot+Residue+for+Forensic+Analysis:+A+Review.">Electrochemical Detection of Gunshot Residue for Forensic Analysis: A Review.</a> Electroanalysis. 25 (6), 1341-1358 (2013).</li><li>Vigneshvar, S., Sudhakumari, C. C., Senthilkumaran, B., Prakash, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+Advances+in+Biosensor+Technology+for+Potential+Applications+-+An+Overview.">Recent Advances in Biosensor Technology for Potential Applications - An Overview.</a> Frontiers in Bioengineering and Biotechnology. 4, 9 (2016).</li><li>Fernandez, M., Morel, B., Ramos, J. L., Krell, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paralogous+Regulators+ArsR1+and+ArsR2+of+Pseudomonas+putida+KT2440+as+a+Basis+for+Arsenic+Biosensor+Development.">Paralogous Regulators ArsR1 and ArsR2 of Pseudomonas putida KT2440 as a Basis for Arsenic Biosensor Development.</a> Applied and Environmental Microbiology. 82 (14), 4133-4144 (2016).</li><li>Porter, S. E. G., Barber, A. E., Colella, O. K., Roach, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Biological+Organisms+as+Chemical+Sensors:+The+MicRoboCop+Project.">Using Biological Organisms as Chemical Sensors: The MicRoboCop Project.</a> Journal of Chemical Education. 95 (8), 1392-1397 (2018).</li><li>Borremans, B., Hobman, J. L., Provoost, A., Brown, N. L., Van der Lelie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+analysis+of+the+pbr+lead+resistance+determinant+of+Ralstonia+metallidurans+CH34.">Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34.</a> Journal of Bacteriology. 183 (19), 5651-5658 (2001).</li><li>Hobman, J. L., Julian, D. J., Brown, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cysteine+coordination+of+Pb(II)+is+involved+in+the+PbrR-dependent+activation+of+the+lead-resistance+promoter,+PpbrA,+from+Cupriavidus+metallidurans+CH34.">Cysteine coordination of Pb(II) is involved in the PbrR-dependent activation of the lead-resistance promoter, PpbrA, from Cupriavidus metallidurans CH34.</a> Bmc Microbiology. 12, (2012).</li><li>Yagur-Kroll, S., Amiel, E., Rosen, R., Belkin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene+by+an+Escherichia+coli+bioreporter:+performance+enhancement+by+directed+evolution.">Detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene by an Escherichia coli bioreporter: performance enhancement by directed evolution.</a> Applied Microbiology and Biotechnology. 99 (17), 7177-7188 (2015).</li><li>Gorman, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;Guns+in+America:+The+Debate+Over+Lead+Based+Bullets.&#34;.">&#34;Guns in America: The Debate Over Lead Based Bullets.&#34;.</a> Newsweek. , (2017).</li><li>Yuksel, B., Ozler-Yigiter, A., Bora, T., Sen, N., Kayaalti, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFAAS+Determination+of+Antimony,+Barium,+and+Lead+Levels+in+Gunshot+Residue+Swabs:+An+Application+in+Forensic+Chemistry.">GFAAS Determination of Antimony, Barium, and Lead Levels in Gunshot Residue Swabs: An Application in Forensic Chemistry.</a> Atomic Spectroscopy. 37 (4), 164-169 (2016).</li><li>Blakey, L. S., Sharples, G. P., Chana, K., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fate+and+Behavior+of+Gunshot+Residue-A+Review.">Fate and Behavior of Gunshot Residue-A Review.</a> Journal of Forensic Sciences. 63 (1), 9-19 (2018).</li><li>Yagur-Kroll, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+bioreporters+for+the+detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene.">Escherichia coli bioreporters for the detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene.</a> Applied Microbiology and Biotechnology. 98 (2), 885-895 (2014).</li></ol>

The authors have no competing financial interests or other conflicts of interest to disclose.

Modifications and troubleshooting
The experiment described in Table 4 can be modified in any way appropriate to the sensors that have been designed. The most important aspect of a chemical sensor is to evaluate its sensitivity and specificity. It is beneficial to ensure that a wide range of concentrations of the analyte is analyzed to determine the useful analytical range of the sensor. It is also worth determining a maximum level of analyte for the cells. Bec...

A biosensor is any analytical device that uses biological components (such as proteins, nucleic acids, or whole organisms) that produce a response that can be used for the detection of a chemical substance or analyte. As an example, the coal mining industry used a biosensor for much of the 20th century to detect the presence of toxic mine gases: the canary in the coal mine1. The biological organism&#39;s (canary&#39;s) response (death or distress) to a chemical analyte (carbon monoxide) was observed by the miners in order to protect the workers. In a more modern and sophisticated example, bacteria can be altered using synthetic biology techniques to respond to the presence of a certain chemical analyte by exhibiting a specific response, such as the expression of a fluorescent protein.
Synthetic biology is a broad term that refers to the construction of biological devices and systems that do not exist naturally, or the re-design of existing biological systems for a specific purpose2. Synthetic biology is distinguished from genetic engineering by a standard methodology and the existence of standardized parts (standard synthetic biology genetic elements) that can be used to synthesize devices and systems. A part is introduced into the genome of a device, an organism such as a bacterium, to express a certain trait that will serve as an indication of function. For example, in many synthetic devices, the expression of a fluorescent protein is introduced into a single celled organism as a reporter protein. Multiple devices can be combined into a system. The genomes of microorganisms such as bacteria are easy to manipulate in this manner. Numerous examples of biosensors specific to a wide range of chemical analytes have been reported in the literature over the last decade3,4.
In this work, the MicRoboCop system is presented as an example of a biosensor designed using synthetic biology techniques with novel applications in forensic and environmental chemistry. MicRoboCop is a system of three separate devices that, when combined, will allow Escherichia coli to express red fluorescent protein (RFP) in the presence of gunshot residue (GSR) that has been collected from a person&#8217;s hands or a surface. Each of the three devices responds to a specific chemical analyte that is known to be a component of GSR5. The three analytes to which the system responds are I. 2,4,6-trinitrotoluene (TNT) and related compounds, II. lead (in the form of lead ions), and III. antimony (also in the form of ions).
GSR consists of many different chemical substances, but the three usually used to identify a residue as GSR are barium, lead, and antimony5. The standard evidentiary test for the identification of GSR is to use scanning electron microscopy (SEM) with energy dispersive X-ray fluorescence (EDX)5. SEM-EDX allows analysts to identify the unique morphology and the elemental components of GSR. Presently, there are few widely used binary presumptive tests available. One recently published presumptive test uses ion-mobility spectroscopy (IMS), which is specialized equipment that might not be available in many labs6. There are also a few color &#8220;spot&#8221; tests that can be used, though they are typically used for distance determination or for GSR identification on bullet holes and wounds5. Additionally, there has been some limited attention in the literature to electrochemical tests for GSR that employ voltammetric analysis, which has the advantage of potentially being field portable, or anodic stripping voltammetry, which is an extremely sensitive method for metallic elements7. There is very little mention in the literature of biosensors designed specifically for the purpose of detecting GSR, though some biosensors for other forensic applications have been published8.
The biological elements for each device in the MicRoboCop system, and the plasmid construction, are illustrated in Figure 1. The curved arrow in Figure 1b represents the promoter region that is activated in the presence of the analyte, the oval is the ribosomal binding site that allows translation of the reporter protein, the gray box labeled RFP is the gene that expresses red fluorescent protein, and the red octagon is the transcription termination site. All three devices will be used together as a system to detect GSR. Each device with a specific promoter (SbRFP, PbRFP, and TNT-RFP) will be incubated with the sample that is being tested and fluorescence of RFP will be measured. RFP will only be expressed if the appropriate chemical analyte is present and activates the promoter region. Three devices that respond to some of the chemical substances present in GSR have been designed and are presented in this work.
The promoters used in the three MicRoboCop devices are an arsenic and antimony sensitive promoter, SbRFP9,10, a lead sensitive promoter, PbRFP11,12 and a TNT sensitive promoter, TNT-RFP13. Because a search in the literature revealed no promoter designed to respond to barium, the TNT promoter was selected instead since this promoter is sensitive to a number of structurally related compounds (in particular, 2,4-dinitrotoluene and dinitrobenzene) that are known to be a part of the organic compounds left behind in GSR. This promoter has successfully been used to specifically detect minute quantities of TNT and 2,4-dinitrotoluene (2,4-DNT) in buried land mines13. Using the three devices together as a system, a positive test for GSR will produce fluorescence in all three devices. A fluorescence signal in only one or two devices will indicate another environmental source of the analyte(s) or in the case of the TNT promoter, activation by a compound that is not an organic compound left behind in GSR. By using all three devices together, the possibility of a false positive results due to environmental sources is minimized. Lead-free ammunition, which is gaining in popularity, still represents only about 5% of ammunition sales in the United States; hence, false negative results due to the absence of lead may be a possibility but there is still utility in a sensor that uses lead as a marker for GSR14. In addition to this specific forensic application, each device can be used separately for purposes of detecting environmental contaminants.
The protocols presented include the synthetic biology techniques used to create the devices (sensor bacteria) and the analytical techniques to check the function of the devices and analyze the fluorescence signals obtained. The protocol also includes collection of forensic evidence in the form of hand wiping to collect GSR from the hands of a suspect or swabbing to collect GSR from a surface. Results from the lead sensor device are presented as example results, along with a demonstration of a positive test for GSR using a spent cartridge casing.

<table><tbody><tr><td>1,3-dinitrobenzene, 97%</td><td>Aldrich</td><td>D194255-25G</td><td></td></tr><tr><td>2,4-dinitrotoluene, 97%</td><td>Aldrich</td><td>101397-5G</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP1423-500</td><td></td></tr><tr><td>Ampicillin</td><td>Fisher Scientific</td><td>BP1760-5</td><td></td></tr><tr><td>Antimony, Reference Standard Solution (1000ppm &amp;plusmn;1%/Certified)</td><td>Fisher Scientific</td><td>SA450-100</td><td>Standard in dilute HNO3</td></tr><tr><td>Cut Smart Buffer</td><td>New England BioLabs</td><td>B7204S</td><td></td></tr><tr><td>Duplex Buffer</td><td>Integrated DNA Technologies</td><td>11-01-03-00</td><td></td></tr><tr><td>EcoRI-HF Restriction Enzyme</td><td>New England BioLabs</td><td>R3101S</td><td></td></tr><tr><td>Ethanol, HPLC grade, denatured</td><td>Acros Organics</td><td>AC611050040</td><td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td></tr><tr><td>Eurofins Genomics SimpleSeq DNA Sequencing Kits</td><td>Eurofins Genomics</td><td>SimpleSeq Kit Standard</td><td></td></tr><tr><td>Forward primer for colony PCR</td><td>Integrated DNA Technologies</td><td></td><td>5&amp;rsquo;- GCCGCTTGAATTCGTCATATAT-3&amp;rsquo;</td></tr><tr><td>Forward primer for DNA sequencing</td><td>Integrated DNA Technologies</td><td></td><td>5&amp;rsquo;- GTAAAACGACGGCCAGTG-3&amp;rsquo;</td></tr><tr><td>IBI Science High Speed Plasmid Mini-kit</td><td>IBI Scientific</td><td>IB47101</td><td></td></tr><tr><td>LB Broth, Miller</td><td>Fisher Scientific</td><td>BP1426-500</td><td></td></tr><tr><td>Lead, Reference Standard Solution (1000ppm &amp;plusmn;1%/Certified)</td><td>Fisher Scientific</td><td>SL21-100</td><td>Standard in dilute HNO3</td></tr><tr><td>LeadOff Disposable Cleaning and Decon Wipes</td><td>Hygenall</td><td>45NRCN</td><td>Sold in canisters or individually wrapped, any alcohol based wipe will work.</td></tr><tr><td>Methanol, HPLC grade</td><td>Fisher Scientific</td><td>A452-4</td><td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td></tr><tr><td>NEB 5-alpha Competent &lt;em&gt;E. coli&lt;/em&gt; cells</td><td>New England BioLabs</td><td>C2987I</td><td></td></tr><tr><td>NheI-HF Restriction Enzyme</td><td>New England BioLabs</td><td>R3131S</td><td></td></tr><tr><td>Nuclease free water</td><td>New England BioLabs</td><td>B1500S</td><td></td></tr><tr><td>One&lt;em&gt;Taq&lt;/em&gt; 2X Master Mix with Standard Buffer</td><td>New England BioLabs</td><td>M0482S</td><td></td></tr><tr><td>Plasmids from the registry of standard biological parts used for synthetic biology</td><td>Registry of Standard Biological Parts</td><td></td><td>http://parts.igem.org/Main_Page</td></tr><tr><td>Promoter Sequences</td><td>Integrated DNA Technologies</td><td></td><td>Sb promoter: 5&amp;rsquo;-GCATGAATTCA&lt;br /&gt;
GTCATATATGTTTTTGACTTATCC&lt;br /&gt;
GCTTCGAAGAGAGAGACACTACCT&lt;br /&gt;
GCAACAATCGCTAGCGCAT-3&amp;rsquo;&lt;br /&gt;
3&amp;rsquo;-CGTACTTAAGCTCACTATA&lt;br /&gt;
TACAAAAACTGAATAGGCGAAGC&lt;br /&gt;
TTCTCTCTCTGTGATGGACGTTG&lt;br /&gt;
TTAGCGATCGCGTA-5&amp;rsquo;
&lt;br /&gt;
Pb promoter: 5&amp;rsquo;-GCATGAATTCG&lt;br /&gt;
TCTTGACTCTATAGTAACTAAGGG&lt;br /&gt;
&lt;br /&gt;TGTATAATCGGCAACGCG&lt;br /&gt;
AGCTAGCGCAT-3&amp;rsquo;&lt;br /&gt;
3&amp;rsquo;-CGTACTTAAGCAGAA&lt;br /&gt;
CTGAGATATCATTGATCTCCCACA&lt;br /&gt;
TCTTAGCCGTTGCGCTGCGATCGC&lt;br /&gt;
GTA-5&amp;rsquo;
&lt;br /&gt;
TNT promoter: 5&amp;rsquo;GCATTCTAGAT&lt;br /&gt;
CAATTTATTTGAACAAGGCGGTCA&lt;br /&gt;
ATTCTCTTCGATTTTATCTCTCGT&lt;br /&gt;
AAAAAAACGTGATACTCATCACAT&lt;br /&gt;
CGACGAAACAACGTCACTTATACA&lt;br /&gt;
AAAATCACCTGCGAGAGATTAATT&lt;br /&gt;
GAATTCGCAT3&amp;rsquo;&lt;br /&gt;
3&amp;rsquo;CGTAAGATCTAGTTAA&lt;br /&gt;
ATAAACTTGTTCCGCCAGTTAAGA&lt;br /&gt;
GAAGCTAAAATAGAGAGCATTTTT&lt;br /&gt;
TTGCACTATGAGTAGTGTAGCTGC&lt;br /&gt;
TTTGTTGCAGTGAATATGTTTTTA&lt;br /&gt;
GTGGACGCTCTCTAATTAACTTAA&lt;br /&gt;
GCGTA5&amp;rsquo;</td></tr><tr><td>Reverse primer for colony PCR</td><td>Integrated DNA Technologies</td><td></td><td>5&amp;rsquo;- GCCGCTTGAATTCGTCTAGACT- 3&amp;rsquo;</td></tr><tr><td>Reverse primer for DNA sequencing</td><td>Integrated DNA Technologies</td><td></td><td>5&amp;rsquo;- GGAAACAGCTATGACCATG-3&amp;rsquo;</td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr></tbody></table>

preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, when used together, can indicate the presence of gunshot residue (GSR) by producing a fluorescence signal in the presence of three key analytes (antimony, lead, and organic components of GSR). The protocol describes the synthesis of the biosensors using Escherichia coli (E. coli), and the analytical chemistry methods used to evaluate the selectivity and sensitivity of the sensors. The functioning of the system is demonstrated by using GSR collected from the inside of a spent cartridge casing. Once prepared, the biosensors can be stored until needed and can be used as a test for these key analytes. A positive response from all three analytes provides a presumptive positive test for GSR, while each individual device has applications for detecting the analytes in other samples (e.g., a detector for lead contamination in drinking water). The main limitation of the system is the time required for a positive signal; future work may involve studying different organisms to optimize the response time.

Fluorescence spectra for the RFP variant used in this work are shown in Figure 2. These data are from the PbRFP device as it responds to lead and the TNT-RFP device as it responds to two analytes, 2,4-DNT and 1,3-DNB. This figure shows the spectrum of a negative control (no analyte added), and the spectra at two different levels of analyte added. The maximum fluorescence signal for the RFP variant used was observed at 575 nm (excitation wavelength 500 nm). The data in <st...

Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, ...

preparation-application-new-bacterial-biosensor-for-presumptive

Universidad San Sebastian

Research

JoVE Journal

Chemistry

8.0K Views.  Longwood University. A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.

Video: Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Bioengineering

One-day Workflow Scheme for Bacterial Pathogen Detection and Antimicrobial Resistance Testing from Blood Cultures

Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock1. Therefore, rapid administration of adequate antibiotic therapy is of foremost importance in the treatment of bloodstream infections. The critical element in this process is timing, heavily dependent on the results of bacterial identification and antibiotic susceptibility testing. Both of these parameters are routinely obtained by culture-based testing, which is time-consuming and takes on average 24-48 hours2, 4. The aim of the study was to develop DNA-based assays for rapid identification of bloodstream infections, as well as rapid antimicrobial susceptibility testing. The first assay is a eubacterial 16S rDNA-based real-time PCR assay complemented with species- or genus-specific probes5. Using these probes, Gram-negative bacteria including Pseudomonas spp., Pseudomonas aeruginosa and Escherichia coli as well as Gram-positive bacteria including Staphylococcus spp., Staphylococcus aureus, Enterococcus spp., Streptococcus spp., and Streptococcus pneumoniae could be distinguished. Using this multiprobe assay, a first identification of the causative micro-organism was given after 2 h.
Secondly, we developed a semi-molecular assay for antibiotic susceptibility testing of S. aureus, Enterococcus spp. and (facultative) aerobe Gram-negative rods6. This assay was based on a study in which PCR was used to measure the growth of bacteria7. Bacteria harvested directly from blood cultures are incubated for 6 h with a selection of antibiotics, and following a Sybr Green-based real-time PCR assay determines inhibition of growth. The combination of these two methods could direct the choice of a suitable antibiotic therapy on the same day (Figure 1). In conclusion, molecular analysis of both identification and antibiotic susceptibility offers a faster alternative for pathogen detection and could improve the diagnosis of bloodstream infections.

The design of a straightforward one-day workflow scheme for bacterial pathogen diagnostics enables the rapid recognition of bloodstream infections. The inclusion of eight clinically relevant bacterial targets and their antibiotic resistance profiles offers the clinician an initial insight on the same day, which can lead to more adequate therapy.

Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock1. ...

Immunology and Infection

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) antibody conjugated latex beads have been utilized to create a biosensor designed for discrimination of methicillin resistant (MRSA) and sensitive (MSSA) S. aureus species 1,2. The lytic phages have been converted into phage spheroids by contact with water-chloroform interface. Phage spheroid monolayers have been moved onto a biosensor surface by Langmuir-Blodgett (LB) technique 3. The created biosensors have been examined by a quartz crystal microbalance with dissipation tracking (QCM-D) to evaluate bacteria-phage interactions. Bacteria-spheroid interactions led to reduced resonance frequency and a rise in dissipation energy for both MRSA and MSSA strains. After the bacterial binding, these sensors have been further exposed to the penicillin-binding protein antibody latex beads. Sensors analyzed with MRSA responded to PBP 2a antibody beads; although sensors inspected with MSSA gave no response. This experimental distinction determines an unambiguous discrimination between methicillin resistant and sensitive S. aureus strains. Equally bound and unbound bacteriophages suppress bacterial growth on surfaces and in water suspensions. Once lytic phages are changed into spheroids, they retain their strong lytic activity and show high bacterial capture capability. The phage and phage spheroids can be utilized for testing and sterilization of antibiotic resistant microorganisms. Other applications may include use in bacteriophage therapy and antimicrobial surfaces.

Lytic phage biosensors and antibody beads are able to discriminate between methicillin resistant (MRSA) and sensitive staphylococcus bacteria. The phages were immobilized by a Langmuir-Blodgett method onto a surface of a quartz crystal microbalance sensor and worked as broad range staphylococcus probes. Antibody beads recognize MRSA.

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a model microorganism. The biosensor relies on direct binding of the target bacteria cells onto its surface, while no pretreatment (e.g.&#160;by cell lysis) of the studied sample is required. A mesoporous Si thin film is used as the optical transducer element of the biosensor. Under white light illumination, the porous layer displays well-resolved Fabry-P&#233;rot fringe patterns in its reflectivity spectrum. Applying a fast Fourier transform (FFT) to reflectivity data results in a single peak. Changes in the intensity of the FFT peak are monitored. Thus, target bacteria capture onto the biosensor surface, through antibody-antigen interactions, induces measurable changes in the intensity of the FFT peaks, allowing for a &#39;real time&#39; observation of bacteria attachment.
The mesoporous Si film, fabricated by an electrochemical anodization process, is conjugated with monoclonal antibodies, specific to the target bacteria. The immobilization, immunoactivity and specificity of the antibodies are confirmed by fluorescent labeling experiments. Once the biosensor is exposed to the target bacteria, the cells are directly captured onto the antibody-modified porous Si surface. These specific capturing events result in intensity changes in the thin-film optical interference spectrum of the biosensor. We demonstrate that these biosensors can detect relatively low bacteria concentrations (detection limit of 104 cells/ml) in less than an hour.

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

A label-free optical biosensor for rapid bacteria detection is introduced. The biosensor is based on a nanostructured porous Si, which is designed to directly capture the target bacteria cells onto its surface. We use monoclonal antibodies, immobilized onto the porous transducer, as the capture probes. Our studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations within minutes with no prior sample processing (such as cell lysis).

A label-free optical biosensor based on a nanostructured porous Si is designed for rapid capture and detection of Escherichia coli K12 bacteria, as a ...

The Use of a &#946;-lactamase-based Conductimetric Biosensor Assay to Detect Biomolecular Interactions

Biosensors are becoming increasingly important and implemented in various fields such as pathogen detection, molecular diagnosis, environmental monitoring, and food safety control. In this context, we used &#946;-lactamases as efficient reporter enzymes in several protein-protein interaction studies. Furthermore, their ability to accept insertions of peptides or structured proteins/domains strongly encourages the use of these enzymes to generate chimeric proteins. In a recent study, we inserted a single-domain antibody fragment into the Bacillus licheniformis BlaP &#946;-lactamase. These small domains, also called nanobodies, are defined as the antigen-binding domains of single chain antibodies from camelids. Like common double chain antibodies, they show high affinities and specificities for their targets. The resulting chimeric protein exhibited a high affinity against its target while retaining the &#946;-lactamase activity. This suggests that the nanobody and &#946;-lactamase moieties remain functional. In the present work, we report a detailed protocol that combines our hybrid &#946;-lactamase system to the biosensor technology. The specific binding of the nanobody to its target can be detected thanks to a conductimetric measurement of the protons released by the catalytic activity of the enzyme.

In this work, we report a new method to study protein-protein interactions using a conductimetric biosensor based on the hybrid &#946;-lactamase technology. This method relies on release of protons upon hydrolysis of &#946;-lactams.

Biosensors are becoming increasingly important and implemented in various fields such as pathogen detection, molecular diagnosis, environmental ...

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

Ultrasensitive Detection of Biomarkers by Using a Molecular Imprinting Based Capacitive Biosensor

The ability to detect and quantitate biomolecules in complex solutions has always been highly sought-after within natural science; being used for the detection of biomarkers, contaminants, and other molecules of interest. A commonly used technique for this purpose is the Enzyme-linked Immunosorbent Assay (ELISA), where often one antibody is directed towards a specific target molecule, and a second labeled antibody is used for the detection of the primary antibody, allowing for the absolute quantification of the biomolecule under study. However, the usage of antibodies as recognition elements limits the robustness of the method; as does the need of using labeled molecules. To overcome these limitations, molecular imprinting has been implemented, creating artificial recognition sites complementary to the template molecule, and obsoleting the necessity of using antibodies for initial binding. Further, for even higher sensitivity, the secondary labeled antibody can be replaced by biosensors relying on the capacitance for the quantification of the target molecule. In this protocol, we describe a method to rapidly and label-free detect and quantitate low-abundant biomolecules (proteins and viruses) in complex samples, with a sensitivity that is significantly better than commonly used detection systems such as the ELISA. This is all mediated by molecular imprinting in combination with a capacitance biosensor.

Here, we present a protocol for the detection and quantification of low abundant molecules in complex solutions using molecular imprinting in combination with a capacitance biosensor.

The ability to detect and quantitate biomolecules in complex solutions has always been highly sought-after within natural science; being used for the ...

Rapid and Specific Detection of Acinetobacter baumannii Infections Using a Recombinase Polymerase Amplification/Cas12a-based System

Acinetobacter baumannii, a gram-negative bacterium, is notorious for causing severe infections with high mortality rates. Rapid and accurate detection of A. baumannii is crucial for prompt treatment, effective infection control, and curbing antibiotic resistance. However, there is no suitable method for rapid and easy on-site detection of A. baumannii. The DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR) system offers a rapid, precise, and sensitive approach to A. baumannii detection by integrating the target-specific recognition capabilities of Cas12a with the isothermal amplification efficiency of Recombinase Polymerase Amplification (RPA). This protocol details the detection of A. baumannii using RPA combined with LbaCas12a endonuclease. The following steps are described in this article: extraction of DNA, selection of a specific DNA sequence, design of primer and CRISPR RNA (crRNA), construction of positive recombinant plasmid, setup of Cas12a-RPA assay, optimization of the RPA amplification system, visualization of the RPA-CRISPR/Cas12a assay using a fluorescence detection tool such as a real-time PCR instrument, and evaluation of sensitivity and specificity evaluation.

To facilitate the rapid and precise detection of Acinetobacter baumannii, we present a protocol that employs Recombinase Polymerase Amplification (RPA) in conjunction with LbaCas12a endonuclease for identifying A. baumannii infections.

Acinetobacter baumannii, a gram-negative bacterium, is notorious for causing severe infections with high mortality rates. Rapid and accurate detection of ...

Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

Summary

Explore More Videos

Chapters in this video

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

One-day Workflow Scheme for Bacterial Pathogen Detection and Antimicrobial Resistance Testing from Blood Cultures

Bacterial Detection & Identification Using Electrochemical Sensors

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

Detection of Bacteria Using Fluorogenic DNAzymes

Optical Detection of E. coli Bacteria by Mesoporous Silicon Biosensors

The Use of a β-lactamase-based Conductimetric Biosensor Assay to Detect Biomolecular Interactions

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Ultrasensitive Detection of Biomarkers by Using a Molecular Imprinting Based Capacitive Biosensor

Rapid and Specific Detection of Acinetobacter baumannii Infections Using a Recombinase Polymerase Amplification/Cas12a-based System