We thank members of the Zubiaga and the Altmeyer laboratories for helpful discussions and for technical support. This work was supported by grants from the Spanish Ministry (SAF2015-67562-R, MINECO/FEDER, UE), the Basque Government (IT634-13 and KK-2015/89), and the University of the Basque Country UPV/EHU (UFI11/20).

1. Cellular Synchronization, Release and Monitoring of Cell Cycle Progression
<ol>
	<li>Thymidine- and nocodazole-based (Thy-Noc) synchronization and release of U2OS cells from Mitosis
	<ol>
		<li>Prepare required cell culture medium. U2OS cells are routinely grown in DMEM-Glutamine medium complemented with 10% (vol/vol) FBS (optional: 1% penicillin/streptomycin). Perform all the medium preparation and manipulation under sterile conditions and warm up complemented medium (from now on referred to as &#34;complete medium&#34;) to 37 &#176;C prior to use.</li>
		<li>Seed 2 x 106 U2OS cells per 100 mm dish in 10 mL complete culture medium. In order to calculate the number of dishes needed, take into account that each 100 mm dish typically provides enough mitotic cells to re-plate approximately 5 wells of a 6-well plate (0.2 - 0.25 x 106 cells/well) (see Figure 1B). Two wells per selected time point are required in the experiment (1 well for RNA extraction and 1 well for cell cycle monitoring). Additionally, a third well may be collected per time point for protein analysis. 
		&#8203;NOTE: Plate cells in the evening (around 7 pm) so that subsequent steps can be carried out during working hours the following days. Include 2 additional wells of asynchronously growing cells to define FACS analysis compensation settings.</li>
		<li>Let cells attach by incubating 100 mm dishes at 37 &#176;C in a humidified atmosphere with 5% CO2 for 24 h.</li>
		<li>For the thymidine block, prepare a 200 mM thymidine stock solution by dissolving 145.2 mg thymidine powder in 3 mL H2O (or equivalent amounts) and sterilize the solution by filtration through a 0.2 &#181;m pore size filter. Slight warming might help dissolve thymidine. Add 100 &#956;L of the freshly prepared 200 mM stock to each 100 mm culture dish (final concentration 2 mM). Incubate cells with thymidine for 20 h at 37 &#176;C in a humidified atmosphere with 5% CO2. 
		&#8203;NOTE: Treat cells in the evening (around 7 pm), to have time to perform both thymidine release and nocodazole block the following day.</li>
		<li>To release from the thymidine block, remove thymidine containing growth medium in the afternoon of the following day (3 pm); wash cells twice with pre-warmed 1x PBS and add 10 mL of complete medium to each 100 mm dish. Incubate cells for 5 h at 37 &#176;C in a humidified atmosphere with 5% CO2.</li>
		<li>For mitotic cell arrest, add nocodazole to a final concentration of 50 ng/mL (8 pm). Prepare a stock solution by dissolving nocodazole powder in DMSO (e.g. 5 mg/mL) and store frozen at -20 &#176;C. Incubate cells with nocodazole for no longer than 10 - 11 h at 37 &#176;C in a humidified atmosphere with 5% CO2.</li>
		<li>Release from nocodazole-mediated arrest in early M phase (mitotic shake-off) and collection of samples at several time points (starting at 6-7 am).
		<ol>
			<li>Detach rounded (mitotic) cells by shaking each plate and gently pipetting nocodazole-containing growth medium. Collect medium with detached cells from each 100 mm plate into 50 mL sterile tubes, centrifuge (300 x g, 5 min, room temperature (RT)) and wash cells twice by adding 1x&#160; PBS followed by centrifugation. Use of cold PBS or PBS plus nocodazole is recommended to avoid mitotic slippage (see Discussion section).</li>
			<li>Resuspend mitotic cells gathered from each 100 mm plate in 10 mL of complete medium. Save 2 mL for RNA extraction and 2 mL for FACS analysis for the 0 h time point (approximately 0.2-0.25 x 106 cells per sample).</li>
			<li>Re-plate remaining mitotic cells for subsequent time points in 6-well plates (2 mL/well; 0.2-0.25 x 106 cells/well). 
			NOTE: Remember that 2 wells are required per selected time point (1 for RNA and 1 for FACS analysis).</li>
		</ol>
		</li>
		<li>Collect samples at selected time points. Every 1.5 to 3 h is recommended in order to obtain an adequate profile of the cell cycle progression.
		<ol>
			<li>For RNA extraction, remove medium, rinse well with 2 mL pre-warm 1x PBS and add 1 mL of suitable RNA isolation reagent (e.g. TRIzol) in the well (perform this last step in a safety cabinet for chemicals). Pipette up and down to detach and lyse cells, transfer cell lysate to a 1.5 mL microcentrifuge tube, incubate 5 min at RT and store tube at -80 &#176;C until further use.</li>
			<li>For FACS analysis, rinse well with 2 mL pre-warm 1x PBS, add pre-warmed Trypsin-EDTA solution (0.3 mL/well) to detach cells, block Trypsin-EDTA by adding 1 mL complete medium and collect each sample in a separate 15 mL tube.
			<ol>
				<li>Centrifuge cells (300 x g, 5 min, RT), save cellular pellet and discard supernatant. In order to fix cells, resuspend cells in 1 mL of chilled 70% (v/v) ethanol in 1x PBS by gently vortexing tubes, and place them on ice for approximately 15 min prior to storing at 4 &#176;C or to staining for further analysis by FACS (described in steps 1.4 - 1.5).</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>HU-based synchronization and release of U2OS cells from G1/S boundary
	<ol>
		<li>Prepare complete cell culture medium as described in step 1.1.</li>
		<li>Seed 0.25 x 106 U2OS cells per well in 6 well plates (2 mL complete culture medium per well). In order to calculate the number of wells needed for the experiment, take into account that 2 wells will be required per selected time point (1 well for RNA extraction and 1 well for cell cycle monitoring) and that 2 additional wells of asynchronously growing cells are needed to define FACS analysis compensation settings.</li>
		<li>Let cells attach by incubating 6-well plates overnight (O/N) at 37 &#176;C in a humidified atmosphere with 5% CO2.</li>
		<li>Remove complete medium from wells the following morning and add 2 mL of pre-warmed FBS-free DMEM-Glutamine medium per well. Incubate cells for an additional 24 h at 37 &#176;C in a humidified atmosphere with 5% CO2. 
		&#8203;NOTE: Perform this step in all wells except for 2 (those saved to define FACS settings). Serum withdrawal step can be omitted if efficient synchronization is achieved by simply incubating cells with HU.</li>
		<li>G1/S cell cycle arrest with HU.
		<ol>
			<li>Prepare fresh HU stock solution (500 mM) prior to each use. Add 2 mL H2O to 76.06 mg of HU powder and mix until thoroughly dissolved. Sterilize the solution by filtration through a 0.2 &#181;m pore size filter. Mix 50 mL of complete medium with 400 &#956;L of filter-sterilized HU stock solution for a final HU concentration of 4 mM.</li>
			<li>Remove medium from all wells except from the 2 wells needed for defining FACS settings and replace with a freshly prepared 4 mM HU-containing complete medium (2 mL/well).</li>
			<li>Incubate cells for 24 h in HU-containing medium at 37 &#176;C in a humidified atmosphere with 5% CO2.</li>
		</ol>
		</li>
		<li>Release of cells from HU-mediated arrest. Remove HU-containing medium from wells and rinse wells twice with pre-warmed 1x PBS (2 mL each time). Add 2 mL of complete medium per well. Collect 2 samples for the 0 h time point (1 for RNA extraction and 1 for cell cycle arrest verification by FACS) as well as 2 samples saved for FACS settings. Place remaining wells in the incubator.</li>
		<li>Collect samples every 1.5 to 3 h in order to obtain an adequate distribution of cell cycle progression. At each time point, perform sample processing (for RNA extraction and for FACS analysis) as described in 1.1.8.1-1.1.8.2.</li>
	</ol>
	</li>
	<li>Treatment with DNA damaging agents 
	NOTE: Whenever the aim is to elucidate the effect of a compound (e.g. DNA damaging agents) in cell cycle events, any of the previously described synchronization methods can be combined with treatment of cells with the genotoxic agent. In order to select the synchronization method, it is important to consider the phase of the cell cycle that we would like to analyze. In general, Thy-Noc procedure may be suitable to study the effect of a compound in G1 phase or S phase entry while HU-mediated synchronization may be more suitable to study the impact in S to G2 phases or in the entry to mitosis.
	<ol>
		<li>Analysis of the effect of genotoxic agents in G1 phase or S phase entry
		<ol>
			<li>Synchronize cells as described in 1.1.2. to 1.1.6.</li>
			<li>Release cells from nocodazole and re-plate them as described in 1.1.7. Incubate them at 37 &#176;C in a humidified atmosphere with 5% CO2 for 3 h to let them attach prior to adding agent (required incubation period may vary depending on the cell line).</li>
			<li>Add agent and collect samples as previously described in 1.1.8.</li>
		</ol>
		</li>
		<li>Analysis of the effect of genotoxic agents in S-G2 phases or M entry
		<ol>
			<li>Synchronize cells as described in 1.2.2. to 1.2.5.</li>
			<li>Release cells from HU as described in 1.2.6. and add agent straightaway.</li>
			<li>Collect samples as previously described in 1.8.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Monitoring of cell synchronization and progression through the cell cycle by propidium iodide (PI) staining and FACS analysis 
	NOTE: Samples collected at all time points together with those required to define FACS settings can be stored at 4 &#176;C once they have been fixed (as mentioned in 1.1.8.2). Perform staining with PI solution followed by FACS analysis for all the samples of the experiment simultaneously. PI intercalates into the major groove of double-stranded DNA producing a highly fluorescent signal when excited at 535 nm with a broad emission peak around 600 nm. Since PI can also bind to double-stranded RNA, it is necessary to treat the cells with RNase for optimal DNA resolution.
	<ol>
		<li>Prepare freshly made PI staining solution. A PI stock solution can be prepared by dissolving PI powder in PBS (e.g. 5 mg/mL). Store the stock solution at 4 &#176;C (in darkness). Staining solution is composed of PI (140 &#956;M), sodium citrate (38 mM) and Triton X-100 (0.01% v/v).</li>
		<li>Warm up an appropriate surface (e.g. oven) to 37 &#176;C.</li>
		<li>Centrifuge fixed cells (450 x g, 5 min, RT), decant supernatant (ethanol) and wash once with 1x PBS.</li>
		<li>Centrifuge cells again, remove PBS and add 300 &#956;L of PI staining solution per sample (except to one of the samples for FACS settings; add PBS to this sample instead).</li>
		<li>Transfer cells to FACS Tubes (5 mL round-bottom polystyrene tubes).</li>
		<li>Add 1 &#956;L of RNase A to each sample, mix and incubate samples for 30 min in darkness at 37 &#176;C. Samples can be stored protected from light at 4 &#176;C for a maximum of 2 - 3 days.</li>
		<li>Analyze DNA content in samples by flow cytometry. Define FACS analysis compensation settings with PI-stained asynchronous sample. Use blank sample (without PI staining solution) to check for autofluorescence. Basics of PI staining-mediated analysis of DNA content by flow cytometry has been previously described9.</li>
	</ol>
	</li>
	<li>Determination of mitotic index by double phospho-H3 (Ser 10)/PI staining 
	NOTE: Cells undergoing mitosis can be easily detected by flow cytometry with antibodies specific for phospho-histone H3 in Serine 10 (pH3). A concomitant PI staining is useful to determine DNA content-based distribution of the cell population. 5 samples are required for the optimal configurations of FACS settings: blank, PI-only, pH3-only, secondary antibody-only and double staining.
	<ol>
		<li>Centrifuge fixed cells (450 x g, 5 min, 4 &#176;C) and discard supernatant. The following steps are described to perform staining in 15 mL tubes.</li>
		<li>Wash cells by adding 1 mL PBS-T (PBS + 0.05% Tween-20) to the pellet and centrifuge (450 x g, 5 min, 4 &#176;C). Remove supernatant.</li>
		<li>Add anti-pH3 antibody diluted (1:500) in 100-200 &#181;L of PBS-T + 3% BSA, and incubate with rocking for 2 h at RT (or O/N at 4 &#176;C).</li>
		<li>Add 2 mL PBS-T (PBS + 0.05% Tween-20) and centrifuge (450 x g, 5 min, 4 &#176;C). Remove supernatant.</li>
		<li>Wash once more by adding 2 mL PBS-T to the pellet, centrifuge and discard supernatant.</li>
		<li>Add secondary antibody (anti-rabbit AlexaFluor 488 in the case of selected pH3 antibody) diluted (1:500) in 100-200 &#181;L of PBS-T + 3% BSA and incubate with rocking for 1 h at RT (or O/N at 4 &#176;C). Protect samples from light.</li>
		<li>Wash twice with PBS-T (2 mL) by centrifugation as described in step 1.5.4.</li>
		<li>Perform PI staining as described (steps 1.4.1 to 1.4.6).</li>
	</ol>
	</li>
</ol>
2. Sample Collection and Processsing for Gene Expression Analysis
<ol>
	<li>Take 1.5 mL microcentrifuge samples in the RNA isolation reagent out of the freezer and let them thaw at RT inside a safety cabinet for chemicals.</li>
	<li>Add 400 &#181;L of chloroform to each sample and shake vigorously (but do not vortex) until complete mixing. Incubate samples for 5 min at RT.</li>
	<li>Centrifuge tubes for 15 min (&#8805;8,000 x g, 4 &#176;C) in a benchtop microcentrifuge.</li>
	<li>Transfer the aqueous (upper) phase to a new 1.5 mL microcentrifuge tube and register the transferred volume (in order to simplify the procedure, it is recommended to collect equal volumes in all samples of the experiment).</li>
	<li>Add 1 volume of 100% ethanol slowly (drop by drop) to the aqueous phase while mixing. Do not centrifuge.</li>
	<li>Perform the next steps with the commercial RNA mini prep kit. Pipet up to 700 &#181;L of each sample, including any precipitate that may have formed, into a spin column in a 2 mL collection tube (provided by the manufacturer).</li>
	<li>Close the lid and centrifuge (&#8805; 8,000 g, RT) for 15 s. Discard the flow-through. Repeat previous step with the remaining sample (if any).</li>
	<li>Follow manufactures&#180; instructions for RNA washing and elution (elute each sample in 30 - 40 &#181;l nuclease-free H2O in order to achieve an appropriate RNA concentration for next step).</li>
	<li>Determine RNA concentration and purity of samples by absorbance measurements (a A260/280 ratio of 2.0-2.1 indicates good purity of the RNA sample). Store RNA samples at -80 &#176;C until use for RT-qPCR analysis.</li>
	<li>For RNA conversion into cDNA and subsequent quantitative-PCR, take 1 &#181;g RNA per sample and prepare retrotranscriptase reaction according to manufacturers&#39; instructions. Obtained cDNA samples can be stored at 4 &#176;C (for a couple of days) or at -20 &#176;C (for longer periods of time). 
	NOTE: Sample preparation, primer design and other considerations for real time-PCR have been extensively described in the literature22,23.</li>
</ol>

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

The authors have nothing to disclose.

Analysis of fine-tune regulated genes involved in transient and specific roles in the cell cycle requires a uniform cell population. Many researchers routinely use long-established tumor cell lines for these purposes, and a variety of methods have been developed to obtain synchronous (or partially synchronous) cell populations, with the aim to accumulate as many cells as possible in defined cell cycle phases. Moreover, strong efforts have been undertaken to improve and optimize well-established synchronization approaches...

Transition through all the phases of the cell cycle is coupled to a tightly regulated gene expression program. This coordinated &#34;on and off&#34; of gene transcription throughout the cell cycle is believed to be under the control of complex transcriptional regulatory systems, regulating not just the timing but also the levels of gene expression. Deregulation of key cell cycle components is known to contribute to the development of several diseases and is a well- established hallmark of tumorigenesis1,2. Genome-wide transcriptomic analyses carried out in yeast and mammalian cells have revealed that a large number of genes exhibit periodic gene expression patterns in the cell cycle, suggesting that transcriptional fluctuation during the cell cycle is a reflection of the temporal requirement of a given gene product in a precise phase3,4,5.
A major task in the study of cell cycle-regulated gene expression is the synchronization of cells into specific cell cycle phases. Cell synchronization helps to interpret association of a gene expression pattern to a particular cell cycle phase transition, and it has led to a better understanding of the regulation and function of numerous genes. Cell synchronization is also important for studying the mechanism of action of anticancer drugs, as chemotherapeutic agents are known to affect both gene expression as well as cell cycle kinetics6,7. Nevertheless, it is often difficult to determine whether gene expression differences resulting from treatment with these agents are a direct response to the treatment or are merely the consequence of changes in cell cycle profiles. To distinguish between these possibilities, gene expression should be analyzed in cells that have been synchronized prior to addition of the chemotherapeutic drug.
With the exception of some primary cells such as freshly isolated lymphoid cells -which constitute a homogeneous cell population synchronized in G08-, in vitro established cell lines grow asynchronously in culture. Under regular growth conditions, these asynchronously cycling cells are found in all phases of the cell cycle but, preferentially in G19. Therefore, this context does not provide an optimal scenario for functional or gene expression analyses in a specific cell cycle phase (e.g. G1, S etc.). Non-transformed immortalized cell lines (e.g. fibroblasts) can be synchronized with so-called physiological methods10. These methods are based on the retained primary cell features of non-transformed cells, such as cell-contact inhibition and growth factor dependency in order to continue cycling. Removal of serum in combination with contact inhibition renders non-transformed cells arrested at G0/G1. However, synchronized cell cycle entry and progression often requires subculture, which also involves artificial detachment of the cells and re-plating10. Most importantly, this method is not suitable for synchronization of transformed cell lines, the vast majority of established cell lines presently in use, characterized for lacking cell contact-mediated growth inhibition or response to growth factor withdrawal. Thus, it is clear that alternative methods are required for efficient cell synchronization in specific phases of the cell cycle. In general terms, the most frequently used synchronization methods are based on transient chemical or pharmacological inhibition of one defined point of the cell cycle, typically DNA synthesis or mitotic spindle formation. Inhibition of DNA synthesis synchronizes cells by arresting them in late G1 or early S phase. This can be achieved by the addition of compounds such as mimosine, an inhibitor of nucleotide biosynthesis11,12, aphidicolin, an inhibitor of DNA polymerases13,14, hydroxyurea, an inhibitor of ribonucleotide reductase15,16 or by excess amounts of thymidine17,18. On the other hand, inhibitors of microtubule polymerization, such as colchicine or nocodazole, are able to block mitotic spindle formation leading to cell synchronization at early M phase19,20,21.
In this work we describe a method involving two complementary synchronization protocols based on transient chemical inhibition for studying the expression of cell cycle-regulated genes at the mRNA level. This method is fundamental for defining the role of cell cycle genes in specific cell cycle processes. Furthermore, it provides a general frame for studying the impact of anticancer treatments in order to accurately detect drug responsive genes and to minimize misinterpretations derived from perturbations in cell cycle progression generated by these drugs.

<table><tbody><tr><td>DMEM, high glucose, GutaMAX supplement</td><td>Thermo Fisher Scientific</td><td>61965-059</td><td></td></tr><tr><td>FBS, qualified, E.U.-approved, South America origin</td><td>Thermo Fisher Scientific</td><td>10270-106</td><td></td></tr><tr><td>Penicillin-Streptomycin (10,000 U/mL)</td><td>Thermo Fisher Scientific</td><td>15140-122</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x), phenol red</td><td>Thermo Fisher Scientific</td><td>25200-072</td><td></td></tr><tr><td>Thymidine</td><td>SIGMA</td><td>T1895-5G</td><td>Freshly prepared. Slight warming might help dissolve thymidine.</td></tr><tr><td>Nocodazole</td><td>SIGMA</td><td>M-1404</td><td>Stock solution in DMSO stored at -20 &amp;ordm;C in small aliquots</td></tr><tr><td>Hydroxyurea</td><td>SIGMA</td><td>H8627</td><td>Freshly prepared</td></tr><tr><td>Mitomycin C from Streptomyces caespitosus</td><td>SIGMA</td><td>M4287</td><td>1.5 mM stock solution in sterile H&lt;sub&gt;2&lt;/sub&gt;O protected from light and stored at 4 &amp;ordm;C</td></tr><tr><td>Dimethyl sulfoxide</td><td>SIGMA</td><td>D2650</td><td></td></tr><tr><td>Propidium iodide</td><td>SIGMA</td><td>P4170</td><td>Stock solution in sterile PBS at 5 mg/ml, stored at 4 &amp;ordm; C protected from light.</td></tr><tr><td>PBS pH 7.6</td><td></td><td></td><td>Home made</td></tr><tr><td>Ethanol</td><td>PANREAC</td><td>A3678,2500</td><td></td></tr><tr><td>Chloroform</td><td>SIGMA</td><td>C2432</td><td></td></tr><tr><td>Sodium Citrate</td><td>PANREAC</td><td>131655</td><td></td></tr><tr><td>Triton X-100</td><td>SIGMA</td><td>T8787</td><td></td></tr><tr><td>RNAse A</td><td>Thermo Fisher Scientific</td><td>EN0531</td><td></td></tr><tr><td>TRIzol Reagent</td><td>LifeTechnologies</td><td>15596018</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>QIAGEN</td><td>74106</td><td></td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Fisher Scientific</td><td>4368814</td><td></td></tr><tr><td>Anti-Cyclin E1 antibody</td><td>Cell Signaling</td><td>4129</td><td>1:1000 dilution in 5% milk, o/n, 4 &amp;ordm;C</td></tr><tr><td>Anti-Cyclin B1 antibody</td><td>Cell Signaling</td><td>4135</td><td>1:1000 dilution in 5% milk, o/n, 4 &amp;ordm;C</td></tr><tr><td>Anti-&amp;beta;-actin</td><td>SIGMA</td><td>A-5441</td><td>1:3000 dilution in 5 % milk, 1 hr, RT</td></tr><tr><td>Anti-pH3 (Ser 10) antiboty</td><td>Millipore</td><td>06-570</td><td>Specified in the protocol</td></tr><tr><td>Secondary anti-rabbit AlexaFluor 488 antibody</td><td>Invitrogen</td><td>R37116</td><td>Specified in the protocol</td></tr><tr><td>Secondary anti-mouse-HRP antibody</td><td>Santa Cruz Biotechnology</td><td>sc-3697</td><td>1:3000 dilution in 5 % milk, 1 hr, RT</td></tr><tr><td>Forward E2F1 antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; TGACATCACCAACGTCCTTGA</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Reverse E2F1 antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; CTGTGCGAGGTCCTGGGTC</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Forward E2F7 antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; GGAAAGGCAACAGCAAACTCT</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Reverse E2F7 antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; TGGGAGAGCACCAAGAGTAGAAGA</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Forward p21&lt;sup&gt;Cip1 &lt;/sup&gt;antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; AGCAGAGGAAGACCATGTGGAC</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Reverse p21&lt;sup&gt;Cip1 &lt;/sup&gt;antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; TTTCGACCCTGAGAGTCTCCAG</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Forward TBP antibody (human) reference gene&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Reverse TBP antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Forward Oxa1L antibody (human) reference gene&amp;nbsp;&amp;nbsp; CACTTGCCAGAGATCCAGAAG&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Reverse Oxa1L &amp;nbsp;antibody (human)&amp;nbsp;&amp;nbsp;&amp;nbsp; CACAGGGAGAATGAGAGGTTTATAG&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>Biolegio</td><td></td><td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td></tr><tr><td>Power SYBRGreen PCR Master Mix</td><td>Thermo Fisher Scientific</td><td>4368702</td><td></td></tr><tr><td>FACS Tubes&amp;nbsp;</td><td>Sarstedt</td><td>551578</td><td></td></tr><tr><td>MicroAmp Optical 96-Well Reaction Plate</td><td>Thermo Fisher Scientific</td><td>N8010560</td><td></td></tr><tr><td>Corning 100 mm TC-Treated Culture Dish</td><td>Corning</td><td></td><td></td></tr><tr><td>Corning Costar cell culture plates 6 well</td><td>Corning</td><td>3506</td><td></td></tr><tr><td>Refrigerated Bench-Top Microcentrifuge</td><td>Eppendorf</td><td>5415 R</td><td></td></tr><tr><td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td><td>Jouan</td><td>743205604</td><td></td></tr><tr><td>NanoDrop Lite Spectrophotometer</td><td>Thermo Scientific</td><td>ND-LITE-PR</td><td></td></tr><tr><td>BD FACSCalibur Flow Cytometer</td><td>BD Bioscience</td><td></td><td></td></tr><tr><td>QuantStudio 3 Real-Time PCR System</td><td>Thermo Fisher Scientific</td><td>A28567</td><td></td></tr></tbody></table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

Schematic representation of Thy-Noc and HU-based protocols for cell synchronization.
Figure 1 summarizes the steps required for U2OS cell synchronization and subsequent sample collection in order to verify progression through the cell cycle and to perform gene expression analyses.
Phospho-H3 and PI staining are good evaluation parameters to select synchroniz...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols | Genetics | Video

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

studying-cell-cycle-regulated-gene-expression-two-complementary-cell

Universidad San Sebastian

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

27.1K Views.  University of the Basque Country, UPV/EHU. We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle. 

Video: Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental changes. Considerable progress in our understanding of the tight connection between the circadian clock and most aspects of physiology has been made in the field over the last decade. However, unraveling the molecular basis that underlies the function of the circadian oscillator in humans stays of highest technical challenge. Here, we provide a detailed description of an experimental approach for long-term (2-5 days) bioluminescence recording and outflow medium collection in cultured human primary cells. For this purpose, we have transduced primary cells with a lentiviral luciferase reporter that is under control of a core clock gene promoter, which allows for the parallel assessment of hormone secretion and circadian bioluminescence. Furthermore, we describe the conditions for disrupting the circadian clock in primary human cells by transfecting siRNA targeting CLOCK. Our results on the circadian regulation of insulin secretion by human pancreatic islets, and myokine secretion by human skeletal muscle cells, are presented here to illustrate the application of this methodology. These settings can be used to study the molecular makeup of human peripheral clocks and to analyze their functional impact on primary cells under physiological or pathophysiological conditions.

Here, we describe settings to monitor in parallel circadian bioluminescence and the secretory activity of human islet cells and primary myotubes. For this, we employed lentiviral gene delivery of a luciferase core clock reporter, followed by in vitro synchronization and collection of outflow medium by continuous cell perifusion.

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell activation, stress, or stimulation. Single-cell multiplex gene expression enables the simultaneous assessment of tens of genes1,2,3. At the single-cell level, multiplex gene expression determines population heterogeneity4,5. It allows for the distinction of population heterogeneity by determining both the probable mix of diverse precursor stages among mature cells and also the diversity of cell responses to stimuli.
Innate lymphoid cells (ILC) have been recently described as a population of innate effectors of the immune response6,7. In this protocol, cell heterogeneity of the ILC hepatic compartment is investigated during homeostasis.
Currently, the most widely used technique to assess gene expression is RT-qPCR. This method measures gene expression only one gene at a time. Additionally, this method cannot estimate heterogeneity of gene expression, since multiple cells are needed for one test. This leads to the measurement of the average gene expression of the population. When assessing large numbers of genes, RT-qPCR becomes a time-, reagent-, and sample-consuming method. Hence, the trade-offs limit the number of genes or cell populations that can be evaluated, increasing the risk of missing the global picture.
This manuscript describes how single-cell multiplex RT-qPCR can be used to overcome these limitations. This technique has benefited from recent microfluidics technological advances1,2. Reactions occurring in multiplex RT-qPCR chips do not exceed the nanoliter-level. Hence, single-cell gene expression, as well as simultaneous multiple gene expression, can be performed in a reagent-, sample-, and cost-effective manner. It is possible to test cell gene signature heterogeneity at the clonal level between cell subsets within a population at different developmental stages or under different conditions4,5. Working on rare populations with large numbers of conditions at the single-cell level is no longer a restriction.

This protocol describes how to assess the expression of a large array of genes at the clonal level. Single-cell RT-qPCR produces highly reliable results with a strong sensitivity for hundreds of samples and genes.

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Analysis of Cell Cycle Position in Mammalian Cells

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of cell proliferation underlies the pathology of diseases like cancer. As such there is great need to be able to investigate cell proliferation and quantitate the proportion of cells in each phase of the cell cycle. It is also of vital importance to indistinguishably identify cells that are replicating their DNA within a larger population. Since a cell&prime;s decision to proliferate is made in the G1 phase immediately before initiating DNA synthesis and progressing through the rest of the cell cycle, detection of DNA synthesis at this stage allows for an unambiguous determination of the status of growth regulation in cell culture experiments.
DNA content in cells can be readily quantitated by flow cytometry of cells stained with propidium iodide, a fluorescent DNA intercalating dye. Similarly, active DNA synthesis can be quantitated by culturing cells in the presence of radioactive thymidine, harvesting the cells, and measuring the incorporation of radioactivity into an acid insoluble fraction. We have considerable expertise with cell cycle analysis and recommend a different approach. We Investigate cell proliferation using bromodeoxyuridine/fluorodeoxyuridine (abbreviated simply as BrdU) staining that detects the incorporation of these thymine analogs into recently synthesized DNA. Labeling and staining cells with BrdU, combined with total DNA staining by propidium iodide and analysis by flow cytometry1 offers the most accurate measure of cells in the various stages of the cell cycle. It is our preferred method because it combines the detection of active DNA synthesis, through antibody based staining of BrdU, with total DNA content from propidium iodide. This allows for the clear separation of cells in G1 from early S phase, or late S phase from G2/M. Furthermore, this approach can be utilized to investigate the effects of many different cell stimuli and pharmacologic agents on the regulation of progression through these different cell cycle phases.
In this report we describe methods for labeling and staining cultured cells, as well as their analysis by flow cytometry. We also include experimental examples of how this method can be used to measure the effects of growth inhibiting signals from cytokines such as TGF-&beta;1, and proliferative inhibitors such as the cyclin dependent kinase inhibitor, p27KIP1. We also include an alternate protocol that allows for the analysis of cell cycle position in a sub-population of cells within a larger culture5. In this case, we demonstrate how to detect a cell cycle arrest in cells transfected with the retinoblastoma gene even when greatly outnumbered by untransfected cells in the same culture. These examples illustrate the many ways that DNA staining and flow cytometry can be utilized and adapted to investigate fundamental questions of mammalian cell cycle control.

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol. We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

The regulation of cell proliferation is central to tissue morphogenesis during the development of multicellular organisms. Furthermore, loss of control of ...

Measuring Cell Cycle Progression Kinetics with Metabolic Labeling and Flow Cytometry

Precise control of the initiation and subsequent progression through the various phases of the cell cycle are of paramount importance in proliferating cells. Cell cycle division is an integral part of growth and reproduction and deregulation of key cell cycle components have been implicated in the precipitating events of carcinogenesis 1,2. Molecular agents in anti-cancer therapies frequently target biological pathways responsible for the regulation and coordination of cell cycle division 3. Although cell cycle kinetics tend to vary according to cell type, the distribution of cells amongst the four stages of the cell cycle is rather consistent within a particular cell line due to the consistent pattern of mitogen and growth factor expression. Genotoxic events and other cellular stressors can result in a temporary block of cell cycle progression, resulting in arrest or a temporary pause in a particular cell cycle phase to allow for instigation of the appropriate response mechanism. 
The ability to experimentally observe the behavior of a cell population with reference to their cell cycle progression stage is an important advance in cell biology. Common procedures such as mitotic shake off, differential centrifugation or flow cytometry-based sorting are used to isolate cells at specific stages of the cell cycle 4-6. These fractionated, cell cycle phase-enriched populations are then subjected to experimental treatments. Yield, purity and viability of the separated fractions can often be compromised using these physical separation methods. As well, the time lapse between separation of the cell populations and the start of experimental treatment, whereby the fractionated cells can progress from the selected cell cycle stage, can pose significant challenges in the successful implementation and interpretation of these experiments.
Other approaches to study cell cycle stages include the use of chemicals to synchronize cells. Treatment of cells with chemical inhibitors of key metabolic processes for each cell cycle stage are useful in blocking the progression of the cell cycle to the next stage. For example, the ribonucleotide reductase inhibitor hydroxyurea halts cells at the G1/S juncture by limiting the supply of deoxynucleotides, the building blocks of DNA. Other notable chemicals include treatment with aphidicolin, a polymerase alpha inhibitor for G1 arrest, treatment with colchicine and nocodazole, both of which interfere with mitotic spindle formation to halt cells in M phase and finally, treatment with the DNA chain terminator 5-fluorodeoxyridine to initiate S phase arrest 7-9. Treatment with these chemicals is an effective means of synchronizing an entire population of cells at a particular phase. With removal of the chemical, cells rejoin the cell cycle in unison. Treatment of the test agent following release from the cell cycle blocking chemical ensures that the drug response elicited is from a uniform, cell cycle stage-specific population. However, since many of the chemical synchronizers are known genotoxic compounds, teasing apart the participation of various response pathways (to the synchronizers vs. the test agents) is challenging. 
Here we describe a metabolic labeling method for following a subpopulation of actively cycling cells through their progression from the DNA replication phase, through to the division and separation of their daughter cells. Coupled with flow cytometry quantification, this protocol enables for measurement of kinetic progression of the cell cycle in the absence of either mechanically- or chemically- induced cellular stresses commonly associated with other cell cycle synchronization methodologies 10. In the following sections we will discuss the methodology, as well as some of its applications in biomedical research.

Tracking subtle changes in the progression and kinetics of cell cycle stages can be accomplished by use of a combination of metabolic labeling of nucleic acids with BrdU and total genomic DNA staining via Propidium Iodide. This method avoids the need of chemical synchronization of cycling cells, thereby preventing the introduction of non-specific DNA damage, which in turn affects cell cycle progression.

Precise control of the initiation and subsequent progression through the various phases of the cell cycle are of paramount importance in proliferating ...

Synchronization of Caulobacter Crescentus for Investigation of the Bacterial Cell Cycle

The cell cycle is important for growth, genome replication, and development in all cells. In bacteria, studies of the cell cycle have focused largely on unsynchronized cells making it difficult to order the temporal events required for cell cycle progression, genome replication, and division. Caulobacter crescentus provides an excellent model system for the bacterial cell cycle whereby cells can be rapidly synchronized in a G0 state by density centrifugation. Cell cycle synchronization experiments have been used to establish the molecular events governing chromosome replication and segregation, to map a genetic regulatory network controlling cell cycle progression, and to identify the establishment of polar signaling complexes required for asymmetric cell division. Here we provide a detailed protocol for the rapid synchronization of Caulobacter NA1000 cells. Synchronization can be performed in a large-scale format for gene expression profiling and western blot assays, as well as a small-scale format for microscopy or FACS assays. The rapid synchronizability and high cell yields of Caulobacter make this organism a powerful model system for studies of the bacterial cell cycle.

Synchronization of Caulobacter Crescentus for Investigation of the Bacterial Cell Cycle

Synchronization of bacterial cells is essential for studies of the bacterial cell cycle and development. Caulobacter crescentus is synchronizable through density centrifugation allowing a rapid and powerful tool for studies of the bacterial cell cycle. Here we provide a detailed protocol for the synchronization of Caulobacter cells.

The cell cycle is important for growth, genome replication, and development in all cells.  In bacteria, studies of the cell cycle have focused largely on ...

Temporal Tracking of Cell Cycle Progression Using Flow Cytometry without the Need for Synchronization

This protocol describes a method to permit the tracking of cells through the cell cycle without requiring the cells to be synchronized. Achieving cell synchronization can be difficult for many cell systems. Standard practice is to block cell cycle progression at a specific stage and then release the accumulated cells producing a wave of cells progressing through the cycle in unison. However, some cell types find this block toxic resulting in abnormal cell cycling, or even mass death. Bromodeoxyuridine (BrdU) uptake can be used to track the cell cycle stage of individual cells. Cells incorporate this synthetic thymidine analog, while synthesizing new DNA during S phase. By providing BrdU for a brief period it is possible to mark a pool of cells that were in S phase while the BrdU was present. These cells can then be tracked through the remainder of the cell cycle and into the next round of replication, permitting the duration of the cell cycle phases to be determined without the need to induce a potentially toxic cell cycle block. It is also possible to determine and correlate the expression of both internal and external proteins during subsequent stages of the cell cycle. These can be used to further refine the assignment of cell cycle stage or assess effects on other cellular functions such as checkpoint activation or cell death.

This protocol describes the use of bromodeoxyuridine (BrdU) uptake to permit the temporal tracking of cells that were in S phase at a specific point in time. Addition of DNA dyes and antibody labeling facilitates detailed analysis of the fate of the S phase cells at later times.

This protocol describes a method to permit the tracking of cells through the cell cycle without requiring the cells to be synchronized. Achieving cell ...

Combining Mitotic Cell Synchronization and High Resolution Confocal Microscopy to Study the Role of Multifunctional Cell Cycle Proteins During Mitosis

Study of the various regulatory events of the cell cycle in a phase-dependent manner provides a clear understanding about cell growth and division. The synchronization of cell populations at specific stages of the cell cycle has been found to be very useful in such experimental endeavors. Synchronization of cells by treatment with chemicals that are relatively less toxic can be advantageous over the use of pharmacological inhibitory drugs for the study of consequent cell cycle events and to obtain specific enrichment of selected mitotic stages. Here, we describe the protocol for synchronizing human cells at different stages of the cell cycle, including both in S phase and M phase with a double thymidine block and release procedure for studying the functionality of mitotic proteins in chromosome alignment and segregation. This protocol has been extremely useful for studying the mitotic roles of multifunctional proteins which possess established interphase functions. In our case, the mitotic role of Cdt1, a protein critical for replication origin licensing in G1 phase, can be studied effectively only when G2/M-specific Cdt1 can be depleted. We describe the detailed protocol for depletion of G2/M-specific Cdt1 using double thymidine synchronization. We also explain the protocol of cell fixation, and live cell imaging using high resolution confocal microscopy after thymidine release. The method is also useful for analyzing the function of mitotic proteins under both physiological and perturbed conditions such as for Hec1, a component of the Ndc80 complex, as it enables one to obtain large sample sizes of mitotic cells for fixed and live cell analysis as we show here.&#160;&#160;

We present a protocol for double thymidine synchronization of HeLa cells followed by analysis using high resolution confocal microscopy. This method is key to obtaining large number of cells that proceed synchronously from S phase to mitosis, enabling studies on mitotic roles of multifunctional proteins which also possess interphase functions.

Study of the various regulatory events of the cell cycle in a phase-dependent manner provides a clear understanding about cell growth and division. The ...

Alignment of Synchronized Time-Series Data for Cross-Experiment Comparisons

Alignment of Synchronized Time-Series Data Using the Characterizing Loss of Cell Cycle Synchrony Model for Cross-Experiment Comparisons

Investigating the cell cycle often depends on synchronizing cell populations to measure various parameters in a time series as the cells traverse the cell cycle. However, even under similar conditions, replicate experiments display differences in the time required to recover from synchrony and to traverse the cell cycle, thus preventing direct comparisons at each time point. The problem of comparing dynamic measurements across experiments is exacerbated in mutant populations or in alternative growth conditions that affect the synchrony recovery time and/or the cell-cycle period. 
We have previously published a parametric mathematical model named Characterizing Loss of Cell Cycle Synchrony (CLOCCS) that monitors how synchronous populations of cells release from synchrony and progress through the cell cycle. The learned parameters from the model can then be used to convert experimental time points from synchronized time-series experiments into a normalized time scale (lifeline points). Rather than representing the elapsed time in minutes from the start of the experiment, the lifeline scale represents the progression from synchrony to cell-cycle entry and then through the phases of the cell cycle. Since lifeline points correspond to the phase of the average cell within the synchronized population, this normalized time scale allows for direct comparisons between experiments, including those with varying periods and recovery times. Furthermore, the model has been used to align cell-cycle experiments between different species (e.g., Saccharomyces cerevisiae and Schizosaccharomyces pombe), thus enabling direct comparison of cell-cycle measurements, which may reveal evolutionary similarities and differences.

Author Spotlight: Alignment of Synchronized Time-Series Data Using the Characterizing Loss of Cell Cycle Synchrony Model for Cross-Experiment Comparisons  

One challenge of analyzing synchronized time-series experiments is that the experiments often differ in the length of recovery from synchrony and the cell-cycle period. Thus, the measurements from different experiments cannot be analyzed in aggregate or readily compared. Here, we describe a method for aligning experiments to allow for phase-specific comparisons.

Investigating the cell cycle often depends on synchronizing cell populations to measure various parameters in a time series as the cells traverse the cell ...

Detection of G1 Phase Single-Stranded DNA Foci via RPA2 Immunofluorescent Staining

Visualizing Single-Stranded DNA Foci in the G1 Phase of the Cell Cycle

DNA has dedicated cellular repair pathways capable of coping with lesions that could arise from both endogenous and/or exogenous sources. DNA repair necessitates collaboration between numerous proteins, responsible for covering a broad range of tasks from recognizing and signaling the presence of a DNA lesion to physically repairing it. During this process, tracks of single-stranded DNA (ssDNA) are often created, which are eventually filled by DNA polymerases. The nature of these ssDNA tracks (in terms of both length and number), along with the polymerase recruited to fill these gaps, are repair pathway-specific. The visualization of these ssDNA tracks can help us understand the complicated dynamics of DNA repair mechanisms.
This protocol provides a detailed method for the preparation of G1 synchronized cells to measure ssDNA foci formation upon genotoxic stress. Using an easy-to-utilize immunofluorescence approach, we visualize ssDNA by staining for RPA2, a component of the heterotrimeric replication protein A complex (RPA). RPA2 binds to and stabilizes ssDNA intermediates that arise upon genotoxic stress or replication to control DNA repair and DNA damage checkpoint activation. 5-Ethynyl-2'-deoxyuridine (EdU) staining is used to visualize DNA replication to exclude any S phase cells. This protocol provides an alternative approach to the conventional, non-denaturing 5-bromo-2'-deoxyuridine (BrdU)-based assays and is better suited for the detection of ssDNA foci outside the S phase.

Author Spotlight: Visualizing Single-Stranded DNA During DNA Repair for Therapeutic Insights 

The following protocol presents the detection of single-stranded DNA foci in the G1 phase of the cell cycle utilizing cell cycle synchronization followed by RPA2 immunofluorescent staining.

DNA has dedicated cellular repair pathways capable of coping with lesions that could arise from both endogenous and/or exogenous sources. DNA repair ...

Cell Cycle Analysis

Cell cycle refers to the set of events through which a cell grows, replicates its genome, and ultimately divides into two daughter cells through the process of mitosis. Because the amount of DNA in a cell shows characteristic changes throughout the cycle, techniques known as cell cycle analysis can be used to separate a population of cells according to the different phases of cell cycle they are in, based on their varying DNA content.This video will cover the principles behind cell cycle analysis via DNA-staining. We will review a generalized protocol for performing this staining using bromodeoxyuridine (BrdU, a thymidine analog that is incorporated into newly synthesized DNA strands) and propidium iodide (PI, a DNA dye that stains all DNA), followed by analysis of the stained cells with flow cytometry. During flow cytometry, a single cell suspension of fluorescently labeled cells is passed through an instrument with a laser beam and the fluorescence of each cell is read. We will then discuss how to interpret data from flow cytometric scatter plots, and finally, look at a few applications of this technique.

Cell Cycle Analysis: Principle, BrdU and Flow Cytometry

Cell cycle refers to the set of events through which a cell grows, replicates its genome, and ultimately divides into two daughter cells through the ...

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

Summary

Explore More Videos

Chapters in this video

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Analysis of Cell Cycle Position in Mammalian Cells

Measuring Cell Cycle Progression Kinetics with Metabolic Labeling and Flow Cytometry

Synchronization of Caulobacter Crescentus for Investigation of the Bacterial Cell Cycle

Temporal Tracking of Cell Cycle Progression Using Flow Cytometry without the Need for Synchronization

Combining Mitotic Cell Synchronization and High Resolution Confocal Microscopy to Study the Role of Multifunctional Cell Cycle Proteins During Mitosis

Alignment of Synchronized Time-Series Data Using the Characterizing Loss of Cell Cycle Synchrony Model for Cross-Experiment Comparisons

Visualizing Single-Stranded DNA Foci in the G1 Phase of the Cell Cycle

Cell Cycle Analysis