AOH and MAS acknowledges the College of Science and the Thomas H. Gosnell School of Life Sciences at the Rochester Institute of Technology for support. This work was supported in part by United States National Science Foundation (NSF) award to AOH MCB-1120541.

NOTE: The authors are willing to provide bacterial strains and recombinant plasmids to facilitate the incorporation of functional complementation analysis for teaching purposes for individuals who are interested. The plasmids that were used to facilitate functional complementation experiments are listed in Table 1.
1. Construction of Plasmids for Functional Complementation
<ol>
	<li>Cloning of Diaminopimelate Aminotransferase (dapL) for Functional Complementation.
	<ol>
		<li>Amplify the dapL open reading frame (ORF) from the V. spinosum and cDNAs from A. thaliana and C. reinhardtii by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the 4 deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. 
		NOTE: The complete description pertaining to the recombinant cloning of three dapL orthologs from the plant A. thaliana (At-dapL), the bacterium Verrucomicrobium spinosum (Vs-dapL) and the alga Chlamydomonas reinhardtii (Cr-dapL) has been previously published.2,18-20 
		NOTE: The primers used for the cloning of the dapL orthologs are as follows: 
		VsdapL F- 5&#39;-CCCCGAATTCATGGCCCTCATCAACGAAAACTTCCTCAAG-3&#39; 
		VsdapL R 5&#39;- CCCCGTCGACCTACTTCAGCGCGGCGATACGGCGGCAGAC-3&#39; 
		AtdapL F- 5&#39;-GGGGCATTGGAAGGAGATATAACCATGGCAGTCAATACTTGCAAATGT-3&#39; 
		AtdapL R-5&#39;- GGGGGTCGACTCATTTGTAAAGCTGCTTGAATCTTCG-3&#39; 
		CrdapL F-5&#39;-CCCCCGAATTCATGCAGCTCAACGTGCGGTCCACCGCCAGC-3&#39; 
		CrdapL R-5&#39;- CCCCCAAGCTTCTAGTTACGCTTGCCGTAGGCCTCCTTAAA-3&#39;</li>
		<li>Clone the PCR fragments into the plasmid pET30A to produce the recombinant plasmids, pET30A::VsdapL, pET30A::AtdapL and pET30A::CrdapL using the primers, restriction enzymes and T4 DNA ligase.
		<ol>
			<li>Briefly, incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 50 &#181;g/ml&#8722;1 kanamycin by incubating at 37 &#176;C for 24 hr.18-20</li>
		</ol>
		</li>
		<li>To create the plasmid for functional complementation, digest pET30A::VsdapL and pET30A::AtdapL plasmids with the restriction enzymes XbaI and SalI and XbaI and HindIII for the pET30A::CrdapL. Ligate the inserts into the plasmid pBAD33 using T4 DNA ligase to produce the plasmids pBAD33::VsdapL; pBAD33::AtdapL and pBAD33::CrdapL.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 kanamycin by incubating 37 &#176;C for 24 hr.20</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of Tyrosine Aminotransferase (tyrB) from A. thaliana for Functional Complementation. 
	NOTE: The complete details regarding the cloning of the cDNA from A. thaliana annotated by the locus tags At5g36160 has been described previously.4 
	<ol>
		<li>Amplify the cDNA by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. 
		NOTE: The primers used for the cloning of the At5g36160 are as follows: 
		AttyrB F- 5&#39;-CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3&#39; 
		AttyrB R- 5&#39;- CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3&#39;</li>
		<li>Clone the fragment into the plasmid pET30A to produce the recombinant plasmids pET30A::At5g36160 by digesting the PCR fragment with EcoR1 and Sal1; ligate in the fragment into pET30A using T4 DNA ligase as described below.4</li>
		<li>To create the functional complementation plasmid, digest the pET30A::At5g36160 with the restriction enzymes XbaI and HindIII, and ligate the insert into pBAD33 using the same restriction enzyme sites to produce the recombinant plasmid pBAD33::At5g3160 using T4 DNA ligase.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform the ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 chloramphenicol by incubating 37 &#176;C for 24 hr.4</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate Ligase (murE) from V. spinosum for Functional Complementation. 
	NOTE: The cloning of the murE ORF from V. spinosum has been described previously.18
	<ol>
		<li>Amplify the open reading frame by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. Then clone into the plasmid pET100D to produce the plasmid pET100D::VsmurE. 
		NOTE: The primers used for the cloning of the VsmurE are as follows: 
		VsMurE F- 5&#39;- CACCATGACCATTTTGCGCGATCTTATCGAGGGT -3&#39; 
		VsMurE R- 5&#39;- GTCGACTCACTGACGGTCATCCCTCCTTTGGCGTGC-3&#39;</li>
		<li>To produce the plasmid for functional complementation, digest the pET100D::VsmurE 
		With the restriction enzymes XbaI and Sal1 and ligate the insert into pBAD33 to produce the recombinant plasmid pBAD33::VsmurE using T4 DNA ligase.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer, along with 1 unit of T4 DNA ligase, overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 chloramphenicol by incubating 37 &#176;C for 24 hr.8</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of relA/spoT (rsh) from Novosphingobium sp for Functional Complementation. 
	NOTE: The cloning of the rsh from Novosphingobium sp. has been described previously.17 
	<ol>
		<li>Amplify the rsh ORF in addition to 599 nucleotides upstream of the initiation start site and 46 nucleotides downstream at the termination site by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Taq DNA polymerase. Then clone into the plasmid pCR2.1 to produce pCR2.1::Nsprsh.
		<ol>
			<li>Incubate 1 &#181;l of amplified PCR fragment, 1 &#181;l of pCR2.1 vector, 1 &#181;l of salt solution and 1 &#181;l of water. Incubate at 25 &#176;C for 5 min and 2 &#181;l of ligation into E. coli cells, and screen for colonies on LB plates supplemented with 50 &#181;g/ml&#8722;1 kanamycin by incubating 37 &#176;C for 24 hr. 
			NOTE: The primers used for the cloning of the rsh are as follows: 
			rsh F- 5&#39;- GTTGAAAAACGCCGAATAGC -3&#39; 
			rsh R- 5&#39;- GAGACCTGTGCGTAGGTGGT -3&#39;</li>
			<li>For functional complementation, digest the plasmid pCR2.1::Nsprsh with EcoR1 and ligate the insert into the broad host range pRK290 to produce the recombinant plasmid pRK290::Nsprsh using T4 DNA ligase.
			<ol>
				<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 10 &#181;g/ml&#8722;1 tetracycline by incubating 37 &#176;C for 24 hr.17</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Preparation of Electro-competent Bacterial Cells to Facilitate Transformation
NOTE: The preparation of electro-competent cells is based on the protocol 26 for 1.0 L of culture that can be scaled down to a smaller volume (i.e., 250 ml). Please note that this protocol can be used to make all the strains competent that are described in this manuscript to facilitate FCA.22
<ol>
	<li>Inoculate 50 ml of liquid medium with a single colony into a flask and grow over night, making sure to check the genotype of the mutant before commencing this step (Table 2).</li>
	<li>On day two, inoculate 1.0 L of the appropriate medium (LB for E. coli mutants and PD for Novosphingobium sp) with the 50 ml of the overnight culture, and grow to an OD600 to 0.4-0.6 (log phase) at 30 &#176;C.</li>
	<li>Harvest cells by centrifuging at 5,000 x g for 15 min at 4 &#176;C, decant the supernatant, and resuspend the pellet in 500 ml of sterile ice-cold pure H2O.</li>
	<li>Centrifuge the cells at 5,000 x g for 20 min at 4 &#176;C, decant the supernatant and resuspend the pellet in 250 ml of sterile ice-cold 10% glycerol.</li>
	<li>Centrifuge the cells at 5,000 x g for 20 min at 4 &#176;C, decant the supernatant, and resuspend the pellet in 2.0 ml of 10% glycerol.</li>
	<li>Aliquot the cells by transferring 50 &#181;l into micro-centrifuge tubes and immediately freeze by placing the tubes in a dry-ice-ethanol bath. Store the competent cells at -80 &#176;C for electroporation.</li>
</ol>
3. Electroporation of Bacterial Cells with Complementation Plasmids
<ol>
	<li>For electroporation, add 1.0 &#181;l (10-50 ng) of recombinant plasmid to an aliquot (50 &#181;l) of competent cells and place on ice for 5 min.</li>
	<li>Transfer the mixture via pipetting to an electroporation cuvette and set the electroporation apparatus to the following setting: 25 &#181;F capacitance, 2.5 kV, and 200 ohm resistance and deliver a pulse.</li>
	<li>Add 1.0 ml of recovery media (LB) to the electroporation cuvette and transfer using a pipette to a 15 ml conical tube. Recover with gentle rotation for 60 min in a shaking incubator.</li>
	<li>Plate 100 &#181;l of the culture from the recovery step onto the agar plates to select for transformants by pipetting and spreading using a sterile spreader. 
	NOTE: Make sure to check Table 1 and Table 2 before commencing this step to check the antibiotics and genotypes to make the proper agar plates.</li>
</ol>
4. Transformation of AOH1 to Facilitate Functional Complementation Using L,L-diaminopimelate Aminotransferase (dapL)
<ol>
	<li>For complementation analysis, transform AOH1 with the empty vector (pBAD33), and with the DapL expression vectors in separate transformation events using the electroporation protocol outlined in section 3.0.</li>
	<li>Select transformants by plating on LB agar medium supplemented with 50 &#181;g/ml&#8722;1 DAP and 34 &#181;g/ml&#8722;1 chloramphenicol and 50 &#181;g/ml&#8722;1 kanamycin.</li>
	<li>Test for functional complementation by replica-plating colonies by streaking onto LB medium with 0.2% (w/v) arabinose with and without 50 &#181;g/ml&#8722;1 DAP and 34 &#181;g/ml&#8722;1 kanamycin.</li>
	<li>Incubate plates at 30 &#176;C for 24 hr and observe results. 
	NOTE: The result should show that the mutant is only able to grow on DAP free media only when the dapL gene is expressed in the mutant background when compared to the vector only control.</li>
</ol>
5. Transformation of TKL-11 to Facilitate Functional Complementation Using UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate Ligase (murE)
<ol>
	<li>Transform the mutant with the empty vector (pBAD33) and with the MurE expressing vector (pBAD33::VsmurE) using the protocol outlined in section 3.0.</li>
	<li>Plate and select transformants on LB agar medium supplemented with 50 &#181;g/ml&#8722;1 thymine and 34 &#181;g/ml&#8722;1 chloramphenicol and incubate the plates at 30 &#176;C for 24 hr.</li>
	<li>Test for complementation by streaking or plating colonies from both the control and the experimental transformations onto two LB medium plus 0.2% (w/v) arabinose and 50 &#181;g/ml&#8722;1 thymine.</li>
	<li>Incubate one plate at 30 &#176;C and the other at 42 &#176;C for 24 hr to visually assess the growth phenotype. 
	NOTE: The results should show that the mutant is able to grow at 42 &#176;C only when the murE gene is expressed in the mutant background compared to the vector only control.</li>
</ol>
6. Transformation of DL39 to Facilitate Functional Complementation Using Tyrosine Aminotransferase (tyrB)
<ol>
	<li>Transform DL39 with either pBAD33 or pBAD33::At5g36160, and select transformants on LB agar plates supplemented with 50 &#181;g/ml&#8722;1 tyrosine, 50 &#181;g/ml&#8722;1 phenylalanine, and 34 &#181;g/ml&#8722;1 chloramphenicol using the protocol outlined in section 3.0.</li>
	<li>Replica-plate colonies on minimal (M9) media with 50 &#181;g/ml&#8722;1 phenylalanine and 50 &#181;g/ml&#8722;1 tyrosine, 50 &#181;g/ml&#8722;1 aspartate, 50 &#181;g/ml&#8722;1 leucine, 50 &#181;g/ml&#8722;1valine, 50 &#181;g/ml&#8722;1 isoleucine, 10 &#181;g/ml&#8722;1 uracil 0.5% (w/v) glycerol, 0.2% (w/v) arabinose. Also replica-plate colonies on plates lacking phenylalanine and tyrosine by streaking the same colony of both plates.</li>
	<li>Incubate plates at 30 &#176;C for 48 hr to observe growth phenotype. 
	NOTE: The result should show that the mutant is only able to grow on phenylalanine and tyrosine free media, only when the tyrB gene is expressed in the mutant background when compared to the vector only control.</li>
</ol>
7. Transformation of Hx699 to Facilitate Functional Complementation of the Hypomucoid Phenotype of Novosphingobium sp. Strain Hx699
<ol>
	<li>Transform wild-type strain Novosphingobium sp. (Rr2-17) and the mutant Hx699 with pRK290 and pRK290::rshNsp in 2 separate transformation events using the transformation protocol outlined in section 3.0.</li>
	<li>Plate the transformations on potato dextrose (PD) agar supplemented with 10 &#181;g/ml&#8722;1 tetracycline, and incubate for at least 24 hr or until transformants appear.</li>
	<li>Streak both transformations in an &#34;X&#34; pattern on fresh PD agar plates and incubate at 30 &#176;C for at least 4 days. Observe the phenotypes of the vector only, and experiment by visually examining the growth phenotype of both plates. 
	NOTE: The result should show that the hypo-mucoid phenotype is complemented when rsh is expressed in the mutant background when compared to the vector only control.</li>
</ol>

<ol>
	<li>Gillum, A. M., Tsay, E. Y., Kirsch, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+the+Candida+albicans+gene+for+orotidine-5'-phosphate+decarboxylase+by+complementation+of+S.+cerevisiae+ura3+and+E.+coli+pyrF+mutations.">Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations.</a> Mol Gen Genet. 198, 179-182 (1984).</li><li>Hudson, A. O., Singh, B. K., Leustek, T., Gilvarg, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+L,L-diaminopimelate+aminotransferase+defines+a+novel+variant+of+the+lysine+biosynthesis+pathway+in+plants.">An L,L-diaminopimelate aminotransferase defines a novel variant of the lysine biosynthesis pathway in plants.</a> Plant Physiol. 140, 292-301 (2006).</li><li>Jander, G., Joshi, V., Last, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspartate-derived+amino+acid+biosynthesis+in+Arabidopsis+thaliana.">Aspartate-derived amino acid biosynthesis in Arabidopsis thaliana.</a> The Arabidopsis Book. , (2009).</li><li>Prabhu, P., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+partial+characterization+of+an+L-Tyrosine+aminotransferase+from+Arabidopsis+thaliana.">Identification and partial characterization of an L-Tyrosine aminotransferase from Arabidopsis thaliana.</a> Biochemistry Research International. , 549572 (2010).</li><li>Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S. V., Machado , M. A., Toth, I., Salmond, G., Foster, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+pathogenic+bacteria+in+molecular+pathology.">Top 10 pathogenic bacteria in molecular pathology.</a> Molecular Plant Pathology. 13, 614-629 (2012).</li><li>McGroty, S. E., Pattaniyil, D. T., Patin, D., Blanot, D., Ravichandran, A. C., Suzuki, H., Dobson, R. C., Savka, M. A., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+Characterization+of+UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:+meso-2,6-diaminopimelate+ligase+(MurE)+from+Verrucomicrobium+spinosum+DSM+4136T.">Biochemical Characterization of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate: meso-2,6-diaminopimelate ligase (MurE) from Verrucomicrobium spinosum DSM 4136T.</a> PLoS ONE. 8 (6), e66458 (2013).</li><li>Hutton, C. A., Perugini, M. A., Gerrard, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+lysine+biosynthesis:+an+evolving+antibiotic+strategy.">Inhibition of lysine biosynthesis: an evolving antibiotic strategy.</a> Mol Biosyst. 3, 458-465 (2007).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical.">(p)ppGpp: still magical.</a> Annu Rev Microbiol. 62, 35-51 (2008).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74, 171-199 (2010).</li><li>Cashel, M., Gentry, D. J., Hernandez, V. J., Vinella, D., Neidhardt, F. C., Curtiss, R., Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., Umbarger, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+stringent+response.">The stringent response.</a> Escherichia coli and Salmonella typhimurium: cellular and molecular biology. , 1458-1496 (1996).</li><li>Chatterji, D., Ojha, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revisiting+the+stringent+response,+ppGpp+and+starvation+signaling.">Revisiting the stringent response, ppGpp and starvation signaling.</a> Curr. Opin. Microbiol. 4, 160-165 (2001).</li><li>Jain, V., Kumar, M., Chatterji, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp:+stringent+response+and+survival.">ppGpp: stringent response and survival.</a> J. Microbiol. 44, 1-10 (2006).</li><li>Kramer, G. F., Baker, J. C., Ames, B. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-UV+stress+in+Salmonella+typhimurium:+4-thiouridine+in+tRNA,+ppGpp,+and+pppGpp+as+components+of+an+adaptive+response.">Near-UV stress in Salmonella typhimurium: 4-thiouridine in tRNA, ppGpp, and pppGpp as components of an adaptive response.</a> J. Bacteriol. 170, 2344-2351 (1988).</li><li>Braeken, K., Moris, M., Daniels, R., Vanderleyden, J., Michiels, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+horizons+for+(p)ppGpp+in+bacterial+and+plant+physiology.">New horizons for (p)ppGpp in bacterial and plant physiology.</a> Trends Microbiol. 14, 45-54 (2006).</li><li>Joseleau-Petit, D., Vinella, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+alarms+and+cell+division+in+Escherichia+coli.">Metabolic alarms and cell division in Escherichia coli.</a> J. Bacteriol. 181, 9-14 (1999).</li><li>Mittenhuber, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+and+evolution+of+genes+encoding+bacterial+(p)+ppGpp+synthetases/hydrolases+(the+Rel,+RelA,+and+SpoT+proteins).">Comparative genomics and evolution of genes encoding bacterial (p) ppGpp synthetases/hydrolases (the Rel, RelA, and SpoT proteins).</a> J. Mol. Microbiol. Biotechnol. 3, 585-600 (2001).</li><li>Gan, H. M., Buckley, L., Szegedi, E., Hudson, A. O., Savka, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+an+rsh+Gene+from+a+Novosphingobium+sp.+Necessary+for+Quorum-Sensing+Signal+Accumulation.">Identification of an rsh Gene from a Novosphingobium sp. Necessary for Quorum-Sensing Signal Accumulation.</a> J. Bacteriol. 191, 2551-2560 (2009).</li><li>Nachar, V. R., Savka, F. C., McGroty, S. E., Donovan, K. A., North, R. A., Dobson, R. C., Buckley, L. J., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+and+biochemical+analysis+of+the+diaminopimelate+and+lysine+biosynthesis+pathway+in+Verrucomicrobium+spinosum:+Identification+and+partial+characterization+of+L,L-diaminopimelate+aminotransferase+and+UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate+ligase.">Genomic and biochemical analysis of the diaminopimelate and lysine biosynthesis pathway in Verrucomicrobium spinosum: Identification and partial characterization of L,L-diaminopimelate aminotransferase and UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate ligase.</a> Front. Microbiol. 3, 183 (2012).</li><li>Hudson, A. O., Gir&#242;n, I., Dobson, R. C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystallization+and+preliminary+X-ray+diffraction+analysis+of+L,L-diaminopimelate+aminotransferase+(DapL)+from+Chlamydomonas+reinhardtii.">Crystallization and preliminary X-ray diffraction analysis of L,L-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii.</a> Acta Cryst. 67, 140-143 (2011).</li><li>Dobson, R. C. J., Gir &#242;n, I., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=L,L-Diaminopimelate+Aminotransferase+from+Chlamydomonas+reinhardtii:+A+Target+for+Algaecide+Development.">L,L-Diaminopimelate Aminotransferase from Chlamydomonas reinhardtii: A Target for Algaecide Development.</a> PLoS ONE. 6 (5), e20439 (2011).</li><li>Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tight+regulation,+modulation,+and+high-level+expression+by+vectors+containing+the+arabinose+pBAD+promoter.">Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter.</a> J. Bacteriol. 177, 4121-4130 (1995).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A laboratory manual. , (2001).</li><li>Lugtenberg, E. J., van Schijndel-van Dam, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature-sensitive+mutants+of+Escherichia+coli+K-12+with+low+activity+of+the+diaminopimelic+acid+adding+enzyme.">Temperature-sensitive mutants of Escherichia coli K-12 with low activity of the diaminopimelic acid adding enzyme.</a> J. Bacteriol. 110, 41-46 (1972).</li><li>Mavrides, C., Orr, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multispecific+aspartate+and+aromatic+amino+acid+aminotransferases+in+Escherichia+coli.">Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli.</a> J. Biol Chem. 250, 4128-4133 (1975).</li><li>Gelfand, D. H., Steinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+mutants+deficient+in+the+aspartate+and+aromatic+amino+acid+aminotransferases.">Escherichia coli mutants deficient in the aspartate and aromatic amino acid aminotransferases.</a> J. Bacteriol. 130, 429-440 (1977).</li><li>Whitaker, R. J., Gaines, C. G., Jensen, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multispecific+quintet+of+aromatic+aminotransferases+that+overlap+different+biochemical+pathways+in+Pseudomonas+aeruginosa.">A multispecific quintet of aromatic aminotransferases that overlap different biochemical pathways in Pseudomonas aeruginosa.</a> J. Biol Chem. 257, 13550-13556 (1982).</li><li>Raskin, D. M., Judson, N., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+stringent+response+in+the+essential+function+if+the+conserved+bacterial+G+protein+CgtA+in+Vibrio+cholera.">Regulation of the stringent response in the essential function if the conserved bacterial G protein CgtA in Vibrio cholera.</a> Proc Natl Acad Sci, USA. 104, 4636-4641 (2007).</li><li>Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+DNA+cloning+system+for+Gram-negative+bacteria:+construction+of+a+gene+bank+of+Rhizobium+meliloti.">Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.</a> Proc Natl Acad Sci, USA. 77, 7347-7351 (1980).</li><li>Watanabe, A., Suzuki, M., Ujiie, S., Gomi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enzymatic+characterization+of+a+novel+&#946;-1,6-glucosidase+from+Aspergillus+oryzae.">Purification and enzymatic characterization of a novel &#946;-1,6-glucosidase from Aspergillus oryzae.</a> J Biosci Bioeng. , (2015).</li><li>Song, J. T., Lu, H., McDowell, J. M., Greenberg, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+key+role+for+ALD1+in+activation+of+local+and+systemic+defenses+in+Arabidopsis.">A key role for ALD1 in activation of local and systemic defenses in Arabidopsis.</a> Plant J. 40, 200-212 (2004).</li><li>Rost, B., Liu, J., Nair, R., Wrzeszczynski, K. P., Ofran, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automatic+prediction+of+protein+function.">Automatic prediction of protein function.</a> Celuular and Molecular Life Sciences. 60, 2637-2650 (2003).</li><li>Norris, S. R., Shen, X., Penna, D. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complementation+of+the+Arabidopsis+pds1+mutation+with+the+gene+encoding+p-Hyrdoxyphenylpyruvate+dioxygenase.">Complementation of the Arabidopsis pds1 mutation with the gene encoding p-Hyrdoxyphenylpyruvate dioxygenase.</a> Plant Physiol. 117, 1317-1323 (1998).</li><li>Mohler, W. A., Blau, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+and+cell+fusion+analyzed+by+lacZ+complementation+in+mammalian+cells.">Gene expression and cell fusion analyzed by lacZ complementation in mammalian cells.</a> Proc Natl Acad Sci, USA. 93, 12423-12427 (1996).</li></ol>

The authors declare that they have no competing financial interests.

Many of the courses that are integral to the Biotechnology and Molecular Bioscience curriculum at the Rochester Institute of Technology have a laboratory component in addition to the lecture portion of the course. The curriculum for the academic year 2014-2015 contains a total of 48 courses, 29 of which contain a laboratory component which represent approximately 60%. One such course is Fundamentals of Plant Biochemistry and Pathology (FPBP), a blended lecture/ laboratory course and Bioseparations: Principles and Practices (BPP), a laboratory based course.
The laboratory component of each course is designed to reinforce the lecture materials. For example, biochemical pathways and metabolism are heavily stressed in FPBP and BPP. Some of the topics include amino acid metabolism, peptidoglycan biosynthesis, plant secondary metabolism, bacterial response to environmental niches, among others. The authors have integrated functional complementation as laboratory exercises in both courses to reinforce the understanding of metabolic pathways that are discussed in the lecture and or pre-laboratory presentations. Four examples of using functional complementation experiment to analyze the function of genes involved in biochemical pathways of lys, PG, tyr, phe and the stringent response of bacteria are discussed.
There are several reasons why the authors have integrated this experimental module into their courses. Firstly, exposure to functional complementation analyses is an excellent tool to reinforce or introduce topics that are related to genetics, evolution, genomics, bioinformatics and biochemistry. Secondly, the experiment is facile and can be accomplished in a course laboratory environment. All of the reagents that are used are safe and the bacteria that are used are denoted as biosafety level 1 and are not pathogenic. As such, the authors are willing to make reagents such as plasmids and bacterial strains available to anyone who is in interested in incorporating functional complementation as a part of their teaching experience. It should be noted that two of the bacterial strains (TKL-11 and DL39) were obtained directly from the Coli Genetic Stock Center (CGSC) (http://cgsc.biology.yale.edu/).
It is important to note that there are several critical steps to the functional complementation protocol. The first step is to make sure that the mutant(s) are able to be cultured before commencing any experiments. The reason is that as per Table 2, there are several genotypes associated with each mutant. In order to grow the mutant to prepare competent cells before the experiment, try growing the mutant with or without the required chemicals and or temperature requirements regarding the PG murE mutant. This is also a teaching moment because it will prove that the mutant is authentic before any experiments.
It should also be noted that although this is an excellent tool to test the function(s) of genes, it does not always work due to several factors such as codon usage where gene(s) of interest cannot be properly translated due to the lack of the appropriate tRNAs in the mutant organism. However, this can be circumvented by codon optimization of the open reading frame or cDNA during the cloning step which is normally done by synthesizing the gene of interest by changing the nucleotides to match the codon usage of the mutant(s). Another issue is that some eukaryotic proteins require post-translational modifications for function. Post translational modification is not a feature of bacteria and as such one might not be able to use this technique to test the function(s) of genes using bacterial mutants.
The significance of the technique that we emphasize in the courses is that FCA is an excellent way to test to function of genes in vivo. Characterization of enzymes are mostly based on in vitro studies where the enzyme is purified and traditional enzymatic assays are performed.29 Also traditional enzymatic assays are great to measure or detect enzymatic activity, one can often &#34;force feed&#34; the enzyme with commercially available substrates that are not pure or natural for the enzyme.30 An in vivo system such as FCA provides a more authentic proof regarding the function of genes given the fact that it is operating under physiological conditions as appose to in vitro which is normally not under physiological conditions.2 Given lack of information regarding the functions of many genes and the fact that most annotations are based on prediction,31 mastering this technique will facilitate experiments to elucidate the functions of many genes that remain nebulous or those that are currently deemed to have putative functions in the various public databases.
One of the issues regarding the technique that is often experienced is in the preparation of the competent cells. One should make sure that the cells are prepared correctly to ensure that there is enough cells to be transformed in addition to making sure the cells are washed properly with water and glycerol to prevent arching during the electroporation process. One should also be cognizant of the phenotype of the mutant by making sure that the cells are grown with the appropriate chemical or at the proper temperature to facilitate both the initial growth of the mutant and also for the functional complementation analysis.
Once this technique is mastered, researchers can use functional complementation assay to assess the function of genes as long as there is an appropriate mutation in an organism available to facilitate this analysis. Please note that the protocol in this manuscript describes the use of bacteria. However, other organisms such as plants and mammalian cells, among others, can be used to assess the function of genes.32-33 One would just have to make sure that the proper vectors are used in addition to optimizing the transforming and or transfection of the cells to facilitate the experiment.

Functional complementation in the context of elucidating the function(s)/role(s) of a gene is defined as the ability of a particular homologous or orthologous gene to restore a particular mutant with an observable phenotype to the wild-type state when the homologous or orthologous gene is introduced in cis or trans into the mutant background. This technique has been widely used to isolate and identify the function(s)/role(s) of many genes. One particular example is the isolation and identification of orotidine-5-phosphate decarboxylase from Candida albicans using the ura3 mutant of S. cerevisiae and the pyrF mutant of E. coli.1 The authors have used this technique to elucidate the function of genes that are involved in the metabolism of amino acids, peptidoglycan and the stringent response in their research programs and have incorporated this technique into their teaching programs in the Biotechnology and Molecular Bioscience (BMB) program at the Rochester Institute of Technology (RIT).
The authors teach Fundamentals of Plant Biochemistry/Pathology (FPBP) (Hudson) and Bioseparations: Principles and Practices (BPP) (Hudson/Savka), two upper division elective laboratory based courses in the BMB Program at the RIT. Since some of the topics that are discussed in the courses are affiliated with their research interests, the authors have incorporated many of the techniques and experimental tools that are used in their respective research programs into these two laboratory-based courses. One such example is functional complementation as a laboratory exercise to reinforce the lecture materials pertaining to amino acid metabolism from plants, peptidoglycan and the stringent response metabolism from bacteria.
Three of the amino acid pathways from plants that are discussed in the FPBB course are that of lysine (lys), tyrosine (tyr) and phenylalanine (phe). The lys pathway is highlighted in the course because of the importance of the amino acid as an essential amino acid for all animals particularly humans since animals lack the genetic machinery to synthesize lys de novo. In addition, it was recently discovered that plants employ a pathway for the synthesis of lys that is significantly different from that of bacteria. This discovery was partially facilitated by functional complementation of the E. coli diaminopimelate (dap) mutants using a gene that encodes the enzyme L,L-diaminopimelate aminotransferase (DapL) from the model plant Arabidopsis thaliana.2 The variant pathways for the synthesis of lys through the intermediate diaminopimelate are shown in Figure 1. In addition, the synthesis of lys facilitates through the aspartate derived family of amino acids which is highly regulated.3 In addition to their importance in protein synthesis, the pathways for tyr and phe are highlighted given their importance in serving as precursor compounds for the anabolism of phenylpropanoid compounds involved the synthesis of plant defense compounds such as: alkaloids, lignins, flavonoids, isoflavonoids, hydroxycinnamic acid among others.4 The tyr and phe pathways are also highlighted to show the difference between the plant and bacterial anabolic pathways. In bacteria, the enzyme tyrosine aminotransferase (TyrB) is involved in the anabolism of both amino acids, whereas in plants, the enzyme is primarily involved in the catabolism of tyr and phe and is not involved in the anabolism of these amino acids. (Figure 2).4
The differences between Gram positive and Gram negative bacteria regarding the structure of peptidoglycan (PG) are highlighted in the FPBP course. The PG of Gram negative bacteria is of interest regarding plant pathology based on to the fact that most plant pathogens are Gram negative. A recent review regarding the top 10 bacterial phyto-pathogens revealed that all are Gram negative. The bacteria were from the genera: Pseudomonas, Ralstonia, Agrobacterium, Xanthomonas, Erwinia, Xylella, Dickeya and Pectobacterium.5 One of the chemical differences when comparing the PG stem of Gram negative and Gram positive bacteria is the difference between the cross-linking amino acids of both types. The initial step for that different cross-linking of PG occurs in the cytoplasmic step of PG anabolism and is facilitated by the enzyme UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (MurE) (Figure 3A). MurE catalyzes the addition of a particular diamine compound at third position of the peptide stem.6 In most Gram negative bacteria, the penultimate lys precursor, meso-diaminopimelate (m-DAP) serves as the cross-linking amino acid and lys serves the same role in the PG of most Gram positive bacteria (Figure 3B).7 This is due to the fact that both m-DAP and lys possess two amine groups and are capable of forming two peptide bonds for peptide stem cross-linking.
In the Bioseparations: Principles and Practices (BPP) course, the differences between open and closed systems for the cultivation of bacteria and how nutrient levels will change significantly in both systems due to environmental changes are discussed. These events are linked to regulatory changes called a &#34;shift down&#34; or &#34;shift up&#34; triggered by starvation or an adequate supply of amino acids or energy. The &#34;shift down&#34; response can occur when a bacterial culture is transferred from a rich and complex medium to a chemically defined medium with a single carbon source. This change in environment leads to the rapid cessation of tRNA and rRNA synthesis. This cessation results in the lack of ribosomes, protein and DNA synthesis even though the biosynthesis of amino acids are upregulated.
Following the &#34;shift down&#34; response, the existing ribosomes are used to produce new enzymes to synthesize the amino acids no longer available in the medium or environment. After a period of time, rRNA synthesis and new ribosomes are assembled and the population of bacterial cells begins to grow although at a reduced rate. The course of events is termed the &#34;stringent response&#34; or &#34;stringent control&#34; and is an example of global cellular regulation and can be thought of as a mechanism for adjusting the cell&#39;s biosynthetic machinery to compensate for the availability of the required substrates and energy needs.8 The stringent response thus enables bacteria to respond rapidly to fluxes of nutrients in the environment and contributes and enhances the ability of bacteria to compete in environments that can change rapidly with regards to nutrient and or substrate availability.8-9 
The stringent response has an integral role in gene expression when the availability of amino acids, carbon, nitrogen, phosphate, and fatty acids are limited.8,10-14 This stringent response is coordinated by two nucleotides, guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) commonly referred together as the alarmone (p)ppGpp. For example, when amino acids are limited-which can lead to a bottleneck in protein synthesis-the alarmone, guanosine 3,5-(bis) pyrophosphate (ppGpp), derived from anabolism of guanosine 3-diphosphate 5-triphosphate (pppGpp) accumulates in the cell. The change in (p)ppGpp level is involved in expression of genes that regulate the response to overcome the lack of substrates in the environment that are directly involved in cell growth and development. Two of the genes that are involved in this process are called relA and spoT. RelA is a ribosome-associated (p)ppGpp synthetase that is involved in the response to the accumulation of uncharged tRNAs that is the result of amino acid limitation. SpoT functions as a bifunctional (p)ppGpp synthetase and hydrolase. The synthetase activity of SpoT is involved in the response to the lack of carbon and fatty acid starvation.8 The RelA/SpoT homologs are widespread in plants and bacteria and are referred to as Rsh for RelA/SpoT homologs.8,10-12,16 A recent manuscript showed that there is a specific Rsh protein involved in the synthesis of these alarmones from the bacterium Novosphingobium sp Rr 2-17.17
Here we present four biochemical pathways tethered to the functional complementation assays. The complementation assays outlined in this manuscript provides an avenue to explore employing this in vivo assay as a means of identifying and or characterizing enzymes that are predicted to have unknown/putative function(s) or as teaching tools to supplement the teaching of biochemical pathways.

<table><tbody><tr><td>&lt;em&gt;E. coli&lt;/em&gt; mutants</td><td>Hudson/Savka lab or CGSC (http://cgsc.biology.yale.edu/)</td><td></td><td></td></tr><tr><td>Electroporator</td><td>Biorad-USA</td><td>1652100</td><td></td></tr><tr><td>Electroporation Cuvettes</td><td>Biorad-USA</td><td>1652082</td><td></td></tr><tr><td>Temperature controlled incubator</td><td>Generic</td><td></td><td></td></tr><tr><td>Microcentrifuge</td><td>Generic</td><td></td><td></td></tr><tr><td>Luria Agar</td><td>Thermofisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Luria Broth</td><td>Thermofisher Scientific</td><td>12795084</td><td></td></tr><tr><td>M9 Medium</td><td>Sigma-Aldrich</td><td>63011</td><td></td></tr><tr><td>Potato Dextrose Medium</td><td>Fisher Scientfic&amp;nbsp;</td><td>DF0013-15-8</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma-Aldrich</td><td>K1377</td><td></td></tr><tr><td>Diaminopimelate</td><td>Sigma-Aldrich</td><td>92591</td><td></td></tr><tr><td>Thymine</td><td>Sigma-Aldrich</td><td>T0376</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Tyrosine</td><td>Sigma-Aldrich</td><td>T3754</td><td></td></tr><tr><td>Phenlylalanine</td><td>Sigma-Aldrich</td><td>P2126</td><td></td></tr><tr><td>Aspartate</td><td>Sigma-Aldrich</td><td>A9256</td><td></td></tr><tr><td>Valine</td><td>Sigma-Aldrich</td><td>V0500</td><td></td></tr><tr><td>Leucine</td><td>Sigma-Aldrich</td><td>L8000</td><td></td></tr><tr><td>Isoleucine</td><td>Sigma-Aldrich</td><td>I2752</td><td></td></tr><tr><td>Uracil</td><td>Sigma-Aldrich</td><td>U0750</td><td></td></tr><tr><td>Gylcerol</td><td>Sigma-Aldrich</td><td>G5516</td><td></td></tr><tr><td>Arabinose</td><td>Sigma-Aldrich</td><td>A3256</td><td></td></tr><tr><td>Tetracyline</td><td>Sigma-Aldrich</td><td>87128</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>Thermofisher Scientific</td><td>10342-020</td><td></td></tr><tr><td>Platinum pfx DNA polymerase</td><td>Thermofisher Scientific</td><td>11708-013</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Thermofisher Scientific</td><td>15224-041</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Dh5-alpha</td><td>Thermofisher Scientific</td><td>18258012</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Top10</td><td>Thermofisher Scientific</td><td>C4040-03</td><td></td></tr><tr><td>pET100D/topo vector</td><td>Thermofisher Scientific</td><td>K100-01</td><td></td></tr><tr><td>pCR2.1 Vector</td><td>Thermofisher Scientific</td><td>K2030-01</td><td></td></tr></tbody></table>

functional complementation analysis (fca): a laboratory exercise designed and implemented to supplement the teaching of biochemical pathways

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very common in biochemistry, genetics and many other disciplines. A comprehensive overview of the technique to supplement the teaching of biochemical pathways pertaining to amino acids, peptidoglycan and the bacterial stringent response is reported in this manuscript. Two cDNAs from the model plant organism Arabidopsis thaliana that are involved in the metabolism of lysine (L,L-diaminopimelate aminotransferase (dapL) and tyrosine aminotransferase (tyrB) involved in the metabolism of tyrosine and phenylalanine are highlighted. In addition, the bacterial peptidoglycan anabolic pathway is highlighted through the analysis of the UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (murE) gene from the bacterium Verrucomicrobium spinosum involved in the cross-linking of peptidoglycan. The bacterial stringent response is also reported through the analysis of the rsh (relA/spoT homolog) bifunctional gene responsible for a hyper-mucoid phenotype in the bacterium Novosphingobium sp. Four examples of FCA are presented. The video will focus on three of them, namely lysine, peptidoglycan and the stringent response.

The bacterial strains that are employed in the various functional complementation analyses are listed in Table 2.
Functional complementation analysis: L,L-diaminopimelate aminotransferase (dapL)
The E. coli double mutant AOH1 (&#916;dapD::Kan2, dapE6) harbors a mutation in the dapE gene and a complete deletion of the dapD gene (Figure 1). As such, the mutant is unable to grow unless DAP is provided. Due to these mutations, AOH1 is deemed auxotrophic. AOH1 is suitable for functional complementation analysis of L,L-diaminopimelate aminotransferase (DapL) orthologs as DapL catalyzes the synthesis of L,L-diaminopimelate directly from THDP to facilitate PG and lys synthesis (Figure 1).
The results from the experiment should show that only AOH1 mutant expressing DapLs are able to grow on L,L-DAP-free media demonstrating that the recombinant enzymes are able to convert THDP to L,L-DAP circumventing the DapD and DapE enzymatic steps in the DAP/lys pathway (Figure 5).
Functional complementation analysis: UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (murE)
meso-diaminopimelate (m-DAP) is the cross-linking amino acid in the PG of Gram-negative bacteria. The enzyme UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate ligase (MurE) facilitates the addition of m-DAP in this process (Figure 3A-B). The E. coli mutant TKL-11 harbors a mutation in the murE gene which results in the ability of the mutant to grow at 42 &#176;C due to the fact that the mutated enzyme is not able to fold properly at this temperature.
The results will demonstrate that there is growth at the permissive temperature of 30 &#176;C by both the control and the experiment. However, only the cells expressing MurE (experiment) will be able to grow at the non-permissive temperature of 42 &#176;C (Figure 6).
Functional complementation analysis: Tyrosine aminotransferase (tyrB)
Arabidopsis thaliana encodes a tyrosine aminotransferase that is able to interconvert tyrosine and 4-hydroxyphenylpyruvate, and phenylalanine and phenylpyruvate annotated by the At5g36160 (Figure 2).4 The E. coli mutant (DL39) harbors a mutation in the tyrB gene which makes auxotrophic for phenylalanine and tyrosine.24-26 It should be noted that the mutant is auxotrophic for the amino acids tyrosine, phenylalanine, aspartate, leucine, isoleucine and valine, as well due to other mutations. The strain is suitable to assess the function of tyrB orthologs since the TyrB enzyme ortholog from E. coli is directly involved in the synthesis of tyrosine and phenylalanine to facilitate protein synthesis.
The result should show that while the DL39 mutant is able to grow on M9 only when tyrosine and phenylalanine are provided. However, the strain expressing the A. thaliana (At5g36160) is able to grow on M9 media lacking tyrosine and phenylalanine demonstrating that the enzyme is able to synthesize tyrosine from 4-hydroxyphenylpyruvate, and phenylalanine from phenylpyruvate t (Figure 7).4
Functional complementation analysis: Rsh (RelA and SpoT homolog)
The Rsh protein from Novosphingobium sp. (Rr2-17) contains both the N-terminal phosphohydrolase and the (p)ppGpp synthase domains, and thus has the proposed bifunctional role like SpoT of E. coli. This has been confirmed using complementation analysis of an E. coli double mutant, CF1693 which harbors mutation in relA and spoT using the rsh gene from Novosphingobium sp. The phenotype of the Rr2-17 rsh mutant, named Hx699 (rsh::EZ-Tn5, KanR), results in a hypo-mucoid and this is due to a non-functional rsh. The hypo-mucoid phenotype of Hx699 was assessed by complementation facilitated by the native rshNsp gene that was cloned into the broad-host range vector pRK290. Consistent with the hypo-mucoid phenotype, the Hx699 harboring empty vector pRK290 show less soluble polysaccharide of that produced by the trans-complemented Hx699 (pRK290::rshNsp) and Rr2-17 containing pRK290 or pRK290::rshNsp (Figure 8).
<img alt="Figure 1" src="/files/ftp_upload/53850/53850fig1.jpg" />
Figure 1: The variants of the lysine anabolic pathways from aspartate that proceed through the intermediate diaminopimelate (DAP). The pathways are annotated by (A) the acyl pathways, (B) the diaminopimelate dehydrogenase (Ddh) pathway and (C) the L,L-diaminopimelate aminotransferase (DapL) pathway. The abbreviation definitions for the enzymes are as follows: aspartate kinase (LysC), aspartate semialdehyde dehydrogenase (asd), tetrahydrodipicolinate synthase (DapA), tetrahydrodipicolinate reductase (DapB), tetrahydrodipicolinate acylase (DapD), N-acyl-2-amino-6-ketopimelate aminotransferase (DapC), N-acyl-L,L-2,6-diaminopimelate deacylase (DapE), diaminopimelate epimerase (DapF), meso-diaminopimelate dehydrogenase (Ddh), meso-diaminopimelate decarboxylase (LysA), L,L-diaminopimelate aminotransferase (DapL), UDP-N-acetylmuramoyl-L-alanyl-d-glutamate:meso-2,6-diaminopimelate ligase (MurE) and lysyl-tRNA synthetase (LysU). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53850/53850fig2.jpg" />
Figure 2: Anabolic pathways for the amino acids tyrosine and phenylalanine. (A) The bacterial (E. coli) pathway through the intermediate chorismate and (B) the plant pathway through the intermediate arogenate. The abbreviations for the enzymes are as follows: chorismate mutase/prephenate dehydratase (PheA), chorismate mutase, prephenate dehydrogenase (TyrA), and tyrosine aminotransferase (TyrB). The diagram was adopted and modified form Prabhu and Hudson, 2010.4 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53850/53850fig3.jpg" />
Figure 3: The cytoplasmic step of peptidoglycan synthesis. (A) Schematic representation of the cytoplasmic step of peptidoglycan synthesis. The abbreviations of the enzymes are as follows: UDP-N-acetylglucosamine enolpyruvyl transferase (MurA), UDP-N-acetylenolpyruvoylglucosaminereductase (MurB), UDP-N-acetylmuramate-L-alanine ligase (MurC), UDP-N-acetyl-muramoylalanine-D-glutamate ligase (MurD), UDP-N-acetylmuramoyl-L-alanyl-d-glutamate 2,6-meso-diaminopimelate ligase (MurE), UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase (MurF), D-alanine-D-alanine ligase (Ddl). (B) Schematic representation of a monomeric unit of peptidoglycan showing the disaccharide N-acetylglucosamine (GlcNAc) and N-acetylmuramic (MurNAc) linked via a &#946;-1,4 glycosidic bond. The amino acid at position 3 of the stem peptide is involved in cross-linking denote by meso-diaminopimelate (m-DAP) in most Gram-negative bacteria and lys in most Gram-positive bacteria. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53850/53850fig4.jpg" />
Figure 4: Schematic model representation of the stringent response in bacteria. Exposure to a nutrient poor environment induces Rsh (RelA or SpoT) to anabolize the alarmone (p)ppGpp (guanosine pentaphosphate) by adding a phosphate group to GTP (guanosine triphosphate). Exposure to a nutrient rich environment induces the expression of Rsh to hydrolyze (p)ppGpp which is a growth inhibitor. The diagram was adopted and modified from Raskin et al., 2007.27 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53850/53850fig5.jpg" />
Figure 5: Functional complementation using DapL. Functional complementation of the AOH1E. coli mutant with L,L-diaminopimelate aminotransferase (dapL) gene from the bacteria V. spinosum (VsdapL), the plant A. thaliana (AtdapL) and the alga, C. reinhardtii (CrdapL). The mutant harboring the plasmids, pBAD33, pBAD33::VsDapL, pBAD33::AtdapL and pBAD33::CrdapL were replica-plated on LB agar plates supplemented with 0.2% (w/v) arabinose with or without 50 &#181;g/ml L,L-diaminopimelate and were grown at 30 &#176;C for 24 hr. The diagram was adopted and modified from Nachar et al., 2012.18 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53850/53850fig6.jpg" />
Figure 6: Functional complementation using MurE. Functional complementation of the TKL-11 E. coli mutant with the UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (murE) gene from V. spinosum. The mutant harboring the plasmids BAD33 or pBAD33::VsmurE were grown in LB medium to an OD600 of 0.1 and were serially diluted to 10-1, 10-2, and 10-3 using 0.85% (w/v) saline. 5 &#181;l of various dilutions were replica-plated on LB medium supplemented with 0.2% (w/v) arabinose and were grown assessed at 30 &#176;C and 42 &#176;C for 24 hr. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" src="/files/ftp_upload/53850/53850fig7.jpg" />
Figure 7: Functional complementation of the DL39E. coli with a tyrosine aminotransferase gene annotated by the locus tag At5g36160 from A. thaliana. The mutant harboring plasmids pBAD33 or pBAD33::At5g36160 were selected on LB agar plates supplemented with 50 &#181;g/ml-1 tyrosine, 50 &#181;g/ml-1 phenylalanine, and 34 &#181;g/ml-1 chloramphenicol. The strain was grown in LB broth to an OD OD600 of 1.0 and were serially diluted to 10-1, 10-2, and 10-3 using 0.85% (w/v) saline. 5 &#181;l of the various dilutions were then replica-plated onto M9 agar plates supplemented with 50 &#181;g/ml-1 phenylalanine and 50 &#181;g/ml-1 tyrosine, 0.5% (w/v) glycerol, 0.2% (w/v) arabinose, 50 &#181;g/ml-1 aspartate, 50 &#181;g/ml-1 leucine, 50 &#181;g/ml-1 valine, 50 &#181;g/ml-1 isoleucine, 10 &#181;g/ml-1 uracil, and also on plates lacking phenylalanine and tyrosine and were incubated at 30 &#176;C for 48 hr. The diagram was adopted and modified form Prabhu and Hudson, 2010.4 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" src="/files/ftp_upload/53850/53850fig8.jpg" />
Figure 8: Functional complementation of the hypomucoid phenotype of the Novosphingobium sp. mutant strain Hx699. The wild-type strain Novosphingobium sp. (Rr2-17) and the mutant strain Hx699 were transformed with pRK290 or pRK290::rshNsp. The strains were streaked in an &#34;X&#34; and were further grown on PD agar at 30 &#176;C for at least 4 days to observe the phenotypes. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53850/53850fig8large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Complementation plasmids</td>
			<td>Antibiotic resistance markers</td>
			<td>Citation</td>
		</tr>
		<tr>
			<td>pBAD33</td>
			<td>Cmr</td>
			<td>21</td>
		</tr>
		<tr>
			<td>pBAD33::AtdapL</td>
			<td>Cmr</td>
			<td>2</td>
		</tr>
		<tr>
			<td>pBAD33::CrdapL</td>
			<td>Cmr</td>
			<td>20</td>
		</tr>
		<tr>
			<td>pBAD33::VsdapL</td>
			<td>Cmr</td>
			<td>18</td>
		</tr>
		<tr>
			<td>pBAD33::At5g36160</td>
			<td>Cmr</td>
			<td>4</td>
		</tr>
		<tr>
			<td>pBAD33::VsmurE</td>
			<td>Cmr</td>
			<td>18</td>
		</tr>
		<tr>
			<td>pRK290</td>
			<td>Tetr</td>
			<td>28</td>
		</tr>
		<tr>
			<td>pRK290::rshNsp</td>
			<td>Tetr</td>
			<td>17</td>
		</tr>
	</tbody>
</table>
Table 1: Functional complementation plasmid used in this study. List of plasmids used for functional complementation analysis. CmR and TetR denote chloramphenicol and tetracycline resistance respectively.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Strain name</td>
			<td>Organism</td>
			<td>Genotype</td>
			<td>Phenotype</td>
			<td>Source</td>
		</tr>
		<tr>
			<td>AOH1</td>
			<td>E. coli</td>
			<td>&#916;dapD::Kan2, dapE6</td>
			<td>Auxotrophic for diaminopimelate</td>
			<td>Hudson Laboratory</td>
		</tr>
		<tr>
			<td>TKL-11*</td>
			<td>E. coli</td>
			<td>thr-1, leuB6 (Am), murE1, fhuA21, codA1, lacY1, tsx-95, glnV44 (AS), &#955;&#8722;, pyrF101, his-108, thyA6, argG66, ilvA634, thi-1, deoC1</td>
			<td>Growth sensitive phenotype were the mutant grows at 30 &#176;C but not a 42 &#176;C</td>
			<td>CGSC (#5989)</td>
		</tr>
		<tr>
			<td>DL39*</td>
			<td>E. coli</td>
			<td>LAM-, aspC13, fnr-25, &#160;rph-1 ilvE12, tyrB507</td>
			<td>Auxotrophic for the amino acids;&#160; tyrosine, phenylalanine, leucine, isoleucine and valine</td>
			<td>CGSC (#6913)</td>
		</tr>
		<tr>
			<td>Rr2-17</td>
			<td>Novosphingobium sp. (wild-type)</td>
			<td>-</td>
			<td>Hyper-mucoid</td>
			<td>Savka Laboratory</td>
		</tr>
		<tr>
			<td>Hx699</td>
			<td>Novosphingobium sp.</td>
			<td>rsh::EZ-Tn5, KanR</td>
			<td>Hypo-mucoid</td>
			<td>Savka Laboratory</td>
		</tr>
	</tbody>
</table>
Table 2: Bacterial strains used in this study. List of bacterial strains along with respective genotypes and phenotypes used in this study. Please note that strains (TKL-11 and DL39) denoted by the asterisk can be obtained directly from the Coli Genetic Stock Center (CGSC) (http://cgsc.biology.yale.edu/).

Watch this Scientific Journal Video about Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways at JoVE.com

Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

The validation of enzymatic activities involved in biochemical pathways can be elucidated using functional complementation analysis (FCA). Described in this manuscript is the FCA assay demonstrating the enzymatic activity of enzymes involved in the metabolism of amino acids, bacterial stringent response and bacterial peptidoglycan biosynthesis.

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very ...

functional-complementation-analysis-fca-laboratory-exercise-designed

Universidad San Sebastian

Research

JoVE Journal

Biology

17.6K Views.  Rochester Institute of Technology. The validation of enzymatic activities involved in biochemical pathways can be elucidated using functional complementation analysis (FCA). Described in this manuscript is the FCA assay demonstrating the enzymatic activity of enzymes involved in the metabolism of amino acids, bacterial stringent response and bacterial peptidoglycan biosynthesis.

Video: Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Bimolecular Fluorescence Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as immunoprecipitation do not provide information on the spatial localization of complexes. In contrast, BiFC monitors the interaction and subcellular compartmentalization of protein complexes. In this method, a fluororescent protein is split into amino- and carboxy-terminal non-fluorescent fragments which are then fused to two proteins of interest. Interaction of the proteins results in reconstitution of the fluorophore (Figure 1)1,2. A limitation of BiFC is that once the fragmented fluorophore is reconstituted the complex is irreversible3. This limitation is advantageous in detecting transient or weak interactions, but precludes a kinetic analysis of complex dynamics. An additional caveat is that the reconstituted flourophore requires 30min to mature and fluoresce, again precluding the observation of real time interactions4. BiFC is a specific example of the protein fragment complementation assay (PCA) which employs reporter proteins such as green fluorescent protein variants (BiFC), dihydrofolate reductase, b-lactamase, and luciferase to measure protein:protein interactions5,6. Alternative methods to study protein:protein interactions in cells include fluorescence co-localization and F&ouml;rster resonance energy transfer (FRET)7. For co-localization, two proteins are individually tagged either directly with a fluorophore or by indirect immunofluorescence. However, this approach leads to high background of non-interacting proteins making it difficult to interpret co-localization data. In addition, due to the limits of resolution of confocal microscopy, two proteins may appear co-localized without necessarily interacting. With BiFC, fluorescence is only observed when the two proteins of interest interact. FRET is another excellent method for studying protein:protein interactions, but can be technically challenging. FRET experiments require the donor and acceptor to be of similar brightness and stoichiometry in the cell. In addition, one must account for bleed through of the donor into the acceptor channel and vice versa. Unlike FRET, BiFC has little background fluorescence, little post processing of image data, does not require high overexpression, and can detect weak or transient interactions. Bioluminescence resonance energy transfer (BRET) is a method similar to FRET except the donor is an enzyme (e.g. luciferase) that catalyzes a substrate to become bioluminescent thereby exciting an acceptor. BRET lacks the technical problems of bleed through and high background fluorescence but lacks the ability to provide spatial information due to the lack of substrate localization to specific compartments8. Overall, BiFC is an excellent method for visualizing subcellular localization of protein complexes to gain insight into compartmentalized signaling.

The subcellular localization of proteins is important in determining the spatio-temporal regulation of cell signaling. Here, we describe bimolecular fluorescence complementation (BiFC) as a straightforward method for monitoring the spatial interactions of proteins in the cell.

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as ...

Implementing Gibson Assembly to Enhance Molecular Biology Education and Skills

Improving Student Outcomes with an Adaptable Molecular Cloning Course-Based Undergraduate Research Experience

The continuous advancement of molecular biology techniques requires that molecular biology curricula are&#160;regularly refined to effectively prepare students to enter the workforce with modern competencies. In particular, the emergence of Gibson Assembly, a highly customizable and adaptive molecular cloning technique, has advanced the landscape of molecular cloning in numerous research environments. Thus, we created a Gibson Assembly cloning module for deployment in a molecular biology laboratory course at California Polytechnic State University, San Luis Obispo and evaluated student learning outcomes from the module. Over three iterations of the course, students participated in an experiment-based independent project that involved cloning three unique plasmid libraries to support research projects in natural products biosynthesis. Students were given pre- and post-questionnaires to evaluate their understanding of molecular cloning and their confidence in molecular biology terms and techniques. Students&#8217; responses showed a significant increase in both learning molecular cloning concepts and in self-reported confidence with molecular cloning terms and techniques. This module framework can be generalized to teach Gibson Assembly for various applications, providing instructors with a toolkit for teaching an adaptable and emergent cloning technology while advancing their research projects.

An adaptable Gibson Assembly molecular cloning module was employed in a course-based undergraduate research experience (CURE) format for molecular biology laboratory course students. Assessment of student learning outcomes showed improved understanding and confidence in molecular cloning after completion of the CURE, and novel plasmids were cloned for natural product biosynthesis research.&#160;&#160;

The continuous advancement of molecular biology techniques requires that molecular biology curricula are&#160;regularly refined to effectively prepare ...

Biochemistry

Annotation of Plant Gene Function via Combined Genomics, Metabolomics and Informatics

Given the ever expanding number of model plant species for which complete genome sequences are available and the abundance of bio-resources such as knockout mutants, wild accessions and advanced breeding populations, there is a rising burden for gene functional annotation. In this protocol, annotation of plant gene function using combined co-expression gene analysis, metabolomics and informatics is provided (Figure 1). This approach is based on the theory of using target genes of known function to allow the identification of non-annotated genes likely to be involved in a certain metabolic process, with the identification of target compounds via metabolomics. Strategies are put forward for applying this information on populations generated by both forward and reverse genetics approaches in spite of none of these are effortless. By corollary this approach can also be used as an approach to characterise unknown peaks representing new or specific secondary metabolites in the limited tissues, plant species or stress treatment, which is currently the important trial to understanding plant metabolism.

Combination of genomics, co-expression gene analysis and the identification of target compounds via metabolism give gene functional annotation.

Given the ever expanding number of model plant species for which complete genome sequences are available and the abundance of bio-resources such as ...

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine cell central metabolism and discover new enzymes is 13C-assisted metabolism analysis 1. This technique is based on isotopic labeling, whereby microbes are fed with a 13C labeled substrates. By tracing the atom transition paths between metabolites in the biochemical network, we can determine functional pathways and discover new enzymes. 
As a complementary method to transcriptomics and proteomics, approaches for isotopomer-assisted analysis of metabolic pathways contain three major steps 2. First, we grow cells with 13C labeled substrates. In this step, the composition of the medium and the selection of labeled substrates are two key factors. To avoid measurement noises from non-labeled carbon in nutrient supplements, a minimal medium with a sole carbon source is required. Further, the choice of a labeled substrate is based on how effectively it will elucidate the pathway being analyzed. Because novel enzymes often involve different reaction stereochemistry or intermediate products, in general, singly labeled carbon substrates are more informative for detection of novel pathways than uniformly labeled ones for detection of novel pathways3, 4. Second, we analyze amino acid labeling patterns using GC-MS. Amino acids are abundant in protein and thus can be obtained from biomass hydrolysis. Amino acids can be derivatized by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (TBDMS) before GC separation. TBDMS derivatized amino acids can be fragmented by MS and result in different arrays of fragments. Based on the mass to charge (m/z) ratio of fragmented and unfragmented amino acids, we can deduce the possible labeled patterns of the central metabolites that are precursors of the amino acids. Third, we trace 13C carbon transitions in the proposed pathways and, based on the isotopomer data, confirm whether these pathways are active 2. Measurement of amino acids provides isotopic labeling information about eight crucial precursor metabolites in the central metabolism. These metabolic key nodes can reflect the functions of associated central pathways.
13C-assisted metabolism analysis via proteinogenic amino acids can be widely used for functional characterization of poorly-characterized microbial metabolism1. In this protocol, we will use Cyanothece 51142 as the model strain to demonstrate the use of labeled carbon substrates for discovering new enzymatic functions.

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

13C-isotope labeling is a useful technique for determining the cell central metabolism for various types of microorganisms. After cells have been cultured with a specific labeled substrate, GC-MS measurement can reveal functional metabolic pathways based on unique labeling patterns in proteinogenic amino acids.

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine ...

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

A Web Tool for Generating High Quality Machine-readable Biological Pathways

PathWhiz is a web server built to facilitate the creation of colorful, interactive, visually pleasing pathway diagrams that are rich in biological information. The pathways generated by this online application are machine-readable and fully compatible with essentially all web-browsers and computer operating systems. It uses a specially developed, web-enabled pathway drawing interface that permits the selection and placement of different combinations of pre-drawn biological or biochemical entities to depict reactions, interactions, transport processes and binding events. This palette of entities consists of chemical compounds, proteins, nucleic acids, cellular membranes, subcellular structures, tissues, and organs. All of the visual elements in it can be interactively adjusted and customized. Furthermore, because this tool is a web server, all pathways and pathway elements are publicly accessible. This kind of pathway &#34;crowd sourcing&#34; means that PathWhiz already contains a large and rapidly growing collection of previously drawn pathways and pathway elements. Here we describe a protocol for the quick and easy creation of new pathways and the alteration of existing pathways. To further facilitate pathway editing and creation, the tool contains replication and propagation functions. The replication function allows existing pathways to be used as templates to create or edit new pathways. The propagation function allows one to take an existing pathway and automatically propagate it across different species. Pathways created with this tool can be &#34;re-styled&#34; into different formats (KEGG-like or text-book like), colored with different backgrounds, exported to BioPAX, SBGN-ML, SBML, or PWML data exchange formats, and downloaded as PNG or SVG images. The pathways can easily be incorporated into online databases, integrated into presentations, posters or publications, or used exclusively for online visualization and exploration. This protocol has been successfully applied to generate over 2,000 pathway diagrams, which are now found in many online databases including HMDB, DrugBank, SMPDB, and ECMDB.

PathWhiz is a comprehensive, online pathway drawing tool for generating biochemical and biological pathways. It uses publicly accessible databases and easily expandable palettes consisting of pre-drawn pathway components. This protocol describes how to easily build new pathways, replicate and edit existing pathways, and propagate previously drawn pathways to different organisms.

PathWhiz is a web server built to facilitate the creation of colorful, interactive, visually pleasing pathway diagrams that are rich in biological ...

High-Throughput Metabolic Profiling for Model Refinements of Microalgae

Metabolic models are reconstructed based on an organism&#39;s available genome annotation and provide predictive tools to study metabolic processes at a systems-level. Genome-scale metabolic models may include gaps as well as reactions that are unverified experimentally. Reconstructed models of newly isolated microalgal species will result in weaknesses due to these gaps, as there is usually sparse biochemical evidence available for the metabolism of such isolates. The phenotype microarray (PM) technology is an effective, high-throughput method that functionally determines cellular metabolic activities&#160;in response to a wide array of entry metabolites. Combining the high throughput phenotypic assays with metabolic modeling can allow existing metabolic network models to be rapidly reconstructed or optimized by providing biochemical evidence to support and expand genomic evidence. This work will show the use of PM assays for the study of microalgae by using the green microalgal model species Chlamydomonas reinhardtii as an example. Experimental evidence for over 254 reactions obtained by PM was used in this study to expand and refine a genome-scale C. reinhardtii metabolic network model, iRC1080, by approximately 25 percent. The protocol created here can be used as a basis for functionally profiling the metabolism of other microalgae, including known microalgae mutants and new isolates.

This protocol demonstrates the use of a phenotype microarray (PM) technology platform to define metabolic requirements of Chlamydomonas reinhardtii, a green microalga, and refine an existing metabolic network model.

Metabolic models are reconstructed based on an organism&#39;s available genome annotation and provide predictive tools to study metabolic processes at a ...

Analyzing Signaling Modules in Alzheimer's Disease with Deep Learning

DeepOmicsAE: Representing Signaling Modules in Alzheimer's Disease with Deep Learning Analysis of Proteomics, Metabolomics, and Clinical Data

Large omics datasets are becoming increasingly available for research into human health. This paper presents DeepOmicsAE, a workflow optimized for the analysis of multi-omics datasets, including&#160;proteomics, metabolomics, and clinical data. This workflow employs a type of neural network called autoencoder, to extract a concise set of features from the high-dimensional multi-omics input data. Furthermore, the workflow provides a method to optimize the key parameters needed to implement the autoencoder. To showcase this workflow, clinical data were analyzed from a cohort of 142 individuals who were either healthy or diagnosed with Alzheimer&#39;s disease, along with the proteome and metabolome of their postmortem brain samples. The features extracted from the latent layer of the autoencoder retain the biological information that separates healthy and diseased patients. In addition, the individual extracted features represent distinct molecular signaling modules, each of which interacts uniquely with the individuals&#39; clinical features,&#160;providing for a mean to integrate&#160;the proteomics, metabolomics, and clinical data.

Author Spotlight: Advancing Alzheimer's Research &#8211; Exploring Early Detection and Multi-Omics Approaches

DeepOmicsAE is a workflow centered on the application of a deep learning method (i.e., an autoencoder) to reduce the dimensionality of multi-omics data, providing a foundation for predictive models and signaling modules representing multiple layers of omics data.

Large omics datasets are becoming increasingly available for research into human health. This paper presents DeepOmicsAE, a workflow optimized for the ...

Enzyme Assays and Kinetics

Enzyme kinetics describes the catalytic effects of enzymes, which are biomolecules that facilitate chemical reactions necessary for living organisms. Enzymes act on molecules, referred to as substrates, to form products. Enzyme kinetic parameters are determined via assays that directly or indirectly measure changes in substrate or product concentration over time.&#160;
This video will cover the basic principles of enzyme kinetics (including rate equations) and kinetic models. The concepts governing enzyme assays are also discussed, followed by a typical colorimetric assay. The applications section discusses an enzyme assay via F&#246;rster resonance energy transfer (FRET) analysis, characterizing extracellular enzyme activity in the environment, and investigating DNA repair kinetics using molecular probes.
<div class="chapter_text" id="script_0">
Enzymes are biochemical catalysts that are essential for life. Enzyme assays are used to study the kinetic properties of enzymatic reactions, elucidating the catalytic effects of enzymes. This video will cover enzyme kinetics and assays, go over a general procedure, and show some applications.
</div>
<div class="chapter_text" id="script_1">
Enzymes are proteins, or less often RNAs, that act on a specific reactant, referred to as the substrate. An enzyme reduces the activation energy needed to initiate a biochemical reaction, causing the reaction to occur at a faster rate.
Enzymatic reactions can be broken up into three elementary components. The first is the formation of the enzyme-substrate complex, formed by the binding of the substrate to the enzyme active site. The complex can decompose into its original constituents. This is the second elementary reaction. Alternatively, the complex can form the product and recover the enzyme, the third elementary reaction.
The kinetics of an elementary reaction is given by the elementary rate law equation. Rate law equations give the rate in terms of the concentration of the reactants and a rate constant. Each of the elementary reactions has an individual rate law equation, with its own rate constant. These equations can be distilled down to a kinetic model known as the Michaelis-Menten equation. This gives the reaction rate in terms of the substrate concentration; which can be experimentally determined. Some general trends for enzyme reactions can be identified using the Michaelis-Menten equation. At high substrate concentration, a saturation point is reached, called Vmax. Here, the rate is limited by the total enzyme concentration, and the number of substrate molecules an enzyme converts into product per given time, also known as kcat. In Michaelis-Menten kinetics kcat is one of the two constants that govern reaction rate. The other constant, KM, is known as the affinity constant. KM is also equivalent to the concentration where the reaction rate is equivalent to one-half Vmax . An enzyme with a higher affinity will have a lower KM and reach Vmax faster, while an enzyme with lower affinity will have a higher KM and take longer to reach Vmax. Knowing kcat and KM allows for enzymes to be compared. To do this we use a ratio called enzyme efficiency. Higher kcat and lower KM result in higher efficiencies, while lower kcat and higher KM results in lower.
The factors used to elucidate enzyme kinetics must be determined experimentally. These assays are typically performed by mixing an enzyme and substrate solution in a controlled environment. Observations are made by measuring the changes in concentration of the substrate, product, or byproducts with respect to time.
The change in concentration over time is used to determine the reaction rate. In order to determine the kinetics, rate data must be obtained at multiple concentrations. If a plot of the inverse initial rate vs. inverse initial concentration, known as the Lineweaver-Burk plot, is linear, then the reaction follows Michaelis-Menten kinetics. The slope and intercept of the line allow for the determination of the kinetic parameters KM and Vmax, which can then be used to calculate kcat and the enzyme efficiency.
Now that the principles of enzyme kinetics have been discussed, let&#39;s look at how a typical enzyme assay is performed.
</div>
<div class="chapter_text" id="script_2">
In this procedure a colorimetric assay is demonstrated. The first step is to generate a standard curve, which will correlate absorbance with substrate concentration. Solutions of known concentration are prepared along with a control sample. A developer solution that reacts with the substrate is added to produce a colored compound. Absorbance is measured and plotted against concentration to generate the standard curve.
To perform the assay, a known concentration of substrate is prepared along with the appropriate amount of enzyme. The enzyme and substrate are mixed and allowed to incubate for a set time interval. pH and temperature are controlled with buffer solutions and heating blocks. A quenching agent is added to stop the reaction. Developer solution is then added to the reactions and mixed. The solutions are then placed in cuvettes and absorbance is measured. The amount of substrate consumed is determined by comparing the measured absorbance to the standard curve. Using the collected data, initial reaction rates are determined by plotting concentration over time. Finally, with the rate data and concentration, the Michaelis-Menten plot is made. This allows for the determination of kinetic properties for the enzyme such as turnover number and enzyme efficiency.
</div>
<div class="chapter_text" id="script_3">
Now that we&#39;ve reviewed an assay procedure, let&#39;s look at other ways assays are performed and their applications.
In this procedure FRET analysis is used to study the kinetics of a protease hydrolyzing a peptide bond of a protein. These emissions can be measured, allowing for a continuous and quantitative analysis of substrate consumption and production, aiding in the determination of the reaction kinetics.
Enzyme assays can be used in environmental science to determine the levels of extracellular enzyme activity in the environment. Waters, soils, and sediments can be collected from the environment and processed in the laboratory. Extracellular enzymatic activity of these materials can then be characterized using enzyme assays. This is a useful tool for understanding how the environment processes organic material.
A cell&#39;s DNA repair mechanism can be evaluated by studying the kinetics of enzymes found in the nucleus. The rate at which an enzyme removes DNA lesions, or damages, can be measured using fluorescent molecular beacons, which only fluoresce when bound to unique DNA sequences. The level of DNA repair can be measured in real time by detecting the fluorescently labeled cleavage products.
</div>
<div class="chapter_text" id="script_4">
You&#39;ve just watched JoVE&#39;s video on enzyme kinetics and assays. This video explained enzyme kinetics, covered assay concepts, went over a general procedure, and described some applications.
Thanks for watching!
</div>

Enzyme Assays to Study Enzyme Activity and Kinetics

Enzyme kinetics describes the catalytic effects of enzymes, which are biomolecules that facilitate chemical reactions necessary for living organisms. ...

Education

JoVE Science Education

Chemistry

Complementation Tests

A complementation test is a simple cross to identify whether the two mutations are located on the same gene or different genes. It was first performed by Edward Lewis in the 1940s while working on fruit flies. He developed the test to identify the location and arrangement of different mutations on chromosomes.
Organisms heterozygous for different mutations are crossed pairwise in all combinations. If present on different genes, the mutations can complement each other by providing the missing genetic element producing a wild-type phenotype. However, if both mutations belong to the same gene, they cannot complement each other and fail to exhibit the wild-type phenotype. The mutations that fail to complement each other are said to be in the same complementation group. The mutations that complement each other belong to different complementation groups.

Complementation Groups and Complementation Tests

A complementation test is a simple cross to identify whether the two mutations are located on the same gene or different genes. It was first performed by ...

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Summary

Explore More Videos

Chapters in this video

Bimolecular Fluorescence Complementation

Improving Student Outcomes with an Adaptable Molecular Cloning Course-Based Undergraduate Research Experience

Annotation of Plant Gene Function via Combined Genomics, Metabolomics and Informatics

Metabolic Pathway Confirmation and Discovery Through ¹³C-labeling of Proteinogenic Amino Acids

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

A Web Tool for Generating High Quality Machine-readable Biological Pathways

High-Throughput Metabolic Profiling for Model Refinements of Microalgae

DeepOmicsAE: Representing Signaling Modules in Alzheimer's Disease with Deep Learning Analysis of Proteomics, Metabolomics, and Clinical Data

Enzyme Assays and Kinetics

Complementation Tests