Name: an ultrahigh-throughput microfluidic platform for single-cell genome sequencing
Uploaded: 2018-05-23T15:00:00.000+00:00
Duration: 10 min
Description: Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

Bu eser bir kariyer Ödülü (grant numarası DBI-1253293); aracılığıyla Ulusal Bilim Vakfı tarafından desteklenmiştir Ulusal Sağlık Enstitüleri (NIH) (grant numaraları HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); ve Savunma İleri Araştırma Projeleri Ajansı yaşayan dökümhaneler Program (sözleşme numaralarını HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Bu iş akışı ile ilgili patent olabilir misyonu biyo için hangi Adam R. Abate lisanslı bir hissedar olduğunu.

SIC seq mikrosıvısal iş akışı binlerce bakteri hücreleri tek hücre genomu sıralama veri üretir. Dijital barkod microgel kapsüllenmiş hücrelerin genleri spliced NGS veri silico deconvolution içine aynı hücreden kaynaklanan barkodlu okuma grupları için izin verir. Bilinen bileşimi gibi bir mikrobiyal topluluğu ile bir denetim deneme barkod grupları saflığı değerlendirmek için gereklidir. Yüksek saflıkta gruplar büyük bir kısmı hücre sarma hızı çok yüksekse veya önemli damlacık çapraz bulaşma mikrosıvısal işlem adımları sırasında meydana gelen gösterir. Poisson istatistiklere göre barkod ve hücreleri 1 parçacık oranı tüm boş olmayan damlacıklar % 5'den az birden fazla kapsülleme olayların sınırlamak her 10 damla için hedef oranında kapsüllü. Kapsülleme oranı doğrulama dropmaking işlemi sırasında kritik önemini bu yüzden bundan daha yüksek bir kapsülleme oranı katlanarak, birini oranda artırır. Farklı hücrelerdeki aynı barkod sıra paylaşımı okuma bioinformatically ayrılmış olamaz, çünkü kullanıcılar birden çok hücreyi tek bir microgel kapsüllemenin özellikle dikkatli olmanız gerekir. Durumda 1 hücre 2 farklı barkod alır, bereket ölçümleri barkod sırası tarafından sayarken etkiye sahip olsa da barkod grup saflık etkilenmez.
Damlacık çapraz bulaşma da suboptimal birleşme koşulları nedeniyle ortaya çıkabilir. Başarılı bir operasyon sırasında mikrosıvısal birleşme aygıt (Şekil 5) controllably 1 microgel ile 1 barkod damlacık ve PCR reaktif hacmi eşleştirebilirsiniz. Sigara-mükemmel akış oranları yanlış oranlarıyla eşleştirme damlacık neden olacaktır: 1 barkod 2 microgels ile örneğin eşleştirilmiş. Protokol listelenen tüm akış oranları tahminleri olması amaçlanmıştır ve aygıt geometri ve damlacık boyutlarda küçük farklılıklar bağlı olarak ayarlanması gerekebilir. Fotoğraf makinesi ile yüksek hızlı kayıt yeteneklere erişimi olan kullanıcılar (> 10.000 kare/s) doğru damlacık birleşme başında ve mikrosıvısal işlemi boyunca doğrulamanız gerekir. Bir yüksek hızlı kamera erişimi olmayan kullanıcılar birleştirilmiş çıktı küçük bir hacim toplamak ve el ile mikroskop altında damlacık boyutları ölçmek. Damlacık boyutu düzgün olmalıdır: reinjection gore buna göre azaltılacak birleştirilmemiş barkodlar veya microgel damla bir fazlalığı gösterir.
Kendi bütünlüğünü korumak için microgels ve microdroplets ele alırken birkaç genel önlemler alınmalıdır. Microgels, mekanik olarak sağlam olsa da, yeterince kırma ve tam jelleşme sağlamak için gereken adımları yıkama önce soğutmalı gerekir. Sigara küresel microgels özel değildi bir gösterge vardır kuvvetlendirmek için yeterli zaman verilirse. Microgels yıkarken, süspansiyonlar ürün kayıplarını önlemek için gerekli hızlarda spin aşağı. Özel hidrojel su yakından eşleşen bir kırılma indisi vardır ve kullanıcılar dikkatli aspirasyon öncesinde jel sıvı sınır belirlemek gerekir bu yüzden tüp22içinde görmek zor olabilir. Petrol su damlacıkları birleştirme tarafından statik kuvvetleri23 laboratuvar eldiven ve boru birikmesi yatkındır. Bu nedenle, damlacık reinjection şırınga çıplak elle yükleme ve pompa priming önce bir anti-statik silahla reinjection çizgilerin tedavisinde önerilir. Büyük birleştiler damlacıkları yavaş yavaş şırınga emülsiyonlar döner ve el ile onların büyük batmaz kuvvet nedeniyle üst biriktikçe daha büyük damla aspirating tarafından kaldırılabilir.
SiC-seq olduğunu, tek hücreli genom sıralama göstermek için ilk teknoloji > 50.000 bakteri hücreleri. Bu platform varolan yaklaşımlar içinde üretilen iş önemli avantaj sunar ve türdeş olmayan mikrobiyal topluluklar daha derin bir örnekleme sağlar. Bugüne kadar mikrosıvısal teknolojileri tek hücreli genom sıralama için microchambers9 ve microwells24 hücre izolasyon ve güçlendirme için ama sadece onlarca yüzlerce hücre aralığındaki throughputs ile istihdam. Akış tek hücreleri wellplates5,6 ' sıralama hiçbir özel mikrosıvısal araçları gerektirir ama aynı şekilde düşük bir üretilen iş sahip. Verilen bu çevreden toprak ve su örnekleri sık, Alfa farklılıkların var > 1.000 türler, seviye25,26, SIC seq organizmalar çok daha fazla sayıda örnek için onun yetenek sayesinde son derece avantajlı. SIC seq iş akışı laboratuvar kültür, doğal çevre, ya da bir yaşam ana hücre girişleri için uyarlanabilir kaynaklanıyor. Bir hücre örneği yalnızca bir sulu süspansiyon olması ve büyük parçacıkların ücretsiz (> 10 µm) uygun mikrosıvısal Kapsülleme için olmak. Örneğin, yöntem bir örnek yıkama bir dizi kullanarak ve hücreleri kapsülleme17önce ön işlemden için adımları filtreleme deniz suyu daha önce uygulandı.
SIC seq Protokolü nispeten seyrek bir sıralama veri miktarı her tek hücreden oluşturur ve tüm uygulamalar için uygun olmayabilir. Arama bazı Biyoinformatik algoritmaları de novo genom derleme veya tek nükleotid varyant (SNV) gibi verimli çalışması için daha yüksek kapsama derinlikleri gerektirir. Bunun yerine, böylece algoritmalar okuma büyük kümeleri üzerinde uygulanabilir barkod grupları kümelenmiş silico taksonomik binning yöntemleri27 tarafından olabilir. Nispeten düşük tüm tedarikçilerden etkinliğini SIC seq iş akışının da giriş örnek durumu düşük nerede durumlarda zorluklar takdim edebilir miyim? SiC-seq bir Poisson dağıtılmış barkod kapsülleme basamakta dayanır, bu nedenle hücreleri yaklaşık yüzde 10'u moleküler bir barkod almak ve son Kütüphane hazırlık adımı sırasında güçlendirilmiş. Bu diğer tedarikçilerden microdroplet tabanlı düzenleri10' a benzer olmakla birlikte, değerli hücre örnekleri ile çalışan kullanıcılar sıralama için yeterli kitaplığı verimi elde zorluk olabilir ve PCR döngüleri son sayısını artırmak gerekebilir amplifikasyon adım. Başka bir potansiyel kullanıcıları için mikrosıvısal uzmanlığı ile böylece genel barkodlama verimlilik getiren dijital PCR adım sonra olumlu barkod damlacıkları sıralamak için çözümdür > % 8528.
Bir potansiyel gelecekteki yönünü SIC seq teknolojisi için iş akışı yeni klinik tek hücre çalışmaları için önünü memeli hücreleri ile kullanmak için adapte olduğunu. Örnek olarak, kopya numarası varyasyon tek kanser arasında bir analizini hücreleri Mayıs heterojenite kanser patoloji2' deki rolü bizim anlayış daha fazla. Alternatif olarak, SIC seq yoklama ve DNA dizileri faiz29 zenginleştirmek için mevcut yöntemler ile entegre altgrupları hedeflenen tek hücreli sıralama veya hücrelerin nadir suşları sağlayacak. Çevre örnekleri ile bilinen bir metabolik yolu üzerinden genlerde hedef olabilir ve Roman genomik Adaları tanımlamak için genlerin komşu yanında içeriksel analiz. Gelen bir insan ana bilgisayar ortamında düşük-titresi patojen bakteri örnekleri izole olabilir ve daha fazla incelemek için tek hücre düzeyinde yakından virülans genotypic onların kökeni sıralı.

Hücresel kimlik ve işlevi, bir organizmanın tamamını içeren bir plan potansiyel kodlama'nın genom hizmet vermektedir. Genom düzeyinde Hücresel biyoloji bir anlayış türdeş olmayan hücre popülasyonlarının içinde gözlenen fenotipik çeşitlilik açıklayabilir. Bu heterojenlik biyolojik sistemlerde belirgindir ve insan sağlığı ve hastalığı geniş etkiler. Örneğin, tümör hücreleri arasında gen kopya numarası varyasyonlar evrim ve yayılmasını kanseri1,2bağlıdır. Bakteriyel enfeksiyonlar, patojen Adaları genleri küçük bir kısmını mevcut yatay olarak transfer edilebilir ve için belgili tanımlık hızla çoğalmak-in antibiyotik dirençli bakteri3,4kurşun. Genleri tek hücre düzeyinde eğitim bir birincil DNA elde edilebilir, aynı zamanda hücreleri binlerce analiz etmek gerek genotip tam çeşitliliği örnek için düşük miktarlarda mücadeledir. Bu nedenlerden dolayı deneysel üretilen iş kısıtlamalar yapılan çalışmaların sonuçları en bol hücreler doğru kutuplama tek hücreli, etkinliğini engel. Sıralama5,6, Optik cımbız7, toplu jelleri8ve havacilik9 olarak sıkıştırılma akışı gibi tek hücreli yalıtım teknikleri hücreler sıralama için yüzlerce işleyebilme yeteneği olan; Ancak, bu çoğu örnekleri yalnızca küçük bir kısmını temsil eder. Tek hücreli genom sıralama ile önemli ölçüde daha yüksek üretilen iş için bir yöntem daha derin ve daha kapsamlı hücre popülasyonlarının, böylece bu topluluklar içinde genotypic çeşitlilik rolü elucidating profilleme sağlayacak.
Damlacık Havacilik hücreleri ve biyolojik kimyasalları picoliter ölçekli reaktörler milyonlarca içinde yüksek-den geçerek manipülasyon sağlar. Türdeş olmayan doku10,11,12, hücreleri arasında fark ifade desen çalışması için kullanılan teknolojiler microdroplet bugüne kadar derin uzun moleküller13,14 sıra ,15ve davranış kromatin immunoprecipitation sıralama (ChiP-seq) analizleri tek hücreleri16. Gerçekten de, microdroplets yüksek üretilen iş, bölümlere işlemleri, tek hücreli genomik uygulamalar için mükellef yapma yeteneğine sahiptirler. Bu teknoloji geliştirme ancak kendi benzersiz teknolojik sorunlar sunar. Hücreleri lysed saflaştırılmış ve aynı şekilde örnek hücre popülasyonlarının için en az önyargı ile güçlendirilmiş. Ayrıca, memeli hücrelerinde poliadenile mRNA transkript var. hiçbir karşılaştırılabilir moleküler motifi hedef nükleik asit yakalanması kolaylaştırmak için genom Bu nedenlerden dolayı tek hücreli genom sıralama microdroplet platformlarında uygulamak zor olmuştur.
Bu çalışmada, biz daha önce raporlanmış tek hücreli mikrosıvısal yaklaşımımız bir tek deneme17hücrelerde, on binlerce genleri sıralama yetenekli detaylı bir protokol sağlar. SiC-seq, adı verilen bu teknoloji sayesinde bakteri hücreleri mikron çaplı hydrogels içinde kapsüllenir ve tek tek lysed, tagmented ve genomik DNA hücrenin üzerine spliced benzersiz oligonükleotid barkod içeren bir microdroplet ile birleştirilmiş bir tek örtüşme uzantısı polimeraz zincir tepkimesi (PCR). Hydrogels izole konteyner içinde yüksek molekül ağırlıklı genomik DNA sterically, deterjanlar ve erişmek ve barkodlama18önce DNA arındırmak için litik enzimler gibi daha küçük moleküller izin kaplı olarak hizmet vermektedir. Bu iletişim kuralı işler > saatler, barkodlu kütüphane sıralama için hazır sonuçlanan 50.000 tek hücreler. Nasıl yapılacağını takiben, okuma, okuma, milyonlarca oluşan bir dataset her hücresel bir dizin ile sonuçlanan onların tek hücreli barkod sırasına göre demultiplexed.

<table><tbody><tr><td>3&quot; silicon wafers, P type, virgin test grade</td><td>University Wafers</td><td>447</td><td></td></tr><tr><td>SU-8 3025 photoresist</td><td>Microchem</td><td>17030192</td><td></td></tr><tr><td>Spin coater</td><td>Specialty Coating Systems</td><td>G3P-8</td><td></td></tr><tr><td>Photomasks</td><td>CadArt Servcies</td><td>(custom)</td><td>See Supplemental Files for mask designs</td></tr><tr><td>PGMEA developer</td><td>Sigma-Aldrich</td><td>484431</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>109827</td><td></td></tr><tr><td>Sylgard 184 silicone elastomer kit</td><td>Krayden</td><td>4019862</td><td></td></tr><tr><td>Degassing chamber</td><td>Bel-Art</td><td>42025</td><td></td></tr><tr><td>0.75 mm biopsy punch</td><td>World Precision Instruments</td><td>504529</td><td></td></tr><tr><td>Glass microscope slides (75 mm x 50 mm)</td><td>Corning</td><td>294775X50</td><td></td></tr><tr><td>Aquapel (hydrophobic glass treatment)</td><td>Pittsburgh Glass Works</td><td>47100</td><td></td></tr><tr><td>PE-2 polyethylene tubing</td><td>Scientific Commodities</td><td>B31695-PE/2</td><td></td></tr><tr><td>1 mL syringes</td><td>BD</td><td>309628</td><td></td></tr><tr><td>27 gauge needles</td><td>BD</td><td>305109</td><td></td></tr><tr><td>Syringe pump</td><td>New Era Pump Systems</td><td>NE-501</td><td></td></tr><tr><td>Novec HFE-7500 fluorinated oil (HFE)</td><td>3M</td><td>98-0212-2928-5</td><td></td></tr><tr><td>FC-40 fluorinated oil</td><td>Sigma-Aldrich</td><td>F9755</td><td></td></tr><tr><td>PEG-PFPE surfactant</td><td>Ran Biotechnologies</td><td>008-FluoroSurfactant</td><td></td></tr><tr><td>Space heater</td><td>Lasko&amp;nbsp;</td><td>CD09250&amp;nbsp;</td><td></td></tr><tr><td>Agarose, low gelling temperature</td><td>Sigma-Aldrich</td><td>a9414</td><td></td></tr><tr><td>TE (10X)</td><td>Rockland</td><td>mb-007</td><td></td></tr><tr><td>PBS 1X, pH 7.4</td><td>E&amp;amp;K Scientific Products</td><td>EK-65083</td><td></td></tr><tr><td>OptiPrep (density gradient medium)</td><td>Sigma-Aldrich</td><td>d1556</td><td></td></tr><tr><td>1H,1H,2H-Perfluoro-1-Octanol (PFO)</td><td>Sigma-Aldrich</td><td>370533</td><td></td></tr><tr><td>Span 80 (sorbitane monooleate)</td><td>Sigma-Aldrich</td><td>s6760</td><td></td></tr><tr><td>Hexane</td><td>Sigma-Aldrich</td><td>139386</td><td></td></tr><tr><td>Tween 20 (polysorbate 20)</td><td>Sigma-Aldrich</td><td>p2287</td><td></td></tr><tr><td>Lysozyme Type IV</td><td>MP Biomedicals</td><td>195303</td><td></td></tr><tr><td>Mutanolysin</td><td>Sigma-Aldrich</td><td>M9901</td><td></td></tr><tr><td>Zymolyase (yeast lytic enzyme)</td><td>Zymo Research</td><td>e1004</td><td></td></tr><tr><td>Lysostaphin</td><td>Sigma-Aldrich</td><td>L7386</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E6758</td><td></td></tr><tr><td>Tris-HCl, pH 7.5, 1M</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Teknova</td><td>d9750</td><td></td></tr><tr><td>Lithium dodecyl sulfate</td><td>Sigma-Aldrich</td><td>L9781</td><td></td></tr><tr><td>Proteinase K</td><td>New England Biosciences</td><td>P8107S</td><td></td></tr><tr><td>Ethanol, 200 Proof (100%)</td><td>Koptec</td><td>V1001</td><td></td></tr><tr><td>SYBR Green I (nucleic acid stain)</td><td>Invitrogen</td><td>S7563</td><td></td></tr><tr><td>PEG 6k</td><td>Sigma-Aldrich</td><td>81260</td><td></td></tr><tr><td>Triton X-100 (octylphenol ethoxylate)</td><td>Sigma-Aldrich</td><td>t8787</td><td></td></tr><tr><td>Nextera DNA Library Prep Kit</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td><td>New England Biosciences</td><td>m05365</td><td></td></tr><tr><td>Platinum Multiplex PCR Master Mix (Taq Master Mix)</td><td>Applied Biosystems</td><td>4464263</td><td></td></tr><tr><td>Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td><td>New England Biosciences</td><td>m0538m</td><td></td></tr><tr><td>NT buffer from Nextera XT kit (neutralization buffer)</td><td>Illumina</td><td>FC-131-1024</td><td></td></tr><tr><td>Cold cathode fluorescent inverter</td><td>(custom)</td><td>(custom)</td><td></td></tr><tr><td>DC power supply</td><td>Mastech</td><td>HY1503D</td><td></td></tr><tr><td>Zerostat 3 anti-static gun</td><td>Milty</td><td>5036694022153</td><td></td></tr><tr><td>3D-printed centrifuge syringe holder</td><td>(custom)</td><td>(custom)</td><td>See Supplemental Files for 3D print file</td></tr><tr><td>Zymo DNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>D4003</td><td></td></tr></tbody></table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sıralama teknolojileri üzerinden toplu bir paradigma kayması tek hücreli çözünürlükte yanıt-e doğru hücresel heterojenite rolü gelişen bir anlayış biyolojik sistemlerde uğramıştır. Ancak, tek hücreli sıralama büyük nüfusun by kısıtlamaları genleri sıralama için işleme engel olmuştur. Bu yazıda, tek kişilik hücrelerin genleri izole, yükseltmek için damlacık Havacilik kullanır tek hücreli genom sıralama (SiC-seq) ve barkod için bir yöntem açıklanmaktadır. Microgels hücre katma sağlar compartmentalized arıtma ve tagmentation DNA, bir mikrosıvısal birleşme verimli bir şekilde her genom benzersiz tek hücreli oligonükleotid barkod ile çiftleri iken izin > sıralı için 50.000 tek hücreler Çalıştır. Sıralama veri barkod, tek hücrelerden kaynaklanan okuma grupları oluşturma tarafından demultiplexed. Yüksek işlem hacmi ve düşük-önyargı yöntemi tek hücreli sıralama olarak, SIC seq genomik çalışmalar çeşitli hücre popülasyonlarının hedef daha geniş bir dizi sağlayacaktır.

SIC seq deneysel iş akışı bir yumuşak litografi yordam (Şekil 1) kullanarak fabrikasyon 3 PDMS mikrosıvısal cihazları içerir. Bir iş akışı dropmaker (Şekil 3A) 25 µm benzersiz bir tek hücreli tanımlayıcı genomik DNA etiketleme için dijital barkod damlacıkları oluşturur. Barkod oligonucleotides PCR güçlendirme (Tablo 2, BAR astar) için kolları tarafından çevrili bir 15 bp dejenere sırasında oluşur. Barkodlar tek molekül kapsülleme elde etmek için bir femtomolar konsantrasyon seyreltilmiş ve bütün damlacıklar ya 0 ya da 1 barkod fragment(s) alırsınız. Bir barkod içeren damlacıklar, Çift iplikçikli barkod amplicons çok sayıda kopyasını verimli güçlendirilmiş. Nükleik asit leke başarılı amplifikasyon doğrulamak ve barkod parçaları (Şekil 4B) kapsülleme oranını ölçmek için kullanılır. Microgels bir bakteri hücre süspansiyon ve erimiş özel jel eşit akış oranları (Şekil 2A), ortak akan tarafından oluşturulur. İş akış dropmaking süreci etkili sulu çözümler 2 katına sulandırır. gibi özel iki kez istenen son konsantrasyonu, hazırlanır. Özel soğudukça damlacığı küresel hacminin işgal 25 µm çapı microgel katılaşır.
Yıkama ve lizis adımlar bir dizi yüksek molekül ağırlıklı genomik DNA'microgels (Şekil 2B) arındırır. Emülsiyonlar kırdıktan sonra sulu yıkama geniş hacimli izleme aşağı akım enzimatik tedavi inhibe olabilir organik çözücüler sulandırmak için yapılmaktadır. Yıkanmış microgels hücre sarma hızı (Şekil 4A) doğrulamak için mikroskop altında gözlenir. Bir kokteyl enzim geniş litik aktivite ile bakteri ve ökaryotik mikroplar19hücre duvarlarını sindirmek için microgel süspansiyon eklenir. İndinavir K ve deterjan ile ikinci bir tedavi proteinler düşürür ve hücre artıkları solubilizes.
Tagmentation saf DNA'ın küçük tagmented DNA parçalarının microgels18arasında difüzyon kaynaklanan potansiyel çapraz bulaşma kaçınmak için damlacıkları gerçekleştirilir. Bir damlacık saklama aygıtı (Şekil 3B) her microgel aynı anda aynı zamanda "o ile önceden yüklenmiş oligonükleotid20etiketleme ise" çift iplikçikli DNA parçaları bir tampon ve tagmentation enzim ile compartmentalizes. Microgels 1 microgel için her damla birkaç birini21 (Şekil 4 c) ile yaklaşan kapsülleme oranları elde parçacıkları, yakın Paketli olarak damlacıkları yüklenir.
Mikrosıvısal iş akışı (Şekil 2C) son adımında bir aygıt 1 barkod damla, 1 damla microgel içeren ve kontrollü bir işlemdir amplifikasyon karışımda birleştiren bir çift birleşme işlemi gerçekleştirir. İlk olarak, PCR reaktif içeren bir damlacık eşleştirilmiş ve sarı (Şekil 5) gösterilen bölge bir barkod düşüş birleştirilir. Tuzlu su elektrotlar mikrosıvısal kanaldaki damlacık birleşme tetikler yüksek elektrik alanı degrade üretir. Benzer bir şekilde, ilk birleştirilmiş damlacık microgel damlacık ile eşleştirilmiş ve kırmızı ile gösterilen bölgede ikinci kez birleşti. Damlacıkları toplanır ve termal çip dışı bir tek-örtüşme uzantısında (SOE) PCR sağlanıncaya. Üst üste gelen tamamlayıcı biter barkod ve tagmented genomik DNA füzyon ve sadece doğru barkodlu yapıları, üstel amplifikasyon izin verir.
Sıralama veri ilk okuma kalitesi ile filtre ve Okunma 15-bp tek hücreli barkod sırasına göre gruplandırarak ayrıştırılır. Barkod grubunda geçerli kabul edilmesi, okuma en az sayıda içermelidir; Bu eşik Analizi yararlı bir sıralama veri miktarı ile hücrelere sınırlar ve PCR mutasyona uğramış barkod "öksüz" kümesinden kaldırır. Çalıştırmak bu örnekte, Grup başına 7,5 kbps minimum ayarlanır (50 okuma 150 bp her). Bir çubuk grafik Grup boyutu karşı barkod sayar geçerli barkod grupları önemli bir bölümünü sadece eşik boyutunu (6A rakam) olduğunu gösterir.
Denetim nerede mikrobiyal topluluk kompozisyon bilinmektedir deneyde, saflık ve göreli bereket ölçümleri SIC seq çalıştırmak kalitesini değerlendirmek için kullanılır. Burada, 3 gram-negatif bakteriler, 5 gram-pozitif bakteri ve 2 Mayalar içeren sentetik bir 10 hücreli topluluk analiz edilir. Verilen barkod grubunda saflığı en yaygın genom okuma grubunda toplam sayısı bölü grubunda Eşleme okuma sayısı olarak tanımlanır. Barkod gruplar büyük çoğunluğu eroine 0,95 (ekil 6B) büyük var. Hücre tiplerinin göreli bereket ham okuma sayma ve sayım grupları kendi üye okuma (Şekil 6C) uzlaşma için karşılık gelen bir hücre tipi nerede atanır barkod grupları tarafından hesaplanır. Okuma ve barkod grupları bolluk izlemek öyle ki bazı türler orantısız küçük veya büyük barkod gruplar halinde bulunmayan hücre popülasyonlarının örnek olduğunu belirten kabaca eşit oranlarda. Tek bir tür tüm barkod gruplarından toplam kapsama komplo yüksek kapsama az veya hiç çıkarma bölgesi (Şekil 7) içeren tüm genomu arasında gösterir. Kapsama tekdüzelik normalleştirilmiş kapsama değerleri, ortalama merkezli birçok değeri ile bir frekans dağılımı ile doğrulanabilir (Şekil 7, iç metin).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg"> Resim 1 : Fotolitografi tarafından mikrosıvısal cihazların imalat. (A)Master kalıpları tek özelliği yüksekliği ile SU-8 fotorezist silikon gofret üzerine bir tabaka kaplama spin tarafından imal edilmiştir. Fotorezist sonra photolithographic maskesi ve UV ışığı, crosslinking maruz kalan SU-8 ile desenli. Son olarak, uncrosslinked SU-8 bir geliştirici banyosunda feshedilmiştir. Elde edilen kalıp tam mikrosıvısal aygıt üretmek için cam slayda gümrüklü PDMS döküm için kullanılır. ()B) bir çift-tabaka aygıt için fabrikasyon benzer şekilde spin kaplama ve pozlama adımları ile başlar. Aşağıdaki adımları sonra bir iki katlı aygıt oluşturmak için yinelenir. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg"> Resim 2: SIC seq iş akışı genel bakış. (A) A mikrobiyal süspansiyon erimiş özel microgels tek kişilik hücrelerde kapsüllemek için bir dropmaker cihaz ile birlikte akıyordu. (B) microgels yıkar bakteriyel genomik DNA arındırmak için bir dizi tabi tutulmaktadır. Litik enzimler gram-pozitif bakteri ve Maya hücre duvarlarını sindirmek ve deterjan hücresel enkaz solubilizes. Microgels yeniden damlacıkları çapraz bulaşma azaltmak tagmentation için içine saklanmış. (C) mikrosıvısal birleşme birleştirir dijital PCR barkod, tagmented microgel genom ve amplifikasyon karışımı bir hızda > 1 kHz. Çip dışı SOE-PCR tagmented genom üzerine benzersiz bir tek hücreli barkod tutturmak ve seçmeli olarak tamamen yükselterek barkodlu yapıları. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg"> Şekil 3: Mikrosıvısal cihazlar dropmaking ve microgel yeniden Kapsülleme için. (A) Bu panel bir iş akışı dropmaker (şekil yüksekliği 25 µm) gösterir. Hücreleri ve erimiş özel 25 µm x 25 µm merkezinde 25 µm damlacıkları üretmek için eşit akış oranları cihazın içine tanıtıldı. Dijital barkod dropmaking için hücre giriş takılı ve PCR karışımı özel giriş giriliyor. (B) Bu panel bir microgel yeniden saklama aygıtı (özelliği yüksekliği 25 µm) gösterir. Microgels içine onların yakın Paketli sipariş korumak ve bir tagmentation Mix 25 µm x 30 µm merkezinde yeniden kapsülleme önce alıyorsanız bir huni şeklinde giriş akışı. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg"> Şekil 4 : Filmler damlacıkları ve microgels. 25 µm microgels enzimatik lizis önce yıkanmış (A) Bu panel gösterir. Bakteri fluorescently kapsülleme oranı miktar için lekeli. Poisson yükleme istatistik hücreleri 1 10 damla bir hızda kapsüllü veya çoklu-kapsülleme olayları sıklığını en aza indirmek için daha az olmalıdır dikte. (B) Bu panel 25 µm dijital barkod damlacıkları ile bir nükleik asit leke tedavi floresans mikroskobu görüntüsünü gösterir. Güçlendirilmiş barkod parçaları içeren damlacıklar güçlü floresans sinyal üretirler. (C) Bu panel 50 µm damla yeniden kapsüllü microgels gösterir. Kapat-ambalaj microgels damla başına 1 jel kaç birini ile yaklaşan kapsülleme oranları sağlar. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg"> Şekil 5 : Mikrosıvısal Çift Kişilik birleşme aygıt için tek hücreli genom tedarikçidir. Bir iki adım birleşme işlemi barkod damlacıkları ile yüksek işlem hacmi itibariyle tagmented genleri çiftleri. Bir damlacık PCR karışımı ilk oluşturulan ve barkod damlacık tuzlu su elektrotları kullanarak sarı renkle gösterilen bölge içinde birleştirilir. Daha sonra bir microgel içeren bir damlacık tanıttı ve kırmızı ile gösterilen bölgede ikinci kez birleşti. Yağ giriş reinjected damlacıkları arasındaki boşluğu hassas kontrol sağlar. Barkod reinjection odası ve spacer petrol mavi gölgeli kısa 25 µm tabaka yerleştirilir. Diğer tüm aygıt özellikleri toplam yüksekliği 45 µm ile kalın katmana ait. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg"> Şekil 6 : Barkod grup ölçümleri 10 hücreli sentetik mikrobiyal topluluğunun. (A) Bu panel grubu boyutları barkod dağılımı gösterir. Grup bir boyut sayısı katlanarak grup büyüklüğü arttıkça azalır. Grup başına 7,5 kbps minimum eşik analizi bilgi yeterli miktarda sahip gruplara sınırlar ve PCR mutasyona uğramış sıra "yetimler." kaldırır (B) Bu panel grup eroine barkod dağılımını gösterir. Büyük çoğunluğu (> % 90) gruplarıdır çok yüksek saflık (> % 95). (C) Bu panel 10 tür okuma ve barkod grubu düzeyinde hesaplanan göreli bolluk gösterir. Sayım yöntemleri 2 Barkod Grup boyutu türler arasında tutarlı hale gelir gösteren benzer sonuçlar. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg"> Şekil 7 : Toplamak genomik kapsama Bacillus subtilis barkod gruplar. Bakteri B. subtilis için eşleme tüm barkod gruplardan okuma (N = 9,398) havuzlu ve toplam olarak analiz edilebilir. Dairesel kapsama alanı Haritası SIC seq okuma hiçbir gözlemlenebilir çıkarma bölgeler ile kapsama tekdüzelik göstermektedir. Kesikli çizgi çevresi ortalama kapsamı gösterir (5,55 x). Bir toplu üsleri genom genelindeki ortalama yakınındaki bir derinlikte kaplıdır göreli kapsama frekansları iç metin histogramını gösterir kesikli çizgiyle temsil. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Aygıt</td>
			<td>1 katman yüksekliği (µm)</td>
			<td>1 katman Spin hızı (devir/dakika)</td>
			<td>2 katman yüksekliği (µm)</td>
			<td>2 katman Spin hızı (devir/dakika)</td>
		</tr>
<tr>
<td>İş akışı dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Jel yeniden encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Çift Kişilik birleşme</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
</tbody></table>Tablo 1: mikrosıvısal cihaz üretim parametreleri. Bu tablo (SU-8 3025 için üreticinin belirtimlerine bağlı olarak) kaplama fotorezist spin için gerekli kendi hızlarında SIC seq akışında kullanılan mikrosıvısal aygıtlar listesini gösterir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Etiket</td>
			<td colspan="5">Sıra (5' > 3')</td>
		</tr>
<tr>
<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
<tr>
<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
<tr>
<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
<tr>
<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
<tr>
<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
</tbody></table>Tablo 2: Astar diziler.
Ek dosya 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Bu dosyayı indirmek için buraya tıklayınız.</a>
Ek dosya 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Bu dosyayı indirmek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Tek hücreli genom sıralama için bir üretilen iş Ultrahigh mikrosıvısal Platform

Tek hücreli sıralama genotypic heterojenlik biyolojik sistemlerde ortaya çıkarır, ama daha fazla işlem hacmi derin topluluk kompozisyon ve işlev profil oluşturma için gerekli güncel teknolojileri eksikliği. Burada, biz bir mikrosıvısal iş akışı sıralama için tarif > 50.000 tek hücreli genleri farklı popülasyonlar hücre.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Research

JoVE Journal

Bioengineering

17.5K Görüntüleme.  University of California, San Francisco. Tek hücreli sıralama genotypic heterojenlik biyolojik sistemlerde ortaya çıkarır, ama daha fazla işlem hacmi derin topluluk kompozisyon ve işlev profil oluşturma için gerekli güncel teknolojileri eksikliği. Burada, biz bir mikrosıvısal iş akışı sıralama için tarif > 50.000 tek hücreli genleri farklı popülasyonlar hücre.

Video: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

Yüksek Verimli MicroRNA Profil: Optimize edilmiş, Multiplex QRT-PCR Fluidigm Dinamik ArrayTM IFCS Nanoliter Ölçeğinde

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Biyomühendislik

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

Bir mikroakışkan Platform kullanarak Yüksek throughput Protein Ekspresyonu Jeneratör

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

High Throughput Single-cell and Multiple-cell Micro-encapsulation

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 &mu;m polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency Pk=1 of 83.7% and a double-particle encapsulation efficiency Pk=2 of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. 
Introduction 
Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify signals from bioreactor products. Drops also provide the ability to re-merge drops into larger aqueous samples or with other drops for intercellular signaling studies.1,2 The reduction in dilution implies stronger detection signals for higher accuracy measurements as well as the ability to reduce potentially costly sample and reagent volumes.3 Encapsulation of cells in drops has been utilized to improve detection of protein expression,4 antibodies,5,6 enzymes,7 and metabolic activity8 for high throughput screening, and could be used to improve high throughput cytometry.9 Additional studies present applications in bio-electrospraying of cell containing drops for mass spectrometry10 and targeted surface cell coatings.11 Some applications, however, have been limited by the lack of ability to control the number of cells encapsulated in drops. Here we present a method of ordered encapsulation12 which increases the demonstrated encapsulation efficiencies for one and two cells and may be extrapolated for encapsulation of a larger number of cells.
To achieve monodisperse drop generation, microfluidic "flow focusing" enables the creation of controllable-size drops of one fluid (an aqueous cell mixture) within another (a continuous oil phase) by using a nozzle at which the streams converge.13 For a given nozzle geometry, the drop generation frequency f and drop size can be altered by adjusting oil and aqueous flow rates Qoil and Qaq. As the flow rates increase, the flows may transition from drop generation to unstable jetting of aqueous fluid from the nozzle.14 
When the aqueous solution contains suspended particles, particles become encapsulated and isolated from one another at the nozzle. For drop generation using a randomly distributed aqueous cell suspension, the average fraction of drops Dk containing k cells is dictated by Poisson statistics, where Dk = &lambda;k exp(-&lambda;)/(k!) and &lambda; is the average number of cells per drop. The fraction of cells which end up in the "correctly" encapsulated drops is calculated using Pk = (k x Dk)/&Sigma;(k' x Dk'). The subtle difference between the two metrics is that Dk relates to the utilization of aqueous fluid and the amount of drop sorting that must be completed following encapsulation, and Pk relates to the utilization of the cell sample. As an example, one could use a dilute cell suspension (low &lambda;) to encapsulate drops where most drops containing cells would contain just one cell. While the efficiency metric Pk would be high, the majority of drops would be empty (low Dk), thus requiring a sorting mechanism to remove empty drops, also reducing throughput.15
Combining drop generation with inertial ordering provides the ability to encapsulate drops with more predictable numbers of cells per drop and higher throughputs than random encapsulation. Inertial focusing was first discovered by Segre and Silberberg16 and refers to the tendency of finite-sized particles to migrate to lateral equilibrium positions in channel flow. Inertial ordering refers to the tendency of the particles and cells to passively organize into equally spaced, staggered, constant velocity trains. Both focusing and ordering require sufficiently high flow rates (high Reynolds number) and particle sizes (high Particle Reynolds number).17,18 Here, the Reynolds number Re =uDh/&nu; and particle Reynolds number Rep =Re(a/Dh)2, where u is a characteristic flow velocity, Dh [=2wh/(w+h)] is the hydraulic diameter, &nu; is the kinematic viscosity, a is the particle diameter, w is the channel width, and h is the channel height. Empirically, the length required to achieve fully ordered trains decreases as Re and Rep increase. Note that the high Re and Rep requirements (for this study on the order of 5 and 0.5, respectively) may conflict with the need to keep aqueous flow rates low to avoid jetting at the drop generation nozzle. Additionally, high flow rates lead to higher shear stresses on cells, which are not addressed in this protocol. The previous ordered encapsulation study demonstrated that over 90% of singly encapsulated HL60 cells under similar flow conditions to those in this study maintained cell membrane integrity.12 However, the effect of the magnitude and time scales of shear stresses will need to be carefully considered when extrapolating to different cell types and flow parameters. The overlapping of the cell ordering, drop generation, and cell viability aqueous flow rate constraints provides an ideal operational regime for controlled encapsulation of single and multiple cells.
Because very few studies address inter-particle train spacing,19,20 determining the spacing is most easily done empirically and will depend on channel geometry, flow rate, particle size, and particle concentration. Nonetheless, the equal lateral spacing between trains implies that cells arrive at predictable, consistent time intervals. When drop generation occurs at the same rate at which ordered cells arrive at the nozzle, the cells become encapsulated within the drop in a controlled manner. This technique has been utilized to encapsulate single cells with throughputs on the order of 15 kHz,12 a significant improvement over previous studies reporting encapsulation rates on the order of 60-160 Hz.4,15 In the controlled encapsulation work, over 80% of drops contained one and only one cell, a significant efficiency improvement over Poisson (random) statistics, which predicts less than 40% efficiency on average.12
In previous controlled encapsulation work,12 the average number of particles per drop &lambda; was tuned to provide single-cell encapsulation. We hypothesize that through tuning of flow rates, we can efficiently encapsulate any number of cells per drop when &lambda; is equal or close to the number of desired cells per drop. While single-cell encapsulation is valuable in determining individual cell responses from stimuli, multiple-cell encapsulation provides information relating to the interaction of controlled numbers and types of cells. Here we present a protocol, representative results using polystyrene microspheres, and discussion for controlled encapsulation of multiple cells using a passive inertial ordering channel and drop generation nozzle.

Combining monodisperse drop generation with inertial ordering of cells and particles, we describe a method to encapsulate a desired number of cells or particles in a single drop at kHz rates. We demonstrate efficiencies twice exceeding those of unordered encapsulation for single- and double-particle drops.

Yüksek Verim Micro-encapsulation Tek hücreli ve Çoklu-hücre

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement ...

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Mikro ölçekli Hücre Stimülasyon deneyler için Çok Yönlü Otomatik Platformu

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

Tek Hücrelerinin yönlü Kimyasal Analiz için mikroakışkan Chip

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

Nanopore sıralamayı kullanarak tüm kan mRNA sıralaması

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetik

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly sensitive. This protocol obtains precise measurements of gene expression from single worms or from bulk samples. The protocol presented here provides a novel adaptation of existing methods for complementary DNA (cDNA) preparation coupled to a nanofluidic RT-qPCR platform. The first part of this protocol, named &#8216;Worm-to-CT&#8217;, allows cDNA production directly from nematodes without the need for prior mRNA isolation. It increases experimental throughput by allowing the preparation of cDNA from 96 worms in 3.5 h. The second part of the protocol uses existing nanofluidic technology to run high-throughput RT-qPCR on the cDNA. This paper evaluates two different nanofluidic chips: the first runs 96 samples and 96 targets, resulting in 9,216 reactions in approximately 1.5 days of benchwork. The second chip type consists of six 12 x 12 arrays, resulting in 864 reactions. Here, the Worm-to-CT method is demonstrated by quantifying mRNA levels of genes encoding heat shock proteins from single worms and from bulk samples. Provided is an extensive list of primers designed to amplify processed RNA for the majority of coding genes within the C. elegans genome.

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

In this article a high-throughput protocol for fast and reliable determination of gene expression levels in single or bulk C. elegans samples is described. This protocol does not require RNA isolation and produces cDNA directly from samples. It can be used together with high-throughput multiplexed nanofluidic real-time qPCR platforms.

Nanoakışkan Teknoloji Kullanarak Tek ve Toplu C. elegans Örneklerinde Yüksek Verimli Nicel RT-PCR

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Yüksek verim Tek hücreli İzolasyonu ve Kültür mikroakışkan Platformu

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Bütün genomik DNA analizi için olağanüstü uzun okunur sıralama

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

Uzun Süreli Hücresiz Gen Ekspresyonunun İletimi için Çok Katmanlı Mikroakışkan Platform

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...