This work was supported by an IMPRS PhD stipend to E.S, an EMBO Long-Term Fellowship to V.P., and MPI-MPP internal funds to F.K. Part of this work was also funded through PLAMORF, a project that has received funding from the European Research Council (ERC) under the European Union&#8217;s Horizon 2020 research and innovation programme (Grant agreement No. 810131). The authors would like to thank Federico Apelt for the bioinformatic analysis and comments on the manuscript, and Mathieu Bahin and Amira Kramdi for the bioinformatic analysis.&#160;Work in the Colot lab is supported by Investissements d&#8217;Avenir ANR-10-LABX-54 MEMO LIFE, 506 ANR-11-IDEX-0001-02 PSL* Research University.

1. Preparing the RNA
<ol>
	<li>Grind 200 mg of plant tissue to powder in liquid nitrogen, making sure that the tissue remains frozen throughout the procedure.</li>
	<li>Extract the RNA from the desired plant tissue following an acid guanidinium thiocyanate-phenol-chloroform extraction protocol. To decrease the possibility to contaminate RNA with DNA during the phase separation, use 1-bromo-3-chloropropane instead of chloroform.
	<ol>
		<li>Add 1 mL of RNA extraction reagent containing guanidine thiocyanate and acid phenol to the grinded plant tissue (500 &#181;L per 100 mg tissue). Mix well by inverting and make sure all the tissue is wet. Incubate for 10 min at room temperature to dissociate the ribonucleoprotein complexes.</li>
		<li>Centrifuge for 10 min at 12,000 x g at 4 &#176;C and transfer the supernatant to a new 1.5 mL tube.</li>
		<li>Add 200 &#181;L of 1-bromo-3-chloropropane (100 &#181;L per 500 &#181;L RNA extraction reagent) and vortex vigorously.</li>
		<li>Centrifuge for 15 min at 12,000 x g at 4 &#176;C and transfer the upper aqueous phase (approx. 500 &#181;L) to a new 1.5 mL tube.</li>
		<li>Add 1 volume of isopropanol (500 &#181;L) and 0.1 volume of 3 M sodium acetate pH 5.5 (50 &#181;L), mix well by inverting and precipitate 10 min at -20 &#176;C. 
		NOTE: The use of sodium acetate (NaOAc) is recommended in order to enhance RNA precipitation. The protocol can be paused at this point by prolonging the precipitation of RNA for a few hours or even overnight.</li>
		<li>Centrifuge for 30 min at 12,000 x g at 4 &#176;C and discard the supernatant.</li>
		<li>Wash the pellet twice with 500 &#181;L of 80% EtOH, centrifuge for 5 min at 12,000 x g at 4 &#176;C and discard.</li>
		<li>Wash the pellet once with 500 &#181;L 99% EtOH, centrifuge for 5 min at 12,000 x g at 4 &#176;C and discard.</li>
		<li>Dry the pellet for 5-10 min and dissolve in 30 &#181;L of RNase-free H2O. 
		NOTE: Instead, use any RNA extraction protocol of choice (e.g., a column-based system). If a DNase digestion is included in the protocol, skip it in the following step (step 1.3).</li>
	</ol>
	</li>
	<li>Measure the RNA concentration (e.g., with the use of a spectrophotometer) and digest 20 &#181;g of RNA with DNase. 
	NOTE: DNA is rich in m5C and the antibody does not distinguish between DNA and RNA.
	<ol>
		<li>In a typical DNase reaction, treat 10 &#181;g of RNA in a 50 &#181;L reaction. Mix the following components and incubate the reaction(s) at 37 &#176;C for 30 min: 
		10 &#181;g of RNA x &#181;L 
		10x DNase buffer 5 &#181;L 
		DNase 1 &#181;L (2 units) 
		RNase-free H2O up to 50 &#181;L</li>
		<li>Remove the enzyme either by adding an appropriate volume of DNase inactivation reagent (if it is included in the DNase kit and according to manufacturer&#8217;s instructions) or by performing a cleanup step (e.g., column purification or phenol/chloroform extraction).</li>
	</ol>
	</li>
	<li>Check the quality and purity of the isolated RNA by capillary electrophoresis and proceed if the RNA integrity number (RIN) is higher than 7, to ensure the samples are of good quality.</li>
	<li>OPTIONAL: Remove the ribosomal RNA to enrich the samples in mRNA content using an rRNA removal kit and according to manufacturer&#8217;s protocol.
	<ol>
		<li>Use the DNase treated RNA from the previous step for the rRNA depletion reaction(s). Perform multiple reactions if the amount of total RNA is more than the maximum amount suggested for the reaction.</li>
		<li>Note that only 5-10% of the input amount will be recovered after rRNA depletion. Proceed with the rRNA depleted RNA (equal amount for all samples) and ignore the amounts mentioned in the following steps, as they refer to total RNA. 
		NOTE: For a comparison and description of available rRNA depletion methods see references 38,39,40. rRNA is the major part of total RNA and is m5C methylated in many organisms.</li>
	</ol>
	</li>
	<li>Prepare in advance in vitro transcripts (IVT) to be used as control RNA sequences and add them in the samples.
	<ol>
		<li>Produce two distinct IVTs using an in vitro transcription kit, one with non-methylated nucleosides and one where rCTP is replaced by 5-methyl-rCTP, to serve as negative and positive controls in MeRIP, respectively. The transcripts prepared were those of EGFP and Renilla luciferase. 
		NOTE: The IVTs should not exist in the transcriptome of the organism you are analysing. If the IVTs are from the same template (e.g., both EGFP), then add the positive and negative control in two different samples. If their sequence is different (e.g., EGFP and Renilla), they can be added to the same sample.</li>
		<li>Spike in each sample 0.1 ng IVT per 3 &#181;g of RNA, as controls.</li>
	</ol>
	</li>
	<li>Sonicate the RNA to approximately 100 nt fragments. 
	NOTE: The conditions for RNA shearing must be adjusted in advance and they differ for each sonicator. For the model used here, sonication is performed with the following conditions: Peak power 174, Duty factor 10, Cycles/burst 200, 17 min.
	<ol>
		<li>Sonicate the same amount of RNA for all samples, at least 12 &#181;g RNA per sample in 80 &#181;L of total volume (min 60 &#181;L, max 100 &#181;L), filled up with RNase-free H2O.</li>
	</ol>
	</li>
	<li>Confirm the efficiency of sonication and the concentration of the RNA samples by capillary electrophoresis. The average size of fragmented RNA should be around 100 nt.</li>
</ol>
2. Methylated RNA Immunoprecipitation (MeRIP)
<ol>
	<li>In low-binding tubes, add 9 &#181;g of sonicated RNA and RNase-free H2O up to 60 &#181;L (or more, depending on the concentration).</li>
	<li>Dissociate the secondary structures by heating the RNA at 70 &#176;C in a water bath for 10 min and cooling down for an additional 10 min in an ice-water mix.</li>
	<li>Split the sample in three parts: one-third (20 &#181;L, if 60 &#181;L were taken in step 2.1) is saved in a separate tube at -80 &#176;C as the Input sample. Fill the remaining 40 &#181;L with RNase-free H2O up to 860 &#181;L and then split in two low-binding tubes: one for IP and one for the Mock control (430 &#181;L each).</li>
	<li>Add to both tubes: 
	50 &#181;L of 10x MeRIP buffer 
	10 &#181;L of RNase inhibitor 
	10 &#181;L of &#945;-m5C antibody (10 &#181;g) in the IP sample per 10 &#181;L of H2O in the Mock sample 
	NOTE: The antibody clone used previously is not commercially available anymore. However, any anti-5-methylcytosine monoclonal antibody should work similarly. Antibodies should be tested for specificity before used for MeRIP11,23.</li>
	<li>Seal the tubes with parafilm and incubate for 12-14 hours at 4 &#176;C, with overhead rotation.</li>
	<li>The next day, prepare the protein G magnetic beads for binding.
	<ol>
		<li>For each tube (either IP or Mock control), use 40 &#181;L of beads. Add the total amount of beads (# of tubes x 40 &#181;L, e.g., for 2 IP and 2 Mock samples, 160 &#181;L of beads are needed) in a 15 mL tube and wash three times with 800 &#181;L of 1x MeRIP buffer per sample (# of tubes x 800 &#181;L buffer, e.g., 3.2 mL for 2 IP and 2 Mock samples).</li>
		<li>Perform washes at room temperature for 5 min with overhead rotation, collect the beads with the help of a magnetic rack and discard the washing buffer. After the third wash, resuspend the beads in the same volume of 1x MeRIP buffer as the initial volume of beads taken (# of tubes x 40 &#181;L, e.g., 160 &#181;L of 1x MeRIP buffer for 2 IP and 2 Mock samples). 
		NOTE: The amount of protein G beads used is determined by the binding capacity of the beads for the specific antibody type and the amount of antibody used. In this case, the beads have a binding capacity of approx. 8 &#181;g of mouse IgG per mg of beads and 30 mg/mL concentration. Therefore, 40 &#181;L are enough to bind approx. 9.6 &#181;g of antibody.</li>
	</ol>
	</li>
	<li>Add 40 &#181;L of resuspended beads to each IP and Mock sample and incubate for additional 2 hours at 4 &#176;C, with overhead rotation.</li>
	<li>Place the tubes on a magnetic rack for 1 min and discard the supernatant or save it as a control (non-bound RNA sample).</li>
	<li>Wash the beads 5 times by resuspending in 700 &#181;L of 1x MeRIP buffer supplied with 0.01% Tween 20 and incubating for 10 min at room temperature with overhead rotation.</li>
	<li>Resuspend the washed beads in 200 &#181;L of Proteinase K digestion buffer and add 3.5 &#181;L of Proteinase K. Incubate for 3 hours at 50 &#176;C, shaking at 800 rpm. Occasionally, flick manually the bottom of the tube if a sediment of beads is forming during the incubation.</li>
	<li>Extract the RNA by addition of 800 &#181;L of RNA extraction reagent and following an acid guanidinium thiocyanate-phenol-chloroform extraction protocol, and continue as in step 1.2. To increase visibility of the RNA pellet, a colored co-precipitant can be added in isopropanol at the precipitation step. Resuspend the pellet in 20 &#181;L of RNase-free H2O (or equal to Input volume kept in step 2.3).</li>
</ol>
3. Downstream analysis
<ol>
	<li>Submit the Input and IP samples for single end sequencing with 50 bases read length (SE50).</li>
	<li>Trim 3&#8217; end adaptors using cutadapt41 and discard reads that are shorter than 48 nt.</li>
	<li>Map trimmed reads to the Arabidopsis genome (TAIR10 annotation) using STAR42 with a cutoff of 6% for mismatches and maximum intron size of 10 kb. Keep uniquely mapped reads for further analysis.</li>
	<li>Identify enriched RNA fragments in IP samples compared to Input using two distinct methods and consider those that are found significantly enriched by both.
	<ol>
		<li>First, detect MeRIP-seq peaks using MACS2 peak caller43 on pooled IPs versus Input.</li>
		<li>Secondly, follow the analysis for MeRIP-seq peak calling as described in Meyer et al.22 and Yang et al.17.
		<ol>
			<li>Using custom R scripts, divide the genome in distinct 25 nt windows and count the number of uniquely mapped reads for each window based on the position of the last mapped nucleotide (since the reads originate from 100 nt RNA fragments).</li>
			<li>Calculate significantly enriched windows in IP samples compared to Input with the Fisher Exact Test. Use the Benjamini-Hochberg procedure&#160;to correct for multiple testing.</li>
			<li>Keep the significantly enriched peaks that span over at least two consecutive windows and discard peaks that cover only one window.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Identify annotated regions of the genome (transcripts) with significantly enriched peaks found by both methods.</li>
	<li>Alternatively or complementarily, test specific RNA targets for their enrichment in the IP samples.
	<ol>
		<li>Reverse transcribe the RNA (same volume of Input, IP and Mock samples) with random hexamers.</li>
		<li>Perform quantitative real-time PCR on the chosen targets, comparing Input, IP and Mock via the &#916;&#916;Ct method. 
		NOTE: The generated product should not be longer than 100 bp, as this is the average fragmentation size.</li>
	</ol>
	</li>
</ol>

The authors have no conflict of interest to disclose.

RNA carries more than one hundred distinct base modifications4 that form the epitranscriptome44. These modifications add an additional layer of regulation of translation and signalling (reviewed in5,6,8,20,45,46). Early studies were able to detect the presence of post-transcriptional modifications on RNA28,47 but the specific modified RNAs need to be identified in order to understand the role of epitranscriptomics. MeRIP was designed as a method to map RNA methylation sites transcriptome-wide21,22. It can be adapted to any modification, if a specific antibody is available.
The main strength of this protocol is that is relatively simple, safe for the RNA and the user (e.g., 5-azaC is highly toxic for plants and humans) and does not require sequence or modifying enzyme information. Moreover, the enrichment of methylated RNAs by the IP increases the chances of low abundant mRNAs to be detected, unlike bisulfite sequencing that does not contain an enrichment step. When two serial rounds of MeRIP are performed, enrichment in RNA fragments containing methylation sites increases further22. One of the limitations of MeRIP, especially when applied to mRNA methylation studies, is the high quantity of RNA required as input for the assay. The ribodepletion &#8211; or poly(A) enrichment &#8211; step will reduce the background caused by the heavily modified ribosomal RNA but it removes more than 90% of total RNA. DNA must also be completely removed as it is rich in 5-methylated cytosines. Another drawback is the lower resolution of the exact position of methylation. Sonication of the RNA prior to incubation with the antibody helps towards this direction by narrowing down the region containing the modification to 100-200 nucleotides. When MeRIP is combined with deep sequencing, the resolution of m5C site prediction increases as the sequencing reads form a Gaussian distribution around the potential methylation site. Additionally, the specificity of the antibody needs to be confirmed prior to the assay (e.g., with RNA dot blot assays, performed with oligos synthesized with modified nucleotides), however, to what extent an antibody can actually distinguish between closely related modifications (e.g., m6A and m6Am) is a point of argument in the field48,49. Moreover, highly structured RNAs might interfere with the antibody&#8211;antigen interaction, another restriction that is mostly addressed with fragmentation and denaturation of RNA prior to IP. On the contrary, bisulfite sequencing that is also affected by secondary structures, does not include a fragmentation step and this might be one reason that causes discrepancy between the m5C sites and mRNAs predicted by bisulfite sequencing16 and MeRIP-seq11,17. Other cytosine modifications (e.g., hm5C) are also resistant to bisulfite-mediated deamination35.
Modifications of MeRIP-seq include a crosslinking step, either with the introduction of a photoactivatable ribonucleoside (photo-crosslinking-assisted m6A-seq, PA-m6A-seq 50) or using UV light to create antibody-RNA crosslinks after the IP (miCLIP49, different method than the miCLIP described in introduction30, but also with individual-nucleotide resolution). In the future, and as knowledge on RNA methylation is accumulating, more targeted approaches might be preferable, based on the modifying enzymes and/or the consensus sequences where methylation is appearing. The identification of reader proteins is essential to the understanding of the molecular and signalling function of post-transcriptional modifications. Nanopore sequencing technology already allows the direct identification of modified nucleotides without prior treatment of the RNA17 but there is still room for improvement on this field regarding sequence depth and bioinformatic analysis. Overall, MeRIP-seq is currently an established, reliable, and unbiased approach to identify methylated RNA transcripts.

An erratum was issued for:&#160;<a href="https://www-jove-com.bdigitaluss.remotexs.co/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://www-jove-com.bdigitaluss.remotexs.co/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

In all three kingdoms of life, RNA species undergo post-transcriptional modifications and research on these functionally relevant biochemical modifications is called &#8220;epitranscriptomics&#8221;. Epitranscriptomics is a growing field and various methods are being developed to study and map the modifications on RNA molecules (reviewed in1,2). More than a hundred RNA modifications have been found, detected in rRNAs, tRNAs, other ncRNAs, as well as mRNAs3,4. Although the presence and function of chemically diverse post-transcriptional modifications in tRNAs and rRNAs are extensively studied5,6,7,8, only recently have mRNA modifications been characterized. In plants, many mRNA modifications have been identified to date, including m7G at the cap structure9, m1A10, hm5C11,12, and uridylation13. However, only m6A10,14,15, m5C11,16,17, and pseudouridine18 have been mapped transcriptome-wide in Arabidopsis. Post-transcriptional mRNA base modifications are involved in several developmental processes19,20.
One of the most commonly used approaches in epitranscriptomics is the methylated RNA immunoprecipitation coupled with deep sequencing (MeRIP-seq). MeRIP-seq was developed in 2012 to study m6A in mammalian cells21,22. It requires the use of an antibody for the desired modification and aims to enrich for RNA fragments carrying the modified nucleotide(s). It is usually followed by deep sequencing to identify and map the enriched fragments or quantitative PCR to verify specific RNA targets. The accuracy of MeRIP is based on the specificity of the antibody to recognise the modified nucleotide over similar modifications (e.g., m5C and hm5C11,23). Besides m6A, MeRIP-seq has been also applied to study m1A and m5C RNA methylation in several organisms11,17,23,24,25.
Methylation of the cytosine at the fifth carbon position (m5C) is the most prevalent DNA modification26,27 and one of the most common RNA modifications too3,4. While m5C was detected in eukaryotic mRNAs in 197528, only recently have studies focused on mapping the modification transcriptome-wide, in coding and non-coding RNAs11,16,17,23,29,30,31,32,33,34.
Alternative methods used in m5C RNA research include chemical conversion of non-methylated cytosines into uracils (bisulfite sequencing) and immunoprecipitation assays based on an irreversible binding of a known RNA cytosine methyltransferase to its RNA targets (miCLIP, aza-IP). In brief, bisulfite sequencing exploits the feature of 5-methylated cytosine to be resistant to sodium bisulfite treatment that deaminates unmodified cytosines to uracil. The method was first developed for DNA but adapted for RNA too and many studies have chosen this approach to detect m5C sites in RNA16,23,29,32,34,35. Both miCLIP and aza-IP require previous knowledge of the RNA cytosine methyltransferase and use of the respective antibody. In the case of miCLIP (methylation individual-nucleotide-resolution crosslinking and immunoprecipitation), the methyltransferase carries a single amino acid mutation so that it binds to the RNA substrate but cannot be released30. In aza-IP (5-azacytidine&#8211;mediated RNA immunoprecipitation), the irreversible binding is formed between the 5-azaC nucleoside and the RNA cytosine methyltransferase when exogenously provided 5-azaC is incorporated by RNA polymerases into a target RNA molecule31.
The main advantage of these three methods is that they allow single nucleotide resolution mapping of m5C. In addition, miCLIP and aza-IP provide information about the specific targets of a selected RNA cytosine methyltransferase, deciphering deeper the mechanism and role of post-transcriptional RNA modifications. However, the MeRIP-seq approach can identify transcriptome-wide m5C regions without any previous knowledge required and avoids harsh chemical and temperature conditions, such as bisulfite treatment or incubation with 5-azaC. Both MeRIP and bisulfite sequencing can be inhibited by secondary RNA structures36. The fragmentation step that is included in the MeRIP assay prior to immunoprecipitation aims to facilitate antibody binding and increase the resolution of m5C identification.
Another method worth mentioning is mass spectrometry (MS) of RNA nucleosides. MS can detect and distinguish any type of modification both on DNA and on RNA. Briefly, RNA is extracted and DNase digested, then desalted and digested to single nucleosides. The RNA nucleosides are analyzed by a mass spectrometer. This method can be used to quantify the levels of each modification and it does not rely on an antibody or a chemical conversion. However, a major drawback is that it provides bulk information about the presence of RNA modifications. In order to map the modifications, MS needs to be combined with RNase digestion and sequencing information about specific RNA molecules, as in the case of human tRNALeu(CAA)37.
Here, we describe and discuss the MeRIP assay as used to study m5C RNA methylation in Arabidopsis17.

<table><tbody><tr><td>anti-m&lt;sup&gt;5&lt;/sup&gt;C antibody</td><td>ZymoResearch</td><td>A3001 (discontinued), A3002 available</td><td>Clone 10G4 (discontinued), 7D21 available</td></tr><tr><td>Chip and reagents for capillary electrophoresis</td><td>Agilent</td><td>5067-1511</td><td>RNA 6000 Nano kit</td></tr><tr><td>Dnase</td><td>Ambion</td><td>AM1907</td><td>TURBO DNA-free kit</td></tr><tr><td>Co-precipitant of nucleic acids</td><td>Ambion</td><td>AM9515</td><td>Glycoblue, 15 mg/mL</td></tr><tr><td>&lt;em&gt;In vitro&lt;/em&gt; transcription kit</td><td>Promega</td><td>P1300</td><td>T7 RiboMAX Large Scale RNA Production System</td></tr><tr><td>Low-binding reaction tubes</td><td>Kisker Biotech</td><td>G017</td><td>1.7 ml microcentrifuge tubes</td></tr><tr><td>Protein G magnetic beads</td><td>Invitrogen</td><td>10003D</td><td>Dynabeads Protein G</td></tr><tr><td>Proteinase K</td><td>Ambion</td><td>AM2546</td><td>20mg/mL stock solution, RNA grade</td></tr><tr><td>RNase inhibitor</td><td>Promega</td><td>N2615</td><td>RNasin Plus 40 U/&amp;mu;l</td></tr><tr><td>rRNA removal kit</td><td>Epicentre</td><td>RZPL11016</td><td>Ribo-Zero rRNA removal kit (Plant leaf)</td></tr><tr><td>Sonication tubes</td><td>Covaris</td><td>520045</td><td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td></tr><tr><td>RNA extraction reagent</td><td>Ambion</td><td>15596018</td><td>TRIzol reagent</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Capillary electrophoresis machine</td><td>Agilent</td><td>G2939BA</td><td>2100 Bioanalyzer System</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>12321D</td><td>DynaMag-2</td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>discontinued</td><td>5417R model</td></tr><tr><td>Rotator</td><td>Benchmark</td><td>R4040</td><td>RotoBot Mini</td></tr><tr><td>Sonicator</td><td>Covaris</td><td>500217</td><td>S220 Focused-ultrasonicator</td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-ONEC-W</td><td>NanoDrop OneC</td></tr><tr><td>Waterbath</td><td>GFL</td><td>1012</td><td>1012 Incubation bath</td></tr></tbody></table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and sequencing (MeRIP-seq) is a method that aims to enrich for methylated RNA and ultimately identify modified transcripts. Briefly, sonicated RNA is incubated with an antibody for 5-methylated cytosines and precipitated with the assistance of protein G beads. The enriched fragments are then sequenced and the potential methylation sites are mapped based on the distribution of the reads and peak detection. MeRIP can be applied to any organism, as it does not require any prior sequence or modifying enzyme knowledge. In addition, besides fragmentation, RNA is not subjected to any other chemical or temperature treatment. However, MeRIP-seq does not provide single-nucleotide prediction of the methylation site as other methods do, although the methylated area can be narrowed down to a few nucleotides. The use of different modification-specific antibodies allows MeRIP to be adjusted for the different base modifications present on RNA, expanding the possible applications of this method.

A schematic of the method is provided in Figure 1. The first critical steps of the protocol are to obtain RNA of good quality (RIN &#8805; 7) and sonicate it to approximately 100 nt fragments. The efficiency of both steps is examined by a chip-based capillary electrophoresis machine. In Figure 2A, a representative run of a good RNA sample is shown. The sample is diluted 1:10 before loading on the chip in order to have a concentration that is in the range of detection of the kit used (5-500 ng/&#181;L). The same sample is also run after sonication and is shown in Figure 2B. Notice the presence of one uniform peak shifted to the left of the diagram, at a size of around 100 nucleotides. The lower concentration is caused both by loss of RNA during fragmentation but also because of the increased volume of the samples (60-100 &#181;L, step 1.7.1).
The quality of the IP and Mock samples can be evaluated by qRT-PCR. To this end, the spiked-in IVTs serve as positive and negative controls: the methylated IVT, where in all cytosine positions there is m5C, is expected to be highly enriched in the IP sample; on the contrary, the non-methylated IVT should not have a difference between IP and Mock. The primers used in the qRT-PCR assay for the two control IVTs (EGFP and Renilla luciferase) are listed in Table 1. Indeed, as shown in Figure 3, around 80% of the methylated IVT was recovered in the IP sample, and only approximately 2% in the Mock. For the non-methylated control, the recovery was below 1% in both IP and Mock samples. This verifies the efficiency of MeRIP that methylated RNA fragments were precipitated and enriched, and is a good indicator that the samples can be used for downstream analysis. In addition, the fold enrichment of the non-methylated IVT (IP to Mock ratio) can be applied as a threshold to estimate significance of enrichment in the qRT-PCR assays.
After aligning the reads to the genome (Figure 4), the peak calling algorithms described in steps 3.4.1&#160;and 3.4.2&#160;are applied to identify the statistically significant windows, enriched in the IP samples compared to the Input. The sequences that correspond to these windows can be used further, for example to search for conserved methylation-related motifs11,17.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg" /> 
Figure 1: Schematic representation of MeRIP-seq protocol. 
RNA samples are incubated with an antibody for 5-methylated cytosines and the complexes are pulled down with protein G magnetic beads that capture the antibodies along with the bound RNA. The eluted RNA samples are analyzed by deep sequencing and qRT-PCR. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg" /> 
Figure 2: Representative results from quality analysis of RNA samples. 
(A) Representative profile of a qualified total RNA plant sample. (B) Representative profile of an RNA sample after sonication to 100 nt fragments. Output files from capillary electrophoresis software. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg" /> 
Figure 3: qRT-PCR analysis of control IVTs. 
Methylated and non-methylated in vitro transcripts were used as positive and negative controls of the MeRIP assay, respectively. After immunoprecipitation, the methylated IVT is highly enriched in the IP sample (green) but not in the Mock sample (without anti-m5C antibody; purple). The non-methylated IVT showed no enrichment and no difference between IP and Mock. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg" /> 
Figure 4: Read alignment before and after MeRIP around a representative transcript. 
Reads aligned to a specific transcript in the Input sample (top row) and in two IP replicates (middle and bottom row). The black box shows an identified enriched 50 nt long window based on MACS243 and MeRIP-seq22 peak-calling analyses. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target</td>
			<td colspan="2">Primer pair</td>
			<td colspan="2">Product sequence</td>
			<td>Product length</td>
		</tr>
		<tr>
			<td rowspan="2">EGFP</td>
			<td colspan="2">For: 5&#39;- GGCAACTACAAGACCCGCGCC -3&#39;</td>
			<td colspan="2" rowspan="2">GGCAACTACAAGACCCGCGCCGAG 
			GTGAAGTTCGAGGGCGACACCCTG 
			GTGAACCGCATCGAGCTGAAGGGC</td>
			<td rowspan="2">72 bp</td>
		</tr>
		<tr>
			<td colspan="2">Rev: 5&#39;- GCCCTTCAGCTCGATGCGGTT -3&#39;</td>
		</tr>
		<tr>
			<td rowspan="2">Renilla luciferase</td>
			<td colspan="2">For: 5&#39;- GGAGAATAACTTCTTCGTGGAAAC -3&#39;</td>
			<td colspan="2" rowspan="2">GGAGAATAACTTCTTCGTGGAAACC 
			ATGTTGCCATCAAAAATCATGAGAA 
			AGTTAGAACCAGAAGAATTTGCAGC</td>
			<td rowspan="2">75 bp</td>
		</tr>
		<tr>
			<td colspan="2">Rev: 5&#39;- GCTGCAAATTCTTCTGGTTCTAA -3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: Information about the primers and generated products for the qRT-PCR analysis.
Buffer Recipes.&#160; <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61231/Buffer Recipes MeRIP.xlsx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

The methylated RNA immunoprecipitation assay is an antibody-based method used to enrich for methylated RNA fragments. Coupled with deep sequencing, it leads to the identification of transcripts carrying the m5C modification.

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Universidad San Sebastian

Research

JoVE Journal

Genetics

6.5K Views.  Max Planck Institute of Molecular Plant Physiology. The methylated RNA immunoprecipitation assay is an antibody-based method used to enrich for methylated RNA fragments. Coupled with deep sequencing, it leads to the identification of transcripts carrying the m5C modification.

Video: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies have revealed that these reversible RNA modifications affect RNA splicing, translation, degradation, and localization. Multiple physiological processes, like circadian rhythms, stem cell pluripotency, fibrosis, triglyceride metabolism, and obesity are also controlled by m6A modifications. Immunoprecipitation/sequencing, mass spectrometry, and modified northern blotting are some of the methods commonly employed to measure m6A modifications. Herein, we present a northeastern blotting technique for measuring m6A modifications. The current protocol provides good size separation of RNA, better accommodation and standardization for various experimental designs, and clear delineation of m6A modifications in various sources of RNA. While m6A modifications are known to have a crucial impact on human physiology relating to circadian rhythms and obesity, their roles in other (patho)physiological states are unclear. Therefore, investigations on m6A modifications have immense possibility to provide key insights into molecular physiology.

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

A modified northern blotting method for measuring N6-methyladenosine (m6A) modifications in RNA is described. The current method can detect modifications in diverse RNAs and controls under various experimental designs.

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies ...

Biochemistry

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and especially methylations, has re-emerged due to the important roles played by the enzymes that write and erase them in biological processes relevant to disease and cancer. Here, a sensitive in vitro assay for accurate analysis of RNA methylation writer activity on synthetic or in vitro transcribed RNAs is provided. This assay uses a tritiated form of S-adenosyl-methionine, resulting in direct labeling of methylated RNA with tritium. The low energy of tritium radiation makes the method safe, and pre-existing methods of tritium signal amplification, make it possible to quantify and to visualize the methylated RNA without the use of antibodies, which are commonly prone to artifacts. While this method is written for RNA methylation, few tweaks make it applicable to the study of other RNA modifications that can be radioactively labeled, such as RNA acetylation with 14C acetyl coenzyme A. Overall, this assay allows to quickly assess RNA methylation conditions, inhibition with small molecule inhibitors, or the effect of RNA or enzyme mutants, and provides a powerful tool to validate and expand results obtained in cells.

Here, an antibody-free in vitro assay for direct analysis of methyltransferase activity on synthetic or in vitro transcribed RNA is described.

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and ...

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a variety of human retinal degenerative diseases and pinpoint new treatment approaches. The nuclear architecture of mouse retina is organized in two different patterns: conventional and inverted. Conventional pattern is universal where heterochromatin is localized to the periphery of the nucleus, while active euchromatin resides in the nuclear interior. In contrast, inverted nuclear pattern is unique to the adult rod photoreceptor cell nuclei where heterochromatin localizes to the nuclear center, and euchromatin resides in the nuclear periphery. DNA methylation is predominantly observed in chromocenters. DNA methylation is a dynamic covalent modification on the cytosine residues (5-methylcytosine, 5mC) of CpG dinucleotides that are enriched in the promoter regions of many genes. Three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) participate in methylation of DNA during development. Detecting 5mC with immunohistochemical techniques is very challenging, contributing to variability in results, as all DNA bases including 5mC modified bases are hidden within the double-stranded DNA helix. However, detailed delineation of 5mC distribution during development is very informative. Here, we describe a reproducible technique for robust immunohistochemical detection of 5mC and another epigenetic DNA marker 5-hydroxymethylcytosine (5hmC), which colocalizes with the &#34;open&#34;, transcriptionally active chromatin in developing and postmitotic mouse retina.

The objective of this report is to describe the protocol for robust immunohistochemical detection of epigenetic markers, 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in developing and postmitotic mouse retina.

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a ...

Developmental Biology

Characterizing RNA Modifications in Single Neurons Using Mass Spectrometry

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous system (CNS). Recent evidence has linked specific neuronal RNA modifications to learning and memory paradigms. Unfortunately, conventional methods for the detection of these epitranscriptomic features are only capable of characterizing highly abundant RNA modifications in bulk tissues, precluding the assessment of unique PTM profiles that may exist for individual neurons within the activated behavioral circuits. In this protocol, an approach is described&#8212;single-neuron RNA modification analysis by mass spectrometry (SNRMA-MS)&#8212;to simultaneously detect and quantify numerous modified ribonucleosides in single neurons. The approach is validated using individual neurons of the marine mollusk, Aplysia californica, beginning with surgical isolation and enzymatic treatment of major CNS ganglia to expose neuron cell bodies, followed by manual single-neuron isolation using sharp needles and a micropipette. Next, mechanical and thermal treatment of the sample in a small volume of buffer is done to liberate RNA from an individual cell for subsequent RNA digestion. Modified nucleosides are then identified and quantified using an optimized liquid chromatography-mass spectrometry method. SNRMA-MS is employed to establish RNA modification patterns for single, identified neurons from A. californica that have known morphologies and functions. Examples of qualitative and quantitative SNRMA-MS are presented that highlight the heterogeneous distribution of RNA modifications across individual neurons in neuronal networks.

Post-transcriptional modifications of RNA represent an understudied layer of translation regulation that has recently been linked to central nervous system plasticity. Here, sample preparation and liquid chromatography-tandem mass spectrometry approach is described for simultaneous characterization of numerous RNA modifications in single neurons.

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous ...

Chemistry

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA methyltransferases is viable, thus providing a system to study how loss of DNA methylation in a genome affects growth and development. Imprinting refers to differential expression of maternal and paternal alleles and plays an important role in reproduction development in both mammal and plants. DNA methylation is critical for determining whether the maternal or paternal alleles of an imprinted gene is expressed or silenced. In flowering plants, there is a double fertilization event in reproduction: one sperm cell fertilizes the egg cell to form embryo and a second sperm fuses with the central cell to give rise to endosperm. Endosperm is the tissue where imprinting occurs in plants. MEDEA, a SET domain Polycomb group gene, and FWA, a transcription factor regulating flowering, are the first two genes shown to be imprinted in endosperm and their expression is controlled by DNA methylation and demethylation in plants. In order to determine imprinting status of a gene and methylation pattern in endosperm, we need to be able to isolate endosperm first. Since seed is tiny in Arabidopsis, it remains challenging to isolate Arabidopsis endosperm and examine its methylation. In this video protocol, we report how to conduct a genetic cross, to isolate endosperm tissue from seeds, and to determine the methylation status by bisulfite sequencing.

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Imprinting is a phenomenon in plant and mammal reproduction. DNA methylation plays an important role in mechanisms of imprinting. Isolating endosperm and determining methylation status of imprinted genes in Arabidopsis can be difficult. In this protocol, we describe how to isolate endosperm and determine methylation by bisulfite sequencing.

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA ...

Biology

Detection of Histone Modifications in Plant Leaves

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent modifications on the amino-terminal tails of histones H3 and H4 play essential roles1-2. H3 and H4 histone modifications include methylation of lysine and arginine, acetylation of lysine, and phosphorylation of serine residues1-2. These modifications are associated either with gene activation, repression, or a primed state of gene that supports more rapid and robust activation of expression after perception of appropriate signals (microbe-associated molecular patterns, light, hormones, etc.)3-7. 
Here, we present a method for the reliable and sensitive detection of specific chromatin modifications on selected plant genes. The technique is based on the crosslinking of (modified) histones and DNA with formaldehyde8,9, extraction and sonication of chromatin, chromatin immunoprecipitation (ChIP) with modification-specific antibodies9,10, de-crosslinking of histone-DNA complexes, and gene-specific real-time quantitative PCR. The approach has proven useful for detecting specific histone modifications associated with C4 photosynthesis in maize5,11 and systemic immunity in Arabidopsis3.

A reliable and useful approach to detect histone modifications on specific plant genes is described. The approach combines chromatin immunoprecipitation (ChIP) and real-time quantitative PCR. It allows detection of histone modifications on specific genes with a role in diverse physiological processes.

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent ...

The Detection of 5-Hydroxymethylcytosine in Neural Stem Cells and Brains of Mice

Multiple&#160;DNA modifications have been identified in the mammalian genome. Of that, 5-methylcytosine and 5-hydroxymethylcytosine-mediated epigenetic mechanisms have been intensively studied. 5-hydroxymethylcytosine displays dynamic features during embryonic and postnatal development of the brain, plays a regulatory function in gene expression, and is involved in multiple neurological disorders. Here, we describe the detailed methods including immunofluorescence staining and&#160;DNA dot-blot to detect 5-hydroxymethylcytosine in cultured cells and brain tissues of mouse.

Here, we present a protocol to detect 5-hydroxymethylcytosine in cells and brain tissues, utilizing immunofluorescence staining and DNA dot-blot methods.

Multiple&#160;DNA modifications have been identified in the mammalian genome. Of that, 5-methylcytosine and 5-hydroxymethylcytosine-mediated epigenetic ...

Neuroscience

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as epitranscriptomics. Among others, N6-methyladenosine (m6A) and 5-methylcytosine (m5C) RNA modifications have been described on mRNA molecules and may have a role in modulating cellular processes. Epitranscriptomics is thus a new layer of regulation that must be considered in addition to transcriptomic analyses, as it can also be altered or modulated by exposure to any chemical or biological agent, including viral infections.
Here, we present a workflow that allows analysis of the joint cellular and viral epitranscriptomic landscape of the m6A and m5C marks simultaneously, in cells infected or not with the human immunodeficiency virus (HIV). Upon mRNA isolation and fragmentation from HIV- infected and non-infected cells, we used two different procedures: MeRIP-Seq, an RNA immunoprecipitation-based technique, to enrich for RNA fragments containing the m6A mark and BS-Seq, a bisulfite conversion-based technique, to identify the m5C mark at a single nucleotide resolution. Upon methylation-specific capture, RNA libraries are prepared for high-throughput sequencing. We also developed a dedicated bioinformatics pipeline to identify differentially methylated (DM) transcripts independently from their basal expression profile.
Overall, the methodology allows exploration of multiple epitranscriptomic marks simultaneously and provides an atlas of DM transcripts upon viral infection or any other cell perturbation. This approach offers new opportunities to identify novel players and novel mechanisms of cell response, such as cellular factors promoting or restricting viral replication.

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in viral infections is just starting to be explored and could highlight new viral-host interaction mechanisms. In this work, we provide a pipeline to investigate m6A and m5C RNA modifications in the context of viral infections.

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as ...

Methylated RNA Immunoprecipitation Assay to Study m⁵C Modification in Arabidopsis

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

A Method for Measuring RNA N⁶-methyladenosine Modifications in Cells and Tissues

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

Characterizing RNA Modifications in Single Neurons Using Mass Spectrometry

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Detection of Histone Modifications in Plant Leaves

The Detection of 5-Hydroxymethylcytosine in Neural Stem Cells and Brains of Mice

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Exploring m⁶A and m⁵C Epitranscriptomes upon Viral Infection: an Example with HIV