Name: combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits
Uploaded: 2018-03-14T14:30:00.000+00:00
Duration: 9 min 17 s
Description: Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

우리는 데모와 도움에 대 한 지원 및 카멜 Vitale F. Benfenati (Istituto 이탈리아 디 기술, IIT)을 감사 합니다. 이 작품은 IIT와 Compagnia 산 파올로 (부여 번호 9734 락)에 의해 투자 되었다.

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y., Leung, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA+Versus+miRNA+as+Therapeutics+for+Gene+Silencing.">siRNA Versus miRNA as Therapeutics for Gene Silencing.</a> Mol Ther-Nucl Acids. 4, e252 (2015).</li><li>Kohl, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemisphere-specific+optogenetic+stimulation+reveals+left-right+asymmetry+of+hippocampal+plasticity.">Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity.</a> Nat Neurosci. 14 (11), 1413-1415 (2011).</li><li>Maejima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+loss+of+P/Q-type+channels+confined+to+rhombic-lip-derived+neurons+alters+synaptic+transmission+at+the+parallel+fiber+to+purkinje+cell+synapse+and+replicates+genomic+Cacna1a+mutation+phenotype+of+ataxia+and+seizures+in+mice.">Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice.</a> J Neurosci. 33 (12), 5162-5174 (2013).</li><li>Mark, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delayed+postnatal+loss+of+P/Q-type+calcium+channels+recapitulates+the+absence+epilepsy,+dyskinesia,+and+ataxia+phenotypes+of+genomic+Cacna1a+mutations.">Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations.</a> J Neurosci. 31 (11), 4311-4326 (2011).</li><li>Thalhammer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+P/Q-Type+Ca2++Channels+Shapes+Presynaptic+Plasticity.">Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity.</a> Cell Rep. 20 (2), 333-343 (2017).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-phosphate-mediated+Transfection+of+Eukaryotic+Cells+with+Plasmid+DNAs.">Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs.</a> CSH Protoc. 2006 (1), (2006).</li><li>Chung, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycistronic+RNA+polymerase+II+expression+vectors+for+RNA+interference+based+on+BIC/miR-155.">Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155.</a> Nucleic Acids Res. 34 (7), e53 (2006).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> J Vis Exp. (57), e3348 (2011).</li><li>Cingolani, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity-dependent+regulation+of+synaptic+AMPA+receptor+composition+and+abundance+by+beta3+integrins.">Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins.</a> Neuron. 58 (5), 749-762 (2008).</li><li>Huang, H., Xu, Y., Cheng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+alternative+splicing+during+epithelial-mesenchymal+transition.">Detection of alternative splicing during epithelial-mesenchymal transition.</a> J Vis Exp. (92), e51845 (2014).</li><li>Vandesompele, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+normalization+of+real-time+quantitative+RT-PCR+data+by+geometric+averaging+of+multiple+internal+control+genes.">Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.</a> Genome Biol. 3 (7), (2002).</li><li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H., Osten, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stereotaxic+gene+delivery+in+the+rodent+brain.">Stereotaxic gene delivery in the rodent brain.</a> Nat Protoc. 1 (6), 3166-3173 (2006).</li><li>Paxinos, G., Franklin, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (2012).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2013).</li><li>Gunaydin, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+optogenetic+control.">Ultrafast optogenetic control.</a> Nat Neurosci. 13 (3), 387-392 (2010).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+of+alpha+1A+subunit+gene+generates+phenotypic+variants+of+P-+and+Q-type+calcium+channels.">Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.</a> Nat Neurosci. 2 (5), 407-415 (1999).</li><li>Chaudhuri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing+as+a+molecular+switch+for+Ca2+/calmodulin-dependent+facilitation+of+P/Q-type+Ca2++channels.">Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels.</a> J Neurosci. 24 (28), 6334-6342 (2004).</li><li>Soong, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+splice+variants+in+human+P/Q-type+channel+alpha1(2.1)+subunits:+implications+for+current+density+and+Ca2+-dependent+inactivation.">Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation.</a> J Neurosci. 22 (23), 10142-10152 (2002).</li><li>Berndt, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+channelrhodopsins+for+fast+neuronal+stimulation+at+low+light+levels.">High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels.</a> P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li><li>Klapoetke, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Independent+optical+excitation+of+distinct+neural+populations.">Independent optical excitation of distinct neural populations.</a> Nat Methods. 11 (3), 338-346 (2014).</li><li>Lin, J. Y., Lin, M. Z., Steinbach, P., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+engineered+channelrhodopsin+variants+with+improved+properties+and+kinetics.">Characterization of engineered channelrhodopsin variants with improved properties and kinetics.</a> Biophys J. 96 (5), 1803-1814 (2009).</li><li>Zhang, Y. P., Oertner, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+induction+of+synaptic+plasticity+using+a+light-sensitive+channel.">Optical induction of synaptic plasticity using a light-sensitive channel.</a> Nat Methods. 4 (2), 139-141 (2007).</li><li>Fowler, D. K., Williams, C., Gerritsen, A. T., Washbourne, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+knockdown+from+artificial+microRNAs+in+an+enhanced+miR-155+backbone:+a+designer's+guide+to+potent+multi-target+RNAi.">Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi.</a> Nucleic Acids Res. 44 (5), e48 (2016).</li></ol>

저자는 공개 없다.

Optogenetic 프로브와 관심의 연 접 유전자에 대 한 미르의 공동 식 연 접 기능 그대로 신경 회로 내에 유전자 최저의 효과 하 강력한 방식을 제공 합니다. 이 실험적인 접근에 대 한 확인 하 고는 매우 효율적이 고 선택적 네이티브 시스템에 관심사의 유전자를 노크에 미르의 특성 중요 하다. 가능 하면 최종 대상에서 효과 대 한 관심의 동일한 mRNA에 대해 두 개 이상의 독립적인 미르 제어에 사용 되어야 한다. 구조 실험, 미르 저항 유전자는 시스템에 재는 특이성에 대 한 제어로 사용할 수 있습니다.
optogenetic 표현 하 동일한 구문을 사용 하 여 프로브와 한 미르 광학 조작 되어 연 접 신경만을 자극에 대 한 수 있습니다. 이건 전기 stimulations 가능 때문에 그들은 감염 되 고 감염 되지 않은 신경, 따라서 생산 하는 혼합과 희석 결과 구분 하지 않습니다. 광 stimulations 여러 활동 전위15일으킬 수 있다, 때문에 가장 빠른 optogenetic 프로브는 확장 팔레트15,19,,2021중에서 선택 하는 것 중요 하다. 또한, 광 자극 연 접 boutons의 직접 도발은 유도 하지 않습니다, 하나22를 조사 하고자 하는 시 냅 시스 전송의 단계 중 일부를 무시 하지 않으려면를 위해 필수적입니다.
우리가 여기, 설명 실험적인 접근 (4-6 개월) 제한 된 기간 내 동시에 관심의 여러 연 접 유전자의 생리 적인 관련성을 평가 하 가능 하 게. 그러나, 그것은 명심 knockdowns 거의 100% 도달 하는 것이 중요입니다. 또한, rAAVs 초기 발달 과정을 조사 하는 경우 시간 제약 조건을 나타내는 optogenetic 조사의 최대 최저의 전체 표현에 대 한 수 있도록 최소한 2 주 동안 표현 될 필요가 있다. 비록 더 많은 시간이 소요, 조건부 녹아웃 쥐 연 접 신경에 제한 일반적으로 결과 관심사의 유전자의 제거를 완료 하 고 따라서 유효한 상호 보완적인 접근 방식을 제공.
미르 기술의 특정 장점은 같은 발기인에서 여러 미르의 식을 것 이다. 주로이 속성 같은 미르 또는 동일한 대상 유전자에 대 한 다른 미르의 여러 복사본을 삽입 하 여 최저 효율을 높이기 위해 사용 되었습니다. 그러나 그것은 수 하는 데 사용 또한 최저 여러 유전자 표현에 대 한 다른 대상 유전자7,23미르. 이 속성은 여러 연 접 단백질 신호 통로 연 접 부에 침묵 하 사용할 수 있습니다.
여기, 우리는 급성 hippocampal 조각에 연 접 기능에 유전자 최저의 효과 특성 인공 미르와 optogenetics를 결합 했다. 비슷한 접근 방식은 조작 하 고 신경 회로 vivo에서조사 또한 사용 될 수 있습니다. 또한, chemogenetic 인공 미르 결합 접근 것 가능 하나가 더 긴 시간의 척도에 신경 회로

이 프로토콜에는 연 접 기능 그대로 신경 회로 내에 유전자 최저의 효과 특성화 하는 새로운 접근 방식을 설명 합니다. 그대로 신경 회로에 연 접 기능을 조사 하는 것은 많은 연 접 boutons 너무 작기 때문에 및 멀리 결합된 분자와 electrophysiological 개입 있도록 소마에서 도전적 이다. RNA 간섭 최저의 시 냅 스 단백질1을 강력 하 고 유연한 방법을 제공 합니다, 하지만이 방법은 사용 되었습니다 아껴 서 최저 전통적인 사용의 효과 검출 하기 어렵기 때문에 연 접 기능을 조사 하 구분 하지 않는 전기 stimulations 조작 및 순진한 연 접 boutons2. 여기, 우리가 인공 예측에 관한 (미르)를 결합 하는 방법에 설명-급성 뇌 조각에 조작된 연 접 boutons의 선택적 자극을 달성 하기 위해 최근에 개발 된 optogenetic 기술로 RNA 간섭 중재.
전기 생리학 함께에서 조건부 녹아웃 쥐 연 접 단백질3,4의 기능을 조사 하기 위해 사용 될 수도, 하는 동안 우리의 전략 필요 하지 않은 개발 및 유지 보수의 유전자 마우스 라인을 수정 하 고 유전자의 특정 isoforms를 허물고 또한 쉽게 채택 될 수 있다. 더 일반적으로 상대적 사용된 짧은 헤어핀 RNAs (shRNAs), 우리 여기 사용 하 고, 인공 미르 뉴런에 최저에 대 한 주요 이점을 제공 합니다. ShRNAs, 달리는 중 합 효소 II 발기인1의 제어에서 표현할 수 있습니다. 따라서, 단일 발기인 미르의 형광 기자와 함께 optogenetic 프로브 식 드라이브를 사용할 수 있습니다. 이 방법에서는, 포장의 한계 내에서 재조합 형 adeno 관련 바이러스 (rAAV, 그림 1A)는 구조물의 크기를 보관할 수 있습니다. 또한, 단일 구조와 단일 발기인의 사용은 미르, optogenetic 프로브 및 고정된 비율에 형광 리포터의 표현에 대 한 허용 하기 때문에 실험적인 변화를 감소.
우리는 최근 마5연 접 칼슘 채널의 양자 택일로 접합된 isoforms의 역할을 검토 하는이 기술을 적용 했습니다. 이러한 전략의 어떤 두뇌 회로에 다른 presynaptically 표현한 단백질의 생리 적인 관련성을 공부에 일반적으로 적용 됩니다.

<table><tbody><tr><td>Acrylamide</td><td>Sigma</td><td>Acrylamide/Bis-acrylamide, 30% solution</td><td>Toxic</td></tr><tr><td>Animal Temperature Controller with heat pad</td><td>WPI</td><td>ATC2000</td><td></td></tr><tr><td>BCA protein assay kit</td><td>ThermoFisher Scientific</td><td>23225</td><td></td></tr><tr><td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td><td>ThermoFisher Scientific</td><td>K4936-00</td><td></td></tr><tr><td>Brain slices Prechamber</td><td>Harvard Apparatus</td><td>BSC-PC</td><td></td></tr><tr><td>CCD camera-based imager</td><td>Bio-Rad</td><td>ChemiDoc&amp;trade; MP</td><td></td></tr><tr><td>Cell Culture reagents</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Chemiluminescent substrate</td><td>GE Helthcare</td><td>ECL Western Blotting Reagents, RPN2106</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>C2432</td><td>Toxic</td></tr><tr><td>Cytosine &amp;beta;-D-arabinofuranoside</td><td>Sigma</td><td>C6645</td><td></td></tr><tr><td>Drill</td><td>Foredom</td><td>K.1030</td><td></td></tr><tr><td>EGTA</td><td>Sigma</td><td>E4378</td><td></td></tr><tr><td>Gentamicin ointment</td><td>Local pharmacy</td><td></td><td></td></tr><tr><td>Glucose</td><td>Sigma</td><td>G7021</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>54459</td><td></td></tr><tr><td>Injection micropipettes</td><td>Narishige</td><td>GD1</td><td></td></tr><tr><td>Inorganic salts &amp;amp; detergents</td><td>Sigma</td><td></td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;-creatine phosphate</td><td>Calbiochem</td><td>237911</td><td></td></tr><tr><td>KGluconate</td><td>Fluka</td><td>60245</td><td></td></tr><tr><td>Laser</td><td>Laserglow Technologies</td><td>LRS-0473-GFM-00100-03</td><td></td></tr><tr><td>Membrane</td><td>Amersham</td><td>Protran&amp;trade; 0.2 &amp;micro;m NC</td><td></td></tr><tr><td>MgATP</td><td>Sigma</td><td>A9187</td><td></td></tr><tr><td>Micropipette holder</td><td>Narishige</td><td>IM-H1</td><td></td></tr><tr><td>Micropipette puller</td><td>Narishige</td><td>PC-100</td><td></td></tr><tr><td>Na&lt;sub&gt;3&lt;/sub&gt;GTP</td><td>Sigma</td><td>G8877</td><td></td></tr><tr><td>NaPyruvate</td><td>Sigma</td><td>P5280</td><td></td></tr><tr><td>Ocular lubricant</td><td>Local pharmacy</td><td>Lacrigel</td><td></td></tr><tr><td>Phosphate inhibitors</td><td>Sigma</td><td>P0044, P5726</td><td></td></tr><tr><td>Protease inhibitors</td><td>Sigma</td><td>cOmplete&amp;trade;, EDTA-free Protease Inhibitor Cocktail</td><td></td></tr><tr><td>Protein gel electrophoresis and blotting devices</td><td>Bio-Rad</td><td>Mini-Protean III Cell</td><td></td></tr><tr><td>Providone iodine</td><td>Local pharmacy</td><td>Betadine</td><td></td></tr><tr><td>Qiazol Lysis Reagent</td><td>Qiagen</td><td>79306</td><td>Toxic</td></tr><tr><td>QuantiTect Reverse&lt;br/&gt; Transcription Kit</td><td>Qiagen</td><td>205311</td><td></td></tr><tr><td>RNeasy Micro Kit</td><td>Qiagen</td><td>74004</td><td></td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>Nanodrop 2000</td><td></td></tr><tr><td>Stereotactic apparatus</td><td>WPI</td><td></td><td></td></tr><tr><td>Tetrodotoxin</td><td>Tocris</td><td>1069</td><td>Toxic</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1200S</td><td></td></tr></tbody></table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

이 프로토콜의 목적은 그대로 신경 회로 내에서 연 접 기능에 유전자 최저의 효과 특성 이다. 우리 인공 예측에 관한 (미르)를 결합 하는 방법에 대 한 워크플로 설명-급성 뇌 조각에 조작된 연 접 boutons의 선택적 자극을 달성 하기 위해 optogenetics RNA 간섭 중재. 실험 방법은 단일 바이러스 성 구조 및 드라이브는 optogenetic 프로브 및 연 접 gene(s)에 대 한 인공 miR(s)의 식 단일 신경 특정 발기인의 사용을 포함. Stereotactically 관심 뇌 영역에 주입 때 표현된 구문 수 있습니다 빛 조사 gene(s)의 감소 식이 독점적으로 뉴런을 자극 하. 이 전략 개발 및 유전자 변형된 마우스 라인의 유지 관리를 필요로 하지 않습니다 하 고 적용할 수 있는 원리에 다른 유기 체 및 선택의 모든 신경 진. 우리는 최근 연 접 P/Q 유형 전압 개폐 칼슘 채널 (VGCCs)의 대체 스플라이스 isoforms의 최저 급성 hippocampal 조각에서 CA1 흥분 성의 시 냅 스에 CA3에서 단기 시 냅 스가 소성을 조절 하는 방법을 조사를 적용 했습니다. 비슷한 접근 방식은 조작 하 고 신경 회로 비보프로브 사용 될 수 있습니다.

위에서 설명한 절차 평가 방법 시 냅 스 전송 하는 강력한 방법을 연 접 신경에서 시 냅 스 단백질의 분해에 의해 영향을 제공 합니다. 대안의 최저 연 접 Cav2.1의 isoforms를 결합 하는 방법에 대 한 대표적인 결과 (P/Q 타입) VGCCs CA3 CA1 흥분 성의 시 냅 스는 예를 들어 아래에 주어진 하에서 단기 시 냅 스가 소성을 조절.
Cav2.1 (P/Q 유형) 채널은 중앙 신 경계에서 가장 빠른 시 냅 스에서 우세 연 접 VGCCs. 대체 상호 배타적인 exons의 접합 37a와 37b는 기 공 형성 α1 소 단위 Cav2.1 (α1A)의, 생산 하 고 2 개의 주요 이체 Cav2.1 [EFa] Cav2.1 [EFb]16,17 18. 확인 하려면 여부 Cav2.1 [EFa] 및 Cav2.1 [EFb] 차동 조절 시 냅 스 전송 및 쥐 hippocampal 피라미드 신경이 소성, 우리가 먼저 개발 isoform 특정 미르 최저를 선택적으로 Cav 2.1 [EFa] 또는 Cav2.1 [EFb]5. 짧은 크기에도 불구 하 고 (97 bp)와 높은 유사성 (뉴클레오티드 수준에서 61.86% 정체성) exons 사이 37a와 37b, 우리에 대 한 세 미르 시퀀스 디자인 수 Cav2.1 [EFa] 쥐 (미르 EFa1: TCCTTATAGTGAATGCGGCCG; 미르 EFa2: ATGTCCTTATAGTGAATGCGG; 미르 EFa3: TTGCAAGCAACCCTATGAGGA) 2 쥐 Cav2.1 [EFb]에 대 한 (미르 EFb1: ATACATGTCCGGGTAAGGCAT; 미르 EFb2: ATCTGATACATGTCCGGGTAA) 예측 높은 최저 효율. 부정적인 제어 (미르 제어), 우리는 어떤 알려진된 척 추가 있는 유전자를 대상 하지 않는 시퀀스를 포함 하는 pcDNA6.2-GW/EmGFP-미르-neg 플라스 미드를 사용 합니다. 우리 미르 EFa1 EFa3 미르, 미르 EFb2 선택 하 고 그들의 식 카세트에는 3' UTR rAAVs의 생산을 위해 설계 된 pAAV-Syn-ChETA-TdT-miR-X, 벡터의 복제 HEK 293 세포 분리 채널에 대 한 첫 번째 화면을 바탕으로, 어디에 synapsin 모터 드라이브 초고속 channelrhodopsin ChETA, 빨간색 형광 단백질 TdTomato 및 삽입 된 미르 (그림 1)의 표현. 우리는 또한 미르가이 미르의 때 려 눕 힘 효율성을 증가 하는 EFb2의 식 카세트를 중복.
다음으로, 우리 위의 4 구문에 대 한 rAAV1/2를 준비 하 고 계량 그들의 최저 효율 및 기본 쥐 신경 문화 isoform 특정 qRT-PCR를 사용 하 여 선택. EFa1 미르와 미르 EFa3 감소 기본 Cav2.1 [EFa] ~ 70%의 mRNA만 하지의 Cav2.1 [EFb] 미르 EFb 네이티브 캘리포니아v2.1 [EFb] ~ 60%의 mRNA만 하지 Cav2.1 [EFa] (그림 2)의 감소 하는 동안.
우리 다음 stereotactically 4 rAAV1/2의 각에 주입 (그림 3A-C), P18 쥐의 해 마의 CA3 영역 (A P/M-L/D-V Bregma에서) −2.6의 좌표 / ± 2.9 / −2.9. 15 ~ 20-4 일 후 주입, 우리 rAAV1/2 주입 쥐에서 급성 hippocampal 슬라이스를 준비 하 고 식 (그림 3B) rAAVs의 지역화를 확인 하려면 TdTomato 형광을 사용. CA1 시 냅 스에 CA3에서 단기 시 냅 스가 소성 연 접 최저 Cav2.1 [EFa] 또는 Cav2.1의 [EFb]에 영향을 받는지 조사, 우리 간단한 473 nm 레이저 광 펄스 (2 ms 동안에와 함께 선택적으로 감염된 CA3 신경 자극 ; 그림 3C) 패치 피라미드 뉴런 (그림 3C) CA1 영역의 중간 지 대에 인접 하 여 결과 EPSCs를 기록 했다. 우리는 Cav2.1 스플라이스 isoforms의 최저 영향 반대 방향으로 결합 펄스 자극에 응답을 발견: 최저 Cav2.1의 [EFa] 미르 EFa1 (미르 EFa3) 쌍 펄스 촉진 (PPF) 증가 반면 Ca의 최저 v2.1 [EFb] (미르 EFb2) 그것은 (그림 3D, E) 폐지.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg"> 그림 1: 체계는 초고속 optogenetic 프로브 ChETA 및 Cav2.1 [EFa] 및 Cav2.1 [EFb]에 대 한 isoform 특정 미르의 결합 된 표현에 대 한 구문입니다. (A) 는 rAAV의 지도 구성 pAAV-Syn-ChETA-TdT-miR-X, synapsin 발기인 (Syn)을 포함, 초고속 channelrhodopsin ChETA 융합 TdTomato 하 고에 근 3' UTR, Cav2.1 스플라이스 isoform 특정 미르. 표시 된 제한 효소는 단일 커터. (B) 식 카세트의 상단, 체계. Synapsin 모터 드라이브 ChETA TdTomato와 isoform 특정 미르의 표정. 하단, 미르 카세트의 일부를 구성 하는 21-뉴클레오티드 대상 시퀀스의 반전 보수. 미르 EFb2에 대 한 두 개의 동일한 미르 카세트는 다른 후 하나에 표현 되었다. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg"> 그림 2입니다. 최저 효율 및 Cav2.1 [EFa] 및 Cav2.1 [EFb] isoform 특정 미르의 선택의 평가. 17-18 DIV 기본 문화 중 Cav2.1 [EFa] (EFa1 미르와 미르 EFa3)을 대상으로 하는 미르를 표현 하는 rAAVs 6 DIV에 감염에서 분리 된 RNA에 Isoform 특정 qRT-PCR 분석 또는 Cav2.1 [EFb] (미르 EFb2). 데이터는 부정적인 제어 (미르 제어)로 정규화 됩니다. EFa1 미르와 미르 EFa3 크게 하 고 선택적으로 mRNA Cav2.1의 [EFa] 감소 (n = 8 및 7 문화, 각각), 미르 EFb 크게 하 고 선택적으로 감소 [EFb] 캘리포니아v2.1의 mRNA (n = 4 문화; * * * p < 0.001; 단방향의 분석 분산 테스트 테스트 후 Tukey Kramer에 의해 다음). 데이터는 ± SEM.를 의미 하는 대로 표시 됩니다. 이 그림에서 Thalhammer, A. 외 적응 되었습니다. 5. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg"> 그림 3입니다. Optogenetics와 노크 다운 신경의 자극을 대상으로 평가의 역할 Cav2.1 [EFa] 및 Cav2.1 [EFb] 여 기본 마. (A) 체계의 vivo에서 감염에 사용 되는 rAAV 구문 식 카세트입니다. ((B)) Hippocampal 섹션 TdTomato 형광 CA3 영역 및 그것의 계획을 보여주는. (C) 실험 구성: 레이저 빔 CA3 somata에 지시 했다 및 패치 클램프 기록 CA1 피라미드 뉴런에서 수행 했다. (D) 2 ms 동안 블루 (473 nm) 레이저 광 펄스 20 Hz에서 났는 데 연상 EPSCs 누구의 PPF 미르 Cav2.1 [EFa]을 대상으로 하 여 증가 하며 Cav2.1에 대 한 미르 [EFb]에 의해 폐지. (E) 요약 (D)에서 실험에 대 한 대응 펄스 비율의 증가에서 보여주는 PPF 미르 EFa1 EFa3 미르와 미르 EFb2에 대 한 감소에 대 한 미르 컨트롤에 상대적인 (n = 9-11 녹음; * p = 0.02; * * p = 0.01; * * * p < 0.0004, 공분산 분석). 데이터는 ± SEM.를 의미 하는 대로 표시 됩니다. 이 그림에서 Thalhammer, A. 외 적응 되었습니다. 5. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

이 프로토콜은 인공 예측에 관한 중재 RNA 간섭 그대로 신경 회로 내에서 선택적 gene(s)의 감소 식이 구체적으로 연 접 boutons를 자극 하는 optogenetics와 결합 하는 방법에 대 한 워크플로우를 제공 합니다.

연 접 기능 그대로 신경 회로 내에 유전자 최저 효과 특성 인공 microRNAs Optogenetics 결합

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Universidad San Sebastian

Research

JoVE Journal

Neuroscience

10.1K 조회수.  Istituto Italiano di Tecnologia. 이 프로토콜은 인공 예측에 관한 중재 RNA 간섭 그대로 신경 회로 내에서 선택적 gene(s)의 감소 식이 구체적으로 연 접 boutons를 자극 하는 optogenetics와 결합 하는 방법에 대 한 워크플로우를 제공 합니다.

비디오: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an entire gene expression pathway by inducing destruction and/or inhibiting translation of these targets. Several miRNAs play key roles in maintaining neuronal structure and function and in higher-level brain functions, and methods are sought for manipulating their levels for exploring these functions. Here, we present a direct in vivo method for examining the cognitive consequences of enforced miRNAs excess in mice by stereotactic injection of miRNA-encoding virus particles. Specifically, the current protocol involves injection into the hippocampal CA1 region, which contributes to mammalian memory consolidation, learning, and stress responses, and offers a convenient injection site. The coordinates are measured according to the mouse bregma and virus perfusion is digitally controlled and kept very slow. After injection, the surgery wound is sealed and the animals recover. Lentiviruses encoding silencers of the corresponding mRNA targets serve to implicate the specific miRNA/target interaction responsible for the observed effect, with na&iuml;ve mice, mice injected with saline and mice injected with "empty" lentivirus vectors as controls. One month post-injection, the animals are examined in the Morris Water Maze (MWM) for assessing their navigation learning and memory abilities. The MWM is a round tank filled with colored water with a small platform submerged 1 cm below the water surface. Steady visual cues around the tank allow for spatial navigation (sound and the earth's magnetic field may also assist the animals in navigating). Video camera monitoring enables measuring the route of swim and the time to find and amount the platform. The mouse is first taught that mounting the hidden platform offers an escape from the enforced swimming; it is then tested for using this escape and finally, the platform is removed and probe tests examine if the mouse remembers its previous location. Repeated tests over several consecutive days highlight improved performance of tested mice at shorter latencies to find and mount the platform, and as more direct routes to reach the platform or its location. Failure to show such improvement represents impaired learning and memory and/or anxiety, which may then be tested specifically (e.g. in the elevated plus maze). This approach enables validation of specific miRNAs and target transcripts in the studied cognitive and/or stress-related processes.

MicroRNAs have significant roles in brain structure and function. Here we describe a method to enforce hippocampal miRNA over-expression using stereotactic injection of an engineered miRNA-expressing lentivirus. This approach can serve as a relatively rapid way to assess the in vivo effects of over-expressed miRNAs in specific brain regions.

의 정위 주입 MicroRNA의 발현 마우스 해마 CA1 영역으로 렌티 바이러스 및 행동 결과의 평가

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an ...

연구

행동분석학

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

Optogenetic methods have emerged as a powerful tool for elucidating neural circuit activity underlying a diverse set of behaviors across a broad range of species. Optogenetic tools of microbial origin consist of light-sensitive membrane proteins that are able to activate (e.g., channelrhodopsin-2, ChR2) or silence (e.g., halorhodopsin, NpHR) neural activity ingenetically-defined cell types over behaviorally-relevant timescales. We first demonstrate a simple approach for adeno-associated virus-mediated delivery of ChR2 and NpHR transgenes to the dorsal subiculum and prelimbic region of the prefrontal cortex in rat. Because ChR2 and NpHR are genetically targetable, we describe the use of this technology to control the electrical activity of specific populations of neurons (i.e., pyramidal neurons) embedded in heterogeneous tissue with high temporal precision. We describe herein the hardware, custom software user interface, and procedures that allow for simultaneous light delivery and electrical recording from transduced pyramidal neurons in an anesthetized in vivo preparation. These light-responsive tools provide the opportunity for identifying the causal contributions of different cell types to information processing and behavior.

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

The recent development of neuroscience tools that combine genetics and optics, termed "optogenetics", enables control over neural circuit activity with an unprecedented level of spatial and temporal resolution. Here we provide a protocol for integrating in vivo recording with optogenetic manipulation of genetically-defined subsets of prefrontal cortical and subicular pyramidal neurons.

개별 피라미드 뉴런의 고 충실도 Optogenetic 제어하는​​ 방법<em&gt; 생체 내</em

Optogenetic methods  have emerged as a powerful tool for elucidating neural circuit activity  underlying a diverse set of behaviors across a broad range ...

신경과학

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the interactions of these forebrain circuits has been aided recently by the development of optogenetic methods for light-mediated modulation of neuronal activity. Here, we describe a protocol for examining the functional organization of forebrain circuits&#160;in vitro using laser-scanning photostimulation of channelrhodopsin, expressed optogenetically via viral-mediated transfection. This approach also exploits the utility of cre-lox recombination in transgenic mice to target expression in specific neuronal cell types. Following transfection, neurons are physiologically recorded in slice preparations using whole-cell patch clamp to measure their evoked responses to laser-scanning photostimulation of channelrhodopsin expressing fibers. This approach enables an assessment of functional topography and synaptic properties. Morphological correlates can be obtained by imaging the neuroanatomical expression of channelrhodopsin expressing fibers using confocal microscopy of the live slice or post-fixed tissue. These methods enable functional investigations of forebrain circuits that expand upon more conventional approaches.

We describe a method for characterizing the functional topography and synaptic properties of forebrain circuits using an optogenetic approach to photostimulate neuronal populations&#160;in vitro.

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the ...

Optogenetic Manipulation of Neuronal Activity to Modulate Behavior in Freely Moving Mice

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of single neurons and region-specific transmitter release, up to whole neuronal circuitries in the central nervous system, and allows the direct measurement of behavioral outcomes. Neurons express optogenetic tools via an injection of viral vectors carrying the DNA of choice, such as Channelrhodopsin2 (ChR2). Light is brought into specific brain regions via chronic optical implants that terminate directly above the target region. After two weeks of recovery and proper tool-expression, mice can be repeatedly used for behavioral tests with optogenetic stimulation of the neurons of interest.
Optogenetic modulation has a high temporal and spatial resolution that can be accomplished with high cell specificity, compared to the commonly used methods such as chemical or electrical stimulation. The light does not harm neuronal tissue and can therefore be used for long-term experiments as well as for multiple behavioral experiments in one mouse. The possibilities of optogenetic tools are nearly unlimited and enable the activation or silencing of whole neurons, or even the manipulation of a specific receptor type by light.
The results of such behavioral experiments with integrated optogenetic stimulation directly visualizes changes in behavior caused by the manipulation. The behavior of the same animal without light stimulation as a baseline is a good control for induced changes. This allows a detailed overview of neuronal types or neurotransmitter systems involved in specific behaviors, such as anxiety. The plasticity of neuronal networks can also be investigated in great detail through long-term stimulation or behavioral observations after optical stimulation. Optogenetics will help to enlighten neuronal signaling in several kinds of neurological diseases.

With optogenetic manipulation of specific neuronal populations or brain regions, behavior can be modified with high temporal and spatial resolution in freely moving animals. By using different optogenetic tools in combination with chronically implanted optical fibers, a variety of neuronal modulations and behavioral testing can be performed.

자유롭게 움직이는 마우스에 있는 행동을 조절하기 위하여 신경 활동의 광유전학 조작

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of ...

A Simple Alternative to Stereotactic Injection for Brain Specific Knockdown of miRNA

MicroRNAs (miRNAs) are key regulators of gene expression. In the brain, vital processes like neurodevelopment and neuronal functions depend on the correct expression of microRNAs. Perturbation of microRNAs in the brain can be used to model neurodegenerative diseases by modulating neuronal cell death. Currently, stereotactic injection is used to deliver miRNA knockdown agents to specific location in the brain. Here, we discuss strategies to design antagomirs against miRNA with locked nucleotide modifications (LNA). Subsequently describe a method for brain specific delivery of antagomirs, uniformly across different regions of the brain. This method is simple and widely applicable since it overcomes the surgery, associated injury and limitation of local delivery in stereotactic injections. We prepared a complex of neurotropic, cell-penetrating peptide Rabies Virus Glycoprotein (RVG) with antagomir against miRNA-29 and injected through tail vein, to specifically deliver in the brain. The antagomir design incorporated features that allow specific targeting of the miRNA and formation of non-covalent complexes with the peptide. The knock-down of the miRNA in neuronal cells, resulted in apoptotic cell death and associated behavioural defects. Thus, the method can be used for acute models of neuro-degeneration through the perturbation of miRNAs.

MicroRNAs play crucial roles in the brain and are potential targets for modeling neuro-degeneration. However, perturbing miRNA levels is challenging due to the short length of miRNA and inaccessibility of the brain tissue. This video presents a method for antagomir design and brain specific delivery using a neuropeptide in mice.

miRNA의 뇌의 특정 최저 대한 정위 주입하는 간단한 대안

MicroRNAs (miRNAs) are key regulators of gene expression.  In the brain, vital processes like neurodevelopment and neuronal functions depend on the ...

Optogenetic Manipulation of Neural Circuits During Monitoring Sleep/wakefulness States in Mice

In recent years, optogenetics has been widely used in many fields of neuroscientific research. In many cases, an opsin, such as channel rhodopsin 2 (ChR2), is expressed by a virus vector in a particular type of neuronal cells in various Cre-driver mice. Activation of these opsins is triggered by application of light pulses which are delivered by laser or LED through optic cables, and the effect of activation is observed with very high time resolution. Experimenters are able to acutely stimulate neurons while monitoring behavior or another physiological outcome in mice. Optogenetics can enable useful strategies to evaluate function of neuronal circuits in the regulation of sleep/wakefulness states in mice. Here we describe a technique for examining the effect of optogenetic manipulation of neurons with a specific chemical identity during electroencephalogram (EEG) and electromyogram (EMG) monitoring to evaluate the sleep stage of mice. As an example, we describe manipulation of GABAergic neurons in the bed nucleus of the stria terminalis (BNST). Acute optogenetic excitation of these neurons triggers a rapid transition to wakefulness when applied during NREM sleep. Optogenetic manipulation along with EEG/EMG recording can be applied to decipher the neuronal circuits that regulate sleep/wakefulness states.

Here, we describe methods of optogenetic manipulation of particular types of neurons during monitoring of sleep/wakefulness states in mice, presenting our recent work on the bed nucleus of the stria terminalis as an example.

마우스에서 수면/각성 상태를 모니터링하는 동안 신경 회로의 광유전학 적 조작

In recent years, optogenetics has been widely used in many fields of neuroscientific research. In many cases, an opsin, such as channel rhodopsin 2 ...

Assaying Circuit Specific Regulation of Adult Hippocampal Neural Precursor Cells

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate new neurons, which integrate into an existing neural circuit and contribute to specific hippocampal functions. Importantly, adult neurogenesis is highly susceptible to environmental stimuli, which allows for activity-dependent regulation of various cognitive functions. A vast range of neural circuits from various brain regions orchestrates these complex cognitive functions. It is therefore important to understand how specific neural circuits regulate adult neurogenesis. Here, we describe a protocol to manipulate neural circuit activity using designer receptor exclusively activated by designer drugs (DREADDs) technology that regulates NSCs and newborn progeny in rodents. This comprehensive protocol includes stereotaxic injection of viral particles, chemogenetic stimulation of specific neural circuits, thymidine analog administration, tissue processing, immunofluorescence labeling, confocal imaging, and imaging analysis of various stages of neural precursor cells. This protocol provides detailed instructions on antigen retrieval techniques used to visualize NSCs and their progeny and describes a simple, yet effective way to modulate brain circuits using clozapine N-oxide (CNO) or CNO-containing drinking water and DREADDs-expressing viruses. The strength of this protocol lies in its adaptability to study a diverse range of neural circuits that influence adult neurogenesis derived from NSCs.

The goal of this protocol is to describe an approach for analyzing behavior of adult neural stem/progenitor cells in response to chemogenetic manipulation of a specific local neural circuit.

성인 해마 신경 전구세포의 회로 특정 조절 을 시술

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate ...

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. Traditional in vitro electrophysiological techniques use electrical stimulation to evoke synaptic transmission. A major drawback of this method is its nonspecific nature; all axons in the region of the stimulating electrode will be activated, making it difficult to attribute an effect to a particular afferent connection. This issue can be overcome by replacing electrical stimulation with optogenetic-based stimulation. We describe a method for combining optogenetics with in vitro patch-clamp recordings. This is a powerful tool for the study of both basal synaptic transmission and synaptic plasticity of precise anatomically defined synaptic connections and is applicable to almost any pathway in the brain. Here, we describe the preparation and handling of a viral vector encoding channelrhodopsin protein for surgical injection into a pre-synaptic region of interest (medial prefrontal cortex) in the rodent brain and making of acute slices of downstream target regions (lateral entorhinal cortex). A detailed procedure for combining patch-clamp recordings with synaptic activation by light stimulation to study short- and long-term synaptic plasticity is also presented. We discuss examples of experiments that achieve pathway- and cell-specificity by combining optogenetics and Cre-dependent cell labeling. Finally, histological confirmation of the pre-synaptic region of interest is described along with biocytin labeling of the post-synaptic cell, to allow further identification of the precise location and cell type.

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Here we present a protocol describing viral transduction of discrete brain regions with optogenetic constructs to permit synapse-specific electrophysiological characterization in acute rodent brain slices.

생체 외 내측 전두엽 피질에서 외측 내후각 피질까지의 장거리 시냅스 전달 및 가소성에 대한 광유전학적 심문

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. ...

Using Optogenetics to Reverse Neuroplasticity and Inhibit Cocaine Seeking in Rats

This protocol demonstrates the steps needed to use optogenetic tools to reverse cocaine-induced plasticity at thalamo-amygdala circuits to reduce subsequent cocaine seeking behaviors in the rat. In our research, we had found that when rats self-administer intravenous cocaine paired with an audiovisual cue, synapses formed at inputs from the medial geniculate nucleus of the thalamus (MGN) onto principal neurons of the lateral amygdala (LA) become stronger as the cue-cocaine association is learned. We hypothesized that reversal of the cocaine-induced plasticity at these synapses would reduce cue-motivated cocaine seeking behavior. In order to accomplish this type of neuromodulation in vivo, we wanted to induce synaptic long-term depression (LTD), which decreases the strength of MGN-LA synapses. To this end, we used optogenetics, which allows neuromodulation of brain circuits using light. The excitatory opsin oChiEF was expressed on presynaptic MGN terminals in the LA by infusing an AAV containing oChiEF into the MGN. Optical fibers were then implanted in the LA and 473 nm laser light was pulsed at a frequency of 1 Hz for 15 minutes to induce LTD and reverse cocaine induced plasticity. This manipulation produces a long-lasting reduction in the ability of cues associated with cocaine to induce drug seeking actions.

The methods described here outline a procedure used to optogenetically reverse cocaine-induced plasticity in a behaviorally-relevant circuit in rats. Sustained low-frequency optical stimulation of thalamo-amygdala synapses induces long-term depression (LTD). In vivo optogenetically-induced LTD in cocaine-experienced rats resulted in the subsequent attenuation of cue-motivated drug seeking.

광유전학을 사용하여 신경 가소성을 역전시키고 쥐에서 코카인 추구를 억제

This protocol demonstrates the steps needed to use optogenetic tools to reverse cocaine-induced plasticity at thalamo-amygdala circuits to reduce ...

Drosophila Optogenetics: A Method to Manipulate Neuronal Circuits

Source: de Vries, S. E., Clandinin, T. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/50192/" target="_blank">Optogenetic Stimulation of Escape Behavior in Drosophila melanogaster</a>. J. Vis. Exp. (2013).
Optogenetics enables the use of light to manipulate neurons that are genetically engineered to express specific opsins&#8211;light-sensitive proteins whose light activation triggers a change in the state of the neuron. Here we describe an optogenetic approach in Drosophila using the opsin Channelrhodopsin2. The example protocol features an optogenetics assay set to study the neuronal circuitry behind the fly&#39;s escape behavior.

초파리 광유전학: 신경 회로를 조작하는 방법

Source: de Vries, S. E., Clandinin, T. Optogenetic Stimulation of Escape Behavior in Drosophila melanogaster. J. Vis. Exp. (2013).
Optogenetics enables ...

연 접 기능 그대로 신경 회로 내에 유전자 최저 효과 특성 인공 microRNAs Optogenetics 결합

요약

더 많은 비디오 탐색

이 비디오의 챕터

의 정위 주입 MicroRNA의 발현 마우스 해마 CA1 영역으로 렌티 바이러스 및 행동 결과의 평가

개별 피라미드 뉴런의 고 충실도 Optogenetic 제어하는 방법

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

자유롭게 움직이는 마우스에 있는 행동을 조절하기 위하여 신경 활동의 광유전학 조작

miRNA의 뇌의 특정 최저 대한 정위 주입하는 간단한 대안

마우스에서 수면/각성 상태를 모니터링하는 동안 신경 회로의 광유전학 적 조작

성인 해마 신경 전구세포의 회로 특정 조절 을 시술

생체 외 내측 전두엽 피질에서 외측 내후각 피질까지의 장거리 시냅스 전달 및 가소성에 대한 광유전학적 심문

광유전학을 사용하여 신경 가소성을 역전시키고 쥐에서 코카인 추구를 억제

초파리 광유전학: 신경 회로를 조작하는 방법

연 접 기능 그대로 신경 회로 내에 유전자 최저 효과 특성 인공 microRNAs Optogenetics 결합

요약

더 많은 비디오 탐색

이 비디오의 챕터

의 정위 주입 MicroRNA의 발현 마우스 해마 CA1 영역으로 렌티 바이러스 및 행동 결과의 평가

개별 피라미드 뉴런의 고 충실도 Optogenetic 제어하는​​ 방법

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

자유롭게 움직이는 마우스에 있는 행동을 조절하기 위하여 신경 활동의 광유전학 조작

miRNA의 뇌의 특정 최저 대한 정위 주입하는 간단한 대안

마우스에서 수면/각성 상태를 모니터링하는 동안 신경 회로의 광유전학 적 조작

성인 해마 신경 전구세포의 회로 특정 조절 을 시술

생체 외 내측 전두엽 피질에서 외측 내후각 피질까지의 장거리 시냅스 전달 및 가소성에 대한 광유전학적 심문

광유전학을 사용하여 신경 가소성을 역전시키고 쥐에서 코카인 추구를 억제

초파리 광유전학: 신경 회로를 조작하는 방법

개별 피라미드 뉴런의 고 충실도 Optogenetic 제어하는 방법