Name: guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing
Uploaded: 2018-03-19T13:30:00.000+00:00
Duration: 8 min 5 s
Description: Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

이 작품-코어 프로그램 (부여 번호 41/11), 이스라엘 과학 재단 (그랜트 908/15), 유럽 크 론 및 Colitis 조직 (헴)에 의해 부분적으로 지원 되었다.

연구를 위한 윤리적인 승인 했다 시바 지역 연구 윤리 위원회에 의해 그리고 모든 방법을 관련 지침 및 규정에 따라 수행 합니다. 프로토콜 받은 환자 동의 예외 지역 윤리 검토 보드에서 사용 했다 배설물 소재부터 이미 제출 했다 미생물학 코어 나이, 다른 환자 식별 정보 없이 임상 검사 결과의 일부로 서 성별와 미생물 결과 이다입니다. 작성, 동의 건강 한 지원자에서 얻은 고 기관 검토 위원회 승인 연구. 그 샘플 중 일부는 이미 이전 분석1에 포함 되었습니다.
1. 샘플 처리
<ol><li>수집 된 약 5 m m2 얼룩 (대략 연필 지우개의 크기) 테스트에서 멸 균 면봉으로 신선한 배설물 샘플에서 튜브 ( 재료의 표참조). 24 시간 이내-80 ° C에서 배설물 샘플을 포함 하는 모든 면봉을 저장 합니다. 지저분한 면봉 추가 처리까지 거기 남아 있을 수 있습니다.</li>
</ol>2. DNA 추출
<ol><li>추출 및 희석 솔루션 실 온에서 해 동 ( 재료의 표참조).</li>
	<li>이동 빈 2 mL 컬렉션에 지저분한 면봉 튜브 ( 재료의 표참조). 크기를 조정할 면봉 스틱 절단 하 여 교차 오염을 최소 관 폐쇄를 사용 하는 깨끗 한가 위를 사용 하 여. 지저분한 면봉 및 혼합 소용돌이 포함 하는 각 컬렉션 튜브를 추출 솔루션의 250 μ를 추가 합니다.</li>
	<li>끓는 물 탕에서 10 분 샘플 열 (95-100° C). 각 샘플을 소용돌이를 섞어 희석 솔루션의 250 μ를 추가 합니다.</li>
	<li>추출 된 DNA와 4 ° c.에 면봉을 포함 하는 2 mL 튜브를 저장</li>
</ol>3. PCR 및 라이브러리 준비
3.1 및 3.2 단계, 깨끗 한, 제공 하는 PCR 워크스테이션에서 작동 템플릿과 amplicon 무료 환경.
<ol><li>라벨 바코드에 따라 프라이 머 (표 1). 두 배 증류수 (DDW) 50 μ M 농도-20 ° c.에가을에서 각 뇌관을 희석</li>
	<li>96 잘 접시를 사용 하 여 PCR 반응에 대 한. 각 플레이트는 32 다른 인덱스 뇌관에 의해 표 32 다른 샘플을 포함할 수 있습니다. 앞으로 뇌관 및 실 온에서 32 역 뇌관 thaw 그리고 5 μ M에 그들을 희석.</li>
	<li>5 μ M 앞으로 뇌관, 1 mL 2 X PCR 마스터 믹스, 그리고 400 μ DDW의 100 μ를 혼합 하 여 100 반응 (각 잘에서 최종 볼륨 20 μ를 있을 것입니다)에 대 한 PCR 반응 혼합을 준비 합니다. 각 잘 (총 96 웰 스)이 PCR 혼합의 15 μ를 넣어. 3 다른 웰 스 (triplicates에서 32 다른 뇌관 96 웰 스의 총을 제공)을 각 5 μ M 역 인덱싱된 뇌관의 1 μ를 추가 합니다.</li>
	<li>사전-PCR 전용된 영역에서 의미는 템플릿과 amplicon 무료, 클린 벤치 추가 각 추출 된 DNA 샘플의 4 μ 반응 혼합물에 (각 추출 된 DNA 샘플 3 중에서 증폭-96 잘 접시 당 32 샘플).</li>
	<li>다음 설정으로 PCR을 실행: 3 분;에 대 한 94 ° C의 초기 변성 뒤에 1 분, 1 분, 그리고 1 분; 72 ° C에서 확장 하는 55 ° C에서 열 처리 변성 94 ° C에서의 35 주기 그리고 10 분 동안 72 ° C에서 최종 확장.</li>
	<li>게시물-PCR 전용된 영역으로 정의 됩니다, 다른 벤치에 단일 볼륨 관 (60 μ 샘플 당)으로 각 triplicate PCR 반응 결합.</li>
	<li>PCR amplicons의 품질 평가, ethidium 평범한 사람 얼룩이 1 %agarose 젤에 각 결합 PCR 반응의 4 μ를 실행 합니다. 260의 UV 파장에서 nm, 긍정적인 amplicons 375-425 bp의 예상된 밴드 크기에 표시 됩니다. 이러한 amplicons만 후속 단계에 포함 됩니다. 참고: 각 샘플은 각 샘플 3 다른 PCR 반응에서 증폭 되어 triplicate, 의미에서 증폭 된다. 확장 하지 마십시오.</li>
</ol>4. 도서관 정량화 및 청소
<ol><li>얻기 위해서 모든 PCR 샘플의 아데닌 농도 수영장, 두 배 좌초 된 DNA에 의해 각 amplicon 계량 (dsDNA 계량 시 약) 형광 핵 산 얼룩 ( 재료의 표참조), 큰의 동시 정량화에 적합 샘플의 크기입니다. 참고: 이후는 amplicon의 크기 범위는 다의 적, nanograms에 실제 금액 아데닌 농도 로드 하는 데 사용 됩니다.</li>
	<li>단일, 무 균 튜브에 각 샘플의 조합 500 ng. 소용돌이를 섞어입니다.</li>
	<li>Ethidium 평범한 사람 얼룩이 1 %agarose 젤에 풀링된 도서관의 200 μ를 실행 합니다. 제조업체의 지침에 따라 젤 추출 키트를 사용 하 여 젤에서 375-425 bp 밴드를 추출 ( 재료의 표참조) 및 80 μ DDW에서에서 풀링된 라이브러리 elute. 참고: 풀링된 라이브러리 크기 호스트 DNA에서에서 일반적인 증폭 제품을 선택 해야 합니다.</li>
	<li>매우 민감한 dsDNA 키트 제조업체의 지침에 따라 검색을 사용 하 여 최종 라이브러리 농도 측정 ( 재료의 표참조). 제조업체의 지침에 따라 DNA 라이브러리에 대 한 매우 민감한 분리 및 분석 키트를 사용 하 여 정확한 라이브러리 크기 측정 ( 재료의 표참조).</li>
</ol>5입니다. 시퀀싱
<ol><li>오후 7 시에 20% 컨트롤 라이브러리의 추가 함께 풀링된 라이브러리를 희석 ( 재료의 표참조), 시퀀싱 시스템 프로토콜에 따라.</li>
	<li>시퀀싱에 대 한 사용 하 여 사용자 정의 설계 무료 v 4 증폭 뇌관 ( 표 1참조)에 뇌관 읽기.</li>
	<li>3 사용 하 여 사용자 지정 설계 된 시퀀싱 뇌관 추가에 바코드를 읽는 주기 ( 표 1참조) 하 고 제조업체의 사양에 따라 각 방향으로 길이 175 기지의 쌍 간 읽기를 생성 합니다.</li>
	<li>시퀀싱 컴퓨터를 실행 하 고 제조 업체의 프로토콜에 따라 FASTQ 파일을 구하십시오.</li>
</ol>6입니다. 데이터 처리
<ol><li>함께 꿰 매 고 QIIME 2 버전 2017.7.017에서 구현 된 데이터 큐레이터 파이프라인에서 겹치는 쌍-엔드 FASTQ 파일을 처리 합니다. 샘플 특정 바코드에 따라 읽기 demultiplex</li>
	<li>DADA218 를 사용 하 여 품질 관리 및 시퀀스 변종 (SVs) 감지. 2 개 이상의 예상 오류 삭제 읽고 3' 끝에서 13 기지와 5' 끝에서 15 기지에서 읽기를 자릅니다. 식별 하 고 일치 메서드를 사용 하 여 키메라를 제거-키메라 샘플에서 개별적으로 검색 되 고 시퀀스에 충분 한 샘플 공상 발견 제거 됩니다.</li>
	<li>SVs 분류학 분류 Naive Bayes 장착 분류자를 사용 하 여 수행, 8 월 2013에 훈련 99% 신원 Greengenes6, 175 데이터베이스 오래 읽기 및 설정/역회전 뇌관.</li>
	<li>2146 시퀀스의 깊이에 모든 샘플 rarefy</li>
	<li>Β에 희박된 샘플 (샘플 다양성19,20) 사이 다양성의 측정을 위한 Unweighted UniFrac를 사용 하 여 샘플 크기 효과 피하기 위해.</li>
	<li>주 좌표 분석 (PCoA) 수행 결과 거리 매트릭스를 사용 합니다. 참고: 데이터 처리 스크립트 및 매핑 파일 (보충 자료 1 과 2) 보충 자료로 제공 됩니다.</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

저자는 공개 없다.

16S rRNA amplicon 및 metagenomics 샷건 시퀀싱 임상 미생물학 응용 프로그램21,22,23에서 인기를 얻고 있다. 이러한 기술은 캡처 culturable와 비 culturable taxa, 병원 성 inoculum 그리고 더 정확 하 게 polymicrobial 감염을 식별 하는 능력의 상대적 풍요에 대 한 데이터를 제공 하는 증가 기능에 유리한 24지문. 미생물 연구의 분야에서 진보는 다양 한 접근법에 일관성의 부족으로 인해 쉽게 비교할 데이터의 방대한 생성. 최근 몇 년 동안, 여러 컨소시엄은 이러한 문제를 해결 하려고 했습니다. 이 프로토콜 지구 microbiome 프로젝트 (EMP)와 비슷한 라이브러리 준비는 다음과 같습니다. 그러나, 추가 분석 파이프라인을 통해 배설물 샘플에서 DNA 추출에 대 한 자세한 단계별 프로토콜이입니다.
이전, 16S rRNA 시퀀싱 배설물 샘플 의심된 전염 성 설사, 전통 문화 결과 입원된 환자와 건강 한 비 입원 과목에서의 미생물 조성 패턴의 특성에 사용 되었습니다. 그 분석에서 결과 입원된 환자에 있는 깊은 증가 taxa Proteobacteria 문1에서 보였다. 여기에 설명 된 방법을 사용 하는 직접 PCR 열 무료 원래 설계 된 추출 식물 DNA16의 16S rRNA 유전자 amplicon 시퀀싱에 대 한 광범위 하 게 사용 되는 방법의 통합된 프로토콜이입니다. 이 이렇게 고 수 있습니다 효율적으로 신속 하 게 높은 처리량 16S rRNA 시퀀싱에 대 한 적합 한 샘플의 많은 수에서 16S rRNA 유전자의 V4 변수 영역을 대상으로 하는 좋은-품질 증폭 DNA 라이브러리를 추출.
이것은 DNA 기반 시퀀싱 방법, aerobes 및 anaerobes 미생물 지역 사회는 개별 배설물 샘플에 존재에 데이터 얻을 수 있습니다. 프로토콜 채택 했다 16S rRNA 유전자의 v 4 지역에 대 한 원래 설계 된15 뇌관. 중요 한 것은, 반전 증폭 뇌관 각 레인15최대 2,167 다른 샘플의 풀링을 지 원하는 12 기본 바코드 시퀀스를 포함 합니다. 앞으로 확대 뇌관 쌍-엔드 시퀀싱 시퀀싱 플랫폼25 (표 1 및 보충 자료 3)에 지 원하는 어댑터 지역에서 9 개의 여분 기초를 포함 합니다. 이 이렇게 활성화 처리는 라이브러리 샘플 당 ~ 30 달러의 비용에서 샘플 당 10622.57 ± 1211.34 (평균 ± 표준 오차) 읽기의 실행 깊이와 1 차선에서 시퀀싱 된 250 분 변 샘플의 구성.
품질 관리를 보장 하기 위해, 우리는 다음과 같은 부정적인 컨트롤;를 사용 하 여 제안 i) DNA 템플렛, ii 없이 PCR) 깨끗 한 멸 균 면봉, 및 iii에서 추출 된 DNA에서 PCR)에 PCR 혼합 추출 및 희석 솔루션. 긍정적인 통제에 관해서는 같은 대변 샘플에서 유래 하지만 다른 역방향 바코드 뇌관 및 샘플 다른 라이브러리 준비 이전 실행에서 내부 품질 관리로 관통 하는 샘플을 포함 하는 것이 좋습니다. 메모의 다른 옵션으로 긍정적인 제어 사용 되는 NIST에서 제공 그 미생물 측정 표준입니다. 평균 범위 부정적인 컨트롤에 대 한 실제 대변 샘플 (표 1)에 비해 현저 하 게 낮은 이며 Mycoplasma taxa에서 주로 구성 했다 읽습니다. 우리는 더 각 같은 배설물 소재에서 유래 하지만 그 다른 라이브러리 준비 (그림 3)를 관통 하는 샘플을 사용 하 여 얻은 시퀀싱 결과의 일관성을 보여주었다. 이 결과 또한 때 우리의 통합된 메서드를 사용 하는 교차 오염 없이 샘플 사이 확인 한다.
이 프로토콜에 많은 수의 샘플을 분석 하는 통합 된 제복, 가능한 프로토콜을 소개 합니다. 이 프로토콜 과학자 16S rRNA amplicon 시퀀싱의 사용을 시작 하는 데이터 분석, 지저분한 컬렉션에서 강력한, 생식, 사용 하기 쉬운, 저렴, 자세한 방법에서에 관심이 중요 한 컨트롤을 사용 하 여 안내 하는 것을 목표로. 이 표준화 된 상세한 가이드 프로토콜을 사용 하 배치 효과 최소화 하 고 다른 연구소 사이 더 비교 시퀀싱 결과 허용 수 있습니다.

미생물 다양 성과 풍요, 건강 하 고 병 적인 조건에 개인 간의 유사성과 차이점을 캡처의 또 다른 측면으로 이해에 집중된 노력 되었습니다. 나이2,3, 지리4, 라이프 스타일5,6및 질병5 창 자 미생물의 성분과 관련 된 것으로 표시 했다 하지만 많은 조건과 인구 아직 되지 않은 완전히 특징. 최근에 미생물 치료 응용 프로그램7,,89수정할 수 있습니다 보고 되었습니다. 따라서, 다양 한 생리 적 조건 및 미생물 구성 사이의 관계에 대 한 추가 통찰력의 잠재적인 미래 수정 최적화 향한 첫 번째 단계입니다.
전통 미생물 문화 방법 낮은 수율10,11에 의해 제한 되 고 중 박테리아가 이진 상태로 개념화에 현재의. 높은 처리량 DNA 기반 시퀀싱 미생물 생태학, 미생물 커뮤니티의 모든 구성원의 캡처 수 있도록 혁명을 했다. 그러나, 시퀀스 길이 품질 유지 정확한 분류 할당12중요 한 장벽을 읽기. 또한, 높은 처리량 기반된 실험 측정 비 생물학 또는 비 과학적인 변수13에 의해 영향을 받는 배치 효과에서 고통을 수 있습니다. 최근 몇 년 동안, 여러 프로그램 미국의 직감 프로젝트, 미국 (미국) 인간 Microbiome 프로젝트 및 영국 (영국) MetaHIT 프로젝트를 포함 하 여 인간의 미생물 연구 설립 되었습니다. 이 이니셔티브는 그들의 접근에 일관성의 부족으로 인해 쉽게 비교할 데이터의 방대한 생성. 다양 한 국제 인간 Microbiome 컨소시엄, 국제 인간 Microbiome 표준 프로젝트, 국립 표준 및 기술 (NIST) 같은 국제 프로젝트14 이러한 문제의 일부를 해결 하려고 , 신뢰할 수 있는 생식 결과의 달성을 사용 해야 미생물 측정에 대 한 표준을 개발 하 고. 여기에 설명 된 여러 광범위 하 게 사용 되는 방법15,16 16S rRNA 높은 처리량 (16S-seq)을 시퀀싱 시작 데이터 분석을 통해 배설물 샘플 컬렉션에서에 대 한 통합 된 프로토콜이입니다. 열 무료 PCR 접근, 식물 DNA16의 직접 추출에 대 한 원래 설계 된 프로토콜에 설명 합니다, 그리고 배설물의 많은 수의 동시 처리를 비교적 짧은 시간에 높은 품질의 샘플 타겟 DNA을 증폭 시퀀싱의 미생물 변수 v 4 지역의 일반적인 시퀀싱 플랫폼. 이 프로토콜 과학자 16S rRNA amplicon 시퀀싱의 사용을 시작 하는 강력한, 생식, 사용 하기 쉬운, 상세한 방법에 관심이 중요 한 컨트롤을 사용 하 여 안내 하는 것을 목표로. 가이드 및 상세한 단계-의해 단계 프로토콜 배치 효과 최소화할 수 있습니다 고 따라서 연구소 사이 더 비교 시퀀싱 결과 허용할 것 이다.

<table><tbody><tr><td>Primers</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Extraction solution</td><td>Sigma-Aldrich</td><td>E7526</td><td></td></tr><tr><td>Dilution solution</td><td>Sigma-Aldrich</td><td>D5688</td><td></td></tr><tr><td>Kapa HiFi HotStart ReadyMix PCR Kit</td><td>KAPABIOSYSTEMS</td><td>KK2601</td><td>PCR Master mix</td></tr><tr><td>Quant-iT PicoGreen dsDNA Reagent kit</td><td>Invitrogen</td><td>P7589</td><td>dsDNA quantify reagent</td></tr><tr><td>MinElute Gel extraction kit</td><td>Qiagen</td><td>28606</td><td></td></tr><tr><td>Agarose</td><td>Amresco</td><td>0710-250G</td><td></td></tr><tr><td>Ultra Pure Water Dnase and Rnase Free</td><td>Biological Industries</td><td>01-866-1A</td><td></td></tr><tr><td>Qubit dsDNA HS assay kit</td><td>Molecular probes</td><td>Q32854</td><td>dsDNA detecting kit</td></tr><tr><td>High Sensitivity D1000</td><td>Agilent Technologies</td><td>Screen Tape 5067-5582</td><td>separation and analysis</td></tr><tr><td>Screen Tape Assay</td><td>Agilent Technologies</td><td>Reagents 5067-5583</td><td>for DNA libraries</td></tr><tr><td>PhiX Control v3</td><td>Illumina</td><td>15017666</td><td>control library</td></tr><tr><td>MiSeq Reagent Kit v2 (500 cycle)</td><td>Illumina</td><td>MS-102-2003</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Amresco</td><td>E406-10mL-TAM</td><td></td></tr><tr><td>2 mL collection tubes</td><td>SARSTEDT</td><td>72.695.400</td><td>Safe Seal collection tubes</td></tr><tr><td>Plastic stick swab in PP test tube</td><td>STERILE INTERIOR</td><td>23117</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>PCR Machine</td><td>Applied Biosystems</td><td>2720 Thermal Cycler</td><td></td></tr><tr><td>Sequncing Machine</td><td>Illumina</td><td>Miseq</td><td></td></tr><tr><td>PCR workstation</td><td>Biosan</td><td>UV-cleaner</td><td></td></tr><tr><td>scissors</td><td></td><td></td><td></td></tr><tr><td>vortexer</td><td>Scientific Industries</td><td>Vortex-Genie 2</td><td></td></tr></tbody></table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

인간 장 미생물 부상에서 세포를 보호, 에너지와 영양소, 처리 및 면역 증진에 중심 역할을 한다. 건강 한 microbiota 구성 (dysbiosis)으로 간주 됩니다에서 편차 pathologic 조건에 선도 하는 중요 한 기능에 악영향을 줄 수 있습니다. 최근 지속적인 연구 노력 미생물 구성 및 인류 건강 및 질병 사이 협회의 특성으로 지시 되어 있다.
높은 처리량 시퀀싱 기술의 발전 창 자 미생물 구성의 특성을 사용합니다. 이러한 방법에는 16S rRNA amplicon 시퀀싱 및 샷건 시퀀싱 포함 됩니다. 16S rRNA amplicon 시퀀싱 샷건 시퀀싱 유전자 예측 및 주석 기능에 대 한 추가 정보를 제공 하는 동안 분류학 구성, 프로 파일링 하는 데 사용 됩니다. 16S rRNA 유전자 변수 지역의 타겟된 시퀀싱 메서드를 사용 하는 이점은 샷건 시퀀싱에 비해 현저히 낮은 비용입니다. 16S rRNA 유전자에서 순서 차이 식별 하 여 다른 taxa는 개별 샘플 내에서 계량 미생물 지문으로 사용 됩니다.
주요 국제적인 노력 16S rRNA amplicon 시퀀싱에 대 한 표준 입 대 했습니다. 그러나, 몇몇 연구 보고 배치 효과 의해 발생 하는 변이의 일반적인 소스. 이 효과, 샘플 수집, 제복을 입은 프로토콜을 최소화 하기 위해 처리 및 시퀀싱을 구현 합니다. 이 프로토콜은 배설물 샘플 컬렉션에서 데이터 분석을 시작 하는 광범위 하 게 사용된 프로토콜의 통합을 제안 합니다. 이 프로토콜 열-무료, 직접 PCR 접근 동시 처리 및 v 4 지역의 PCR 증폭 함께 배설물 샘플의 많은 수의 DNA 추출 가능 하 게 포함 되어 있습니다. 또한, 프로토콜 분석 파이프라인을 설명 하 고 QIIME (QIIME 2 버전 2017.7.0 및 DADA2)의 최신 버전을 사용 하 여 스크립트를 제공 합니다. 이 단계별 프로토콜 강력한, 생식, 사용 하기 쉬운, 상세한 방법에 16S rRNA amplicon 시퀀싱의 사용을 시작에 관심이 안내 목적 이다.

프로토콜의 도식 적인 그림은 그림 1에 표시 됩니다.
우리는 prospectively 의심된 전염 성 설사로 입원된 환자에서 대변 샘플을 수집. 그 샘플으로는 앞에서 설명한1시바 메디컬 센터 2 월과 5 월 2015 년 사이 임상 미생물학 실험실에 제출 했다. 대변 샘플 임상 미생물학 실험실에서 수행 하는 기존의 미생물 문화 그리고 광범위 높은 처리량 16S-seq 동시에 받게 되었다. 또한, 건강 한 성인에서 대변 샘플 비교에 대 한 시퀀싱 했다.
이 분석에서 데이터 및 QIIME217에서 얻은 출력의 대표적인 결과의 품질 관리에 초점을 했다. 처음, 시퀀싱 결과 6 부정적인 컨트롤 샘플에서 품질 관리를 포함 한 검토 되었다: 서식 파일 없이 PCR i), 추출 및 희석 솔루션, 깨끗 하 고 멸 균 면봉에 ii) PCR 및 iii) PCR 혼합된 추출 및 희석 솔루션입니다. 표 2 보여 줍 모든 부정적인 컨트롤 샘플 ≤118 총 읽습니다 (29 시퀀스의 평균), 다른 모든 샘플을 분석 하면서 Mycoplasma taxa에서 주로 평균 총 보여주. 했다 10622.57 (±1211.34 표준 오류) 및 아무 Mycoplasma 읽기 읽습니다. 주요 샘플의 품질 관리를 통과 시켰다.
16 예제 각각 동일한 대변 샘플에서 유래 하지만 다른 역방향 바코드 뇌관으로 다른 라이브러리 준비 통해 긍정적인 컨트롤으로 사용 되었다. 그 16 샘플 Campylobacter이나 살 모 넬 라 이질균 임상 미생물학 실험실 및 부정적인 문화를 가진 것으로 보고 된 8에 의해 보고 된에 대 한 긍정적인 문화 8을 포함. 문의 수준에서 지역 플롯은 그림 2에 표시 됩니다. 샘플 같은 대변 샘플에서 유래 하지만 다른 역방향 바코드 뇌관으로 다른 라이브러리 준비 통해 보여 매우 일관성이 상대적 풍요 (벽난로 테스트 문 수준의 분류학 관계 되는 풍부의 중복 사이 값 시뮬레이션 p-값 = 9999 복제에 따라 1 x 10-04 ).
주 좌표 분석 (PCoA), 입력된 데이터의 차원 감소, 시각적으로 샘플 분리 및 유사성을 찾아보기 UniFrac 매트릭스에 사용 되었다. 그림 3A, 시퀀스 샘플을 같은 원래 대변 샘플에서 유래 하지만 다른 라이브러리 준비를 통해가 서는 같은 색깔. 실제로, 그들은 상대적으로 밀접 하 게에서 PCoA 음모 (중복 PC1 PC2 사이 벽난로 테스트 값 시뮬레이션된 p-값 = 1e-04 9999 복제에 따라). 또한,이 연구에서 샘플 사이의 평균 unweighted unifrac 베타 다양성 거리는 0.706, 두 중복 사이의 평균 거리가 0.235 (Wilcoxon 순위 합계 테스트 p-값 = 4.205 x 10-11). 흥미롭게도, Campylobacter이나 살 모 넬 라 이질균 enteropathogens에 대 한 긍정적인 문화를 했다 샘플 보여준 크게 다른 p c 1 값 (Wilcoxon 순위 합계 테스트 p-값 = 0.011)와 비교 네거티브 문화 결과입니다. 그림 3B 동일한 PCoA 플롯을 보여줍니다 하지만 샘플 Proteobacteria의 관계 되는 풍부에 의해 착 색 하는 지금. 높은 Proteobacteria 풍부한 샘플 했다 크게 다른 p c 1 값 (Spearman 상관 r =-0.533, p 값 = 0.000975). 그 결과이 데이터의 이전 분석 일치 어디 입원된 환자에 있는 깊은 증가 Proteobacteria 문1에서 taxa. 여기 우리는 p c 1은 연관 Proteobacteria 풍요, 문화 긍정적인 샘플 p c 1 축과 문화 부정적인 샘플 대부분 다른 측면에서 건강 한 견본 함께 클러스터링의 1 개의 측에 주로 클러스터링을 보였다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56845/56845fig1.jpg"> 그림 1 : 순서도 배설물 샘플에서 상대 미생물 풍부. 1) 샘플 처리: 왼쪽, 배설물 샘플 멸 균 면봉 튜브에 수집 됩니다. 바로, 면봉 막대기 크기 2 ml 튜브 및 스토리지의 폐쇄 수 있도록 그것을 절단 하 여 조정 됩니다. 2) DNA 추출: DNA 직접 PCR 열 무료 접근 방식에 의해 추출 됩니다. 3) 라이브러리 준비: 왼쪽, 추출 된 DNA의 4 μ는 앞 으로/역방향 인덱스 뇌관으로 증폭. 각 역방향 뇌관 12 기본 바코드를 포함 되어 있습니다. 각 샘플은 3 중에서 증폭 된다. 96 잘 접시 32 다른 바코드를 포함 되어 있습니다. 바로, triplicate 각 바코드를 결합 하 여 단일 볼륨 관으로. 96 잘 접시 96 다른 바코드를 포함 되어 있습니다. 4) 라이브러리 정량화: 긍정적인 샘플, amplicons 심사 위 패널 Ethidium 평범한 사람 얼룩이 1 %agarose 젤에서 발견 했다. 낮은 패널, 단일 라이브러리 풀으로 각 샘플에서 500 ng amplicon의 아데닌 농도 도달 긍정적인 amplicons의 정량화. 5) 라이브러리 정화: 상단 패널, 풀링된 라이브러리는 젤 크기 선택 및 정화 추출. 하단 패널, 라이브러리 정확한 크기 및 농도 측정 됩니다. 6) 시퀀싱: 풀링된 라이브러리의 높 처리량 연속. 7) bioinformatic 파이프라인 16S rRNA amplicon 미생물 생태학에 대 한 시퀀싱 데이터를 분석. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56845/56845fig2.jpg"> 그림 2 : 같은 대변 샘플에서 유래 하지만 다른 라이브러리 준비 통해 샘플 사이의 일관 된 관계 되는 풍부. 문 수준에서 분류학 상대적 풍요는 표시 된 대로 샘플 당 표시 됩니다. 관계 되는 풍부는 의심된 감염 설사 다른 역방향 바코드 뇌관 그리고 3 건강 한 컨트롤의 각각 다른 라이브러리 준비 (중복 1 및 2)를 통해 서 입원된 환자에서 얻은 16 분 변 샘플에 대 한 표시 됩니다. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56845/56845fig3.jpg"> 그림 3 : 계통 발생 다양성 같은 대변 샘플에서 유래 하지만 다른 라이브러리 준비를 통해 서 샘플에 대 한 일관 된 결과 보여줍니다. 주 좌표 분석 (PCoA) 입력된 데이터의 차원 감소 시키는 시각적으로 샘플 분리 및 유사성을 찾아보기 UniFrac 매트릭스에 사용 되었다. 두 샘플 사이의 거리는 그들의 미생물 구성에서 차이 나타냅니다. (A) Unweighted UniFrac PCoA 플롯. 각 포인트는 단일 시퀀스 샘플을 나타냅니다. 샘플 같은 원래 대변 샘플에서 유래는 같은 색깔의. 임상 미생물학1 보고 긍정적인 발판 문화를 가진 입원된 환자에서 샘플 사각형, 삼각형1, 그리고 별도 시퀀싱 실행1에서에서 건강 한 성인에서 부정적인 문화 입원된 환자에 의해 표시 된다 원형에서 가득으로 표시 됩니다. (B)에서 같이 동일한 PCoA A, 하지만 샘플은 지금 색깔 Proteobacteria의 그들의 관계 되는 풍부에 의해 표시 된 대로. <a href="//cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관 이름</td>
			<td>뇌관 순서</td>
			<td>뇌관 설명</td>
		</tr>
<tr>
<td>앞으로 뇌관</td>
			<td>AATGATACGGCGACCACCGAGATCTACAC-TATGGTAATT-GT-GTGCCAGCMGCCGCGGTAA</td>
			<td>5' 어댑터 순서-뇌관 패드 앞으로-앞으로 뇌관 뇌관 링커-전달</td>
		</tr>
<tr>
<td>리버스 인덱스 뇌관</td>
			<td>CAAGCAGAAGACGGCATACGAGAT-XXXXXXXXXXXX-AGTCAGTCAG-CC-GACTACHVGGGTWTCTAAT</td>
			<td>3' 어댑터 시퀀스-Golay 바코드-역방향 뇌관 패드-역방향 뇌관 링커-역방향 뇌관의 보완 역</td>
		</tr>
<tr>
<td>읽기 1 시퀀싱 뇌관</td>
			<td>TATGGTAATT-GT-GTGCCAGCMGCCGCGGTAA</td>
			<td>앞으로 뇌관 패드-앞으로 뇌관 뇌관 링커-전달</td>
		</tr>
<tr>
<td>읽기 2 시퀀싱 뇌관</td>
			<td>AGTCAGTCAG-CC-GGACTACHVGGGTWTCTAAT</td>
			<td>반전 뇌관 패드-역방향 뇌관 링커-역방향 뇌관</td>
		</tr>
<tr>
<td>인덱스 시퀀스 뇌관</td>
			<td>ATTAGAWACCCBDGTAGTCC-GG-CTGACTGACT</td>
			<td>반전 반전 뇌관 패드의 역방향 뇌관 역방향 뇌관 링커의 역 보수-역방향 보완의 보완</td>
		</tr>
</tbody></table>표 1: 뇌관 목록입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>샘플</td>
			<td>읽기 게시물의 수 초기 품질 관리 QIIME</td>
		</tr>
<tr>
<td>추출 및 희석 솔루션-1 깨끗 한 면봉에 PCR</td>
			<td>118</td>
		</tr>
<tr>
<td>추출 및 희석 솔루션-2 깨끗 한 면봉에 PCR</td>
			<td>39</td>
		</tr>
<tr>
<td>템플릿-1 없이 PCR</td>
			<td>0</td>
		</tr>
<tr>
<td>템플릿-2 없이 PCR</td>
			<td>0</td>
		</tr>
<tr>
<td>추출 및 희석 솔루션 믹스-1 PCR</td>
			<td>16</td>
		</tr>
<tr>
<td>PCR 추출 및 희석 솔루션 믹스-2</td>
			<td>0</td>
		</tr>
<tr>
<td>샘플 (평균 ± 표준 오차)</td>
			<td>10622.57 ± 1211.34</td>
		</tr>
</tbody></table>표 2: 읽기 부정적인 컨트롤 및 배설물 샘플의 수입니다.
보충 자료 1: 데이터 처리 하시기 <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845_Suppl1_script.txt">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 자료 2: 매핑 파일. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845_Suppl2_map.txt">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 자료 3: 뇌관 구성표. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56845/56845_Suppl3_schematic_primers_representation.pptx">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

이 원고는 높은 처리량 16S rRNA amplicon 시퀀싱의 상세한 표준화 된 프로토콜을 설명합니다. 프로토콜은 데이터 분석을 통해 배설물 샘플 컬렉션에서 시작 하는 통합, 제복 및 가능한, 저렴 한 프로토콜을 소개 합니다. 이 프로토콜에는 많은 수의 엄격한 표준 샘플의 분석 및 여러 가지 컨트롤 수 있습니다.

16S rRNA Amplicon 시퀀싱에 의해 배설물 미생물 특성화에 대 한 가이드 프로토콜

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Universidad San Sebastian

Research

JoVE Journal

Biology

19.5K 조회수.  Sheba Medical Center. 이 원고는 높은 처리량 16S rRNA amplicon 시퀀싱의 상세한 표준화 된 프로토콜을 설명합니다. 프로토콜은 데이터 분석을 통해 배설물 샘플 컬렉션에서 시작 하는 통합, 제복 및 가능한, 저렴 한 프로토콜을 소개 합니다. 이 프로토콜에는 많은 수의 엄격한 표준 샘플의 분석 및 여러 가지 컨트롤 수 있습니다.

비디오: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

루트 미생물 탐색: 토양, Rhizosphere, 및 루트 Endosphere에서 세균성 지역 사회 데이터 추출

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

연구

유전학

Isolation, Propagation, and Identification of Bacterial Species with Hydrocarbon Metabolizing Properties from Aquatic Habitats

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous catalytic enzymes and are naturally capable of metabolizing hydrocarbons. Scientists harness biodiversity in aquatic ecosystems to isolate bacteria with biodegradation and bioremediation potential. Such isolates from the environment provide a rich set of metabolic pathways and enzymes, which can be further utilized to scale up the degradation process at an industrial scale. In this article, we outline the general process of isolation, propagation, and identification of bacterial species from aquatic habitats and screen their ability to utilize hydrocarbons as the sole carbon source in vitro using simple techniques. The present protocol describes the isolation of various bacterial species and their subsequent identification using the 16S rRNA analysis. The protocol also presents steps for characterizing the hydrocarbon degrading potential of bacterial isolates. This protocol will be useful for researchers trying to isolate bacterial species from environmental habitats for their biotechnological applications.

We present the process of isolating, propagating, and characterizing hydrocarbon-degrading bacteria from aquatic habitats. The protocol outlines bacterial isolation, identification by the 16S rRNA method, and testing of their hydrocarbon-degrading potential. This article would help researchers in characterizing microbial biodiversity in environmental samples, and specifically screen for microbes with bioremediation potential.

Isolation, Propagation, and Identification of Bacterial Species with Hydrocarbon Metabolizing Properties from Aquatic Habitats(수생 서식지에서 탄화수소 대사 특성을 가진 박테리아 종의 분리, 번식 및 식별)

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous ...

환경과학

Applying Advanced In Vitro Culturing Technology to Study the Human Gut Microbiota

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its complex nature, and its diverse association with mammalian components. The goal of this protocol is to culture the gut microbiota in vitro, which allows for the study of the gut microbiota dynamics, without having to consider the contribution of the mammalian milieu. Using in vitro culturing technology, the physiological conditions of the gastro intestinal tract are simulated, including parameters such as pH, temperature, anaerobiosis, and transit time. The intestinal surface of the colon is simulated by adding mucin-coated carriers, creating a mucosal phase, and adding further dimension. The gut microbiota is introduced by inoculating with the human fecal material. Upon inoculation with this complex mixture of bacteria, specific microbes are enriched in the different longitudinal (ascending, transverse and descending colons) and transversal (luminal and mucosal) environments of the in vitro model. It is crucial to allow the system to reach a steady state, in which the community and the metabolites produced remain stable. The experimental results in this manuscript demonstrate how the inoculated gut microbiota community develops into a stable community over time. Once steady state is achieved, the system can be used to analyze bacterial interactions and community functions or to test the effects of any additives on the gut microbiota, such as food, food components, or pharmaceuticals.

Here, we present a protocol for culturing the gut microbiota of the colon in vitro, using a series of bioreactors that simulate the physiological conditions of the gastro intestinal tract.

인간의 본질적인 Microbiota 공부 기술을 경작 하는 체 외에서 고급 적용

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its ...

생체공학

An In Vitro Batch-culture Model to Estimate the Effects of Interventional Regimens on Human Fecal Microbiota

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are needed to decipher the utilization of microbiome modulators for human health benefits. However, the large-scale screening and optimization of modulators to validate microbiome modulation and predict related health benefits may be practically difficult due to the need for large number of animals and/or human subjects. To this end, in vitro or ex vivo models can facilitate preliminary screening of microbiome modulators. Herein, it is optimized and demonstrated an ex vivo fecal microbiota culture system that can be used for examining the effects of various interventions of gut microbiome modulators including probiotics, prebiotics and other food ingredients, aside from nutraceuticals and drugs, on the diversity and composition of the human gut microbiota. Inulin, one of the most widely studied prebiotic compounds and microbiome modulators, is used as an example here to examine its effect on the healthy fecal microbiota composition and its metabolic activities, such as fecal pH and the fecal levels of organic acids including lactate and short-chain fatty acids (SCFAs). The protocol may be useful for studies aimed at estimating the effects of different interventions of modulators on fecal microbiota profiles and at predicting their health impacts.

This protocol describes an in vitro batch-culture fermentation system of human fecal microbiota, using inulin (a well-known prebiotic and one of the most widely studied microbiota modulators) to demonstrate the use of this system in estimating effects of specific interventions on fecal microbiota composition and metabolic activities.

인체 배설물 미생물에 대한 중재 식이요법의 효과를 추정하는 시험관 내 배치 배양 모델

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are ...

면역학 및 감염병학

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

16S 리보솜 RNA 유전자 증폭 산물의 차세대 시퀀싱

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

생물학

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

세균 커뮤니티 특성화에 대한 효율적인 핵산 추출 및 16S rRNA의 유전자 시퀀싱

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

2단계 PCR 및 차세대 16S rRNA 유전자 시퀀싱을 사용한 미생물 분석

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

16S rRNA 시퀀싱: 박테리아 종 식별을위한 PCR 기반 기술

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...