Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

이 작품은 중국 자연 과학 재단 (JV 및 LL에 부여 번호 31471703, A0201300537 및 31671854) 및 100 개의 외국 재능 계획 (JV에 부여 번호 JSB2014012)으로 부분적으로 지원되었습니다.

동물 피험자에 관한 절차는 SPF에 수납 된 동물들과 실험 동물 복지에 관한 국가 지침 (과학 기술부, 중국 홍보, 2006)에 따라 난징 농업 대학교 실험 동물 센터의 윤리위원회의 승인을 받았다. 시설 (허가 ID : SYXK-J-2011-0037). 1. Cmah 녹아웃 마우스 모델 <ol><li> 양주 대학교 (중국)의 비교 의학 센터에서 야생형 C57Bl / 6 마우스를 사용하십시오. 참고 : Cmah 녹아웃 마우스는 이전 Cmah 녹아웃 연구 17 , 19 에서 제공된 정보를 기반으로 생성되었으며 Cmah 유전자의 엑손 6에서 92 염기쌍을 제거하여 CRISPR / Cas9 20 전략을 사용하여 상업적으로 얻었습니다. 인간 CMAH 유전자에서 결실 19 . 양의 F 0 &lt;/ 서브&gt; 때문이야 - 쥐 (2 개인)의 이형 때문이야 - F 1을 얻었다 야생형 마우스와 교배. 이형 F 1 때문이야 - 쥐 (5 개인)를 횡단 한 후, 동형 접합 Cmah 녹아웃 F 2 때문이야 - 쥐가 성공적으로 (3 개인)을 얻을 수있다. </li><li> 상업적 DNA 정제 키트를 사용하여 Zangala 21 에 제시된 방법에 따라 게놈 DNA를 사용하여 생쥐의 genotyping을 수행하십시오. <ol><li> 시중의 DNA 중합 효소와 프라이머 쌍 5&#39;gaaagggctcggctctgtatgaa3 &#39;및 5&#39;tttaaagtgtcccgggtgagaagc3&#39;를 사용하여 Cmah 유전자의 상응하는 DNA 단편을 증폭시킨다. 94 ℃에서 40 초 동안 변성, 40 초 동안 63 ℃에서 어닐링, 72 분에서 1 분간 연신하는 34 가지 PCR 사이클을 사용하여 유전자 증폭을 수행하십시오. </li><li> PCR 제품을 1 % 아가 로즈 겔에서 시각화하십시오. 야생형 개체에 대해서는 단일 밴드 (0.5kb)를, 야생형 개체에 대해서는 더블 밴드 (0.4 및 0.5kb)를 관찰해야한다.heterozygous knock-out 개체 및 homozygous knock-out 개체에 대한 단일 밴드 (0.4kb)가 포함됩니다. </li></ol></li></ol> 2. 샘플 수집 <ol><li> Willingham 등이 기술 한 프로토콜을 사용하여 마우스 우유를 수집 합니다. 22 . </li><li> Gonçalves 등이 설명한 프로토콜을 사용하여 마우스 간 조직을 수집 합니다. -80 ° C에서 23 개 샘플 저장소. </li></ol> 3. 우유에서 시알 산의 분리 <ol><li> 증류 H 2 O 88 ㎖ 중에 빙초산 12 mL를 첨가하여 2 M 아세트산 용액 100mL를 준비 </li><li> 50 mL의 우유를 1.5 mL 원심 분리 튜브에 넣고 준비된 아세트산 수용액 1.2 mL를 넣는다. </li><li> 80 ° C에서 4 시간 동안 현탁액을 품어 내고 샘플을 14,000 xg에서 10 분간 원심 분리한다. </li><li> 상층 액의 상단 1,000 μL를 새로운 1.5 mL 원심 분리 튜브 및 Rem로 옮긴다.실온에서 원심 증발에 의해 용매를 제거하여 건조시킵니다 (부착 된 진공 펌프에 따라 4 ~ 20 시간이 소요됩니다). 재용 증류 H 2 O. 500 μL의 샘플을 </li><li> 마이크로 음이온 교환 컬럼을 준비하십시오. 이 단계는 음이온 성 화합물을 풍부하게하고 우유 및 간 샘플에서 양이온 및 중성 화합물을 제거하므로 시알 산 유도체 화를위한 형광성 OPD 표지제의 선택성을 증가시킵니다. <ol><li> 각 시료 200mg을 음이온 교환 수지 (Dowex 1X8)를 스톱 콕이 부착 된 빈 3mL 컬럼 튜브에 옮긴다. </li><li> 단계 3.1에서 준비한 아세트산 수용액 2 mL를 첨가하여 수지 내의 염화물 이온을 아세테이트 이온으로 대체한다. 솔벤트가 수지 상단에 도달하면 즉시 스톱 콕을 닫으십시오. </li><li> 조심스럽게 증류 H 2 O 2 ㎖를 추가 콕을 열어 즉시 도달 용매의 대부분 같은 흐름을 중지수지의 상단. 수지가 항상 솔벤트로 덮여 있는지 확인하십시오. </li><li> 과량의 아세트산을 제거하기위한 증류 H 2 O 2 mL로 수지 컬럼을 두 번 더 세척 하였다. </li></ol></li><li> 단계 3.4에서 얻은 500 μL의 샘플 용매를 옮기십시오. 수지 칼럼에 놓고 흐름을 버린다. 부드럽게 1.5 ㎖ 중에 50mM의 아세트산 암모늄 용액 1 ㎖를 사용하여 수지로부터 시료 음이온 (암모늄 아세테이트 386 mg을 증류수 H 2 O 100 mL에 용해) 증류 H 2 O. 용출 2 mL로하여 수지를 씻어 원심 분리기 튜브. 실온에서 건조하여 원심 증발시켜 용매를 제거한다. 참고 : 건조 샘플은 4-6 ° C에서 12 개월까지 보관할 수 있습니다. </li></ol> 4. 간 조직으로부터 시알 산의 분리 <ol><li> 부드럽게 20-50 mg의 마우스 간을 해동시키고 그것을 Dounce 조직 분쇄기 (1 mL 또는 2 mL 용량)로 옮긴다. 1.2 mL의 아세트산 수용액단계 3.1에서 준비하고 10 초 동안 부드러운 전단하여 조직을 균질. 생성 된 현탁액을 1.5 mL 원심 분리 튜브에 옮긴다. </li><li> 3.3 단계를 수행하십시오. 3.6. 참고 : 건조 샘플은 4-6 ° C에서 12 개월까지 보관할 수 있습니다. </li></ol> 5. 혼합 시알 산 표준의 제조 <ol><li> 분석 용 저울에 N- 아세틸 뉴 라민 산 5 - 8 mg을 1.5 mL 원심 분리 관에 넣습니다. 정확한 체중을 주마다 mg을 증류수 H 2 O 164 μL를 추가 (즉 Neu5Ac의 중량을 7.2 ㎎을 다음 7.2 = 1 × 164, H 2 O 증류수 181 μL를 추가 할 경우). 최대 12 개월 동안 -20 ° C에서 보관할 수있는 20 mM Neu5Ac 스톡 용액이 생성됩니다. </li><li> 1mg 분량과 같은 적절한 가격으로 소량의 N- 글리콜 릴 뉴 라민 산을 얻습니다. ~ 20 mM의 Neu5Gc 스톡 용액을 제조하기 위해 화합물 2 O 직접 증류 H 154 μL를 추가한다. 전송1.5 mL 원심 튜브에 넣었다. 이 솔루션은 최대 12 개월 동안 -20 ° C에서 보관할 수 있습니다. </li><li> 단계 5.1 및 5.2의 각 원액에서 5 μL를 신선한 1.5 mL 원심 튜브에 넣고 실온에서 건조하여 원심 증발에 의해 용매를 제거합니다. 참고 : 혼합 시알 산 표준은 최대 12 개월 동안 4 ~ 6 ° C에서 보관할 수 있습니다. </li></ol> 6. 시알 산의 형광 유도체 화 <ol><li> 오르토 페닐 렌 디아민 100㎎을하고 10ml에 아황산 수소 나트륨 208 mg을 구성된 10 ㎖ OPD-용액을 준비하여 H 2 O를 증류 </li><li> 마우스 우유 (3 단계), 마우스 간 (4 단계), 또는 혼합 시알 산 표준 (5 단계)에서 파생 된 시알 산 샘플에 OPD 솔루션 20 μL를 추가합니다. 어두운 곳에서 80 ° C에서 4 시간 동안 시료를 30 초간 격렬히 교반하고 incubate하십시오 ( 즉 , 알루미늄 호일에 마이크로 튜브를 감싸십시오). </li><li> 샘플을 5 분 동안 식히고 80μ; 증류수 H 2 O의 L 1 분 동안 14,000 XG에서 튜브를 원심 분리. </li><li> 상등액에서 80 μL를 300 μL 고 회수 HPLC 바이알로 옮긴다. 유도체 화 된 시알 산 시료는 4 ~ 6 ° C에서 최대 1 주일 동안 보관할 수 있습니다. </li></ol> 7. 시알 산 유도체의 HPLC 분석 <ol><li> 온라인 형광 검출기에 연결된 표준 HPLC 시스템을 사용하여 시료를 분석하십시오. </li><li> 표준 250mm 길이와 4.6mm 직경의 역상 C18 컬럼을 사용하여 분석하십시오. </li><li> 스톡 용액 200 mL를 LCMS 급수 800 mL로 희석하여 용매 A를 준비한다 (LCMS - 액체 크로마토 그래피 질량 분석기). 원액 자체는 다음과 같이 준비 할 수있다 : <ol><li> 46 g의 개미산을 800 mL의 LCMS 등급 H 2 O에 첨가한다. </li><li> 수산화 암모늄 용액 (puriss.pa)을 적가하여 pH를 4.5로 조정한다. </li><li> 솔벤트를실린더를 측정하고 LCMS 등급 H 2 O로 1,000 mL까지 채우십시오.이 저장 용액은 4 ~ 6 ° C에서 3 개월까지 저장할 수 있습니다. </li></ol></li><li> 용매 B의 경우 LCMS 등급의 아세토 니트릴을 사용하십시오. </li><li> 시알 산 유도체를 1 mL / min 유속으로 다음의 농도 구배로 분리하십시오 : <ol><li> 용매 A에 혼합 된 용매 B를 10 % 첨가하여 시작하십시오. </li><li> 0 분에서부터 15 분까지 점차적으로 용매 B의 비율을 60 %까지 선형 그래디언트로 증가시킵니다. </li><li> 15 분에서 16 분 사이에 선형 그라디언트로 용매 B의 비율을 60 %에서 90 %까지 빠르게 증가시킵니다. 이것은 HPLC 칼럼의 세척을 시작한다. </li><li> HPLC 칼럼을 추가로 세척하기 위해 용매 B의 수준을 16 분에서 18 분 사이에 90 %로 유지 한 다음 용매 B의 수준을 18 분에서 19 분 사이에 다시 10 %로 점차 감소시킵니다. </li><li> HPLC 칼럼을 19 ~ 24 분 사이의 10 % B의 시작 조건으로 재 평형시킨다. </li></ol></li><li> 에서시료 50 μL를 HPLC 시스템에 주입하십시오. </li><li> 373/448 nm의 형광 검출기 여기 / 방출 파장을 사용하여 용리액을 모니터링하고 유도체 화 된 시알 산은 대략 9 분 (Neu5Gc-OPD) 및 10 분 (Neu5Ac-OPD)의 예상 유지 시간에서 예상 할 수 있습니다. </li><li> F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc )와 같이 Neu5Ac (A Neu5Ac )와 Neu5Gc (A Neu5Gc )의 형광 피크 면적으로부터 Neu5Gc (F Neu5Gc )의 상대적 양을 계산 하라 . homozygous Cmah knock-out 마우스의 우유 및 간 샘플의 경우 F Neu5Gc 는 0 %이어야하지만, 이형 접합체 및 야생형 마우스의 F Neu5Gc 값은 마우스 나이와 조직 유형에 따라 크게 다를 수 있습니다 (2 % 및&gt; 90 %)로 예상 오차 여백은 ± 12 %입니다. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

저자는 공개 할 것이 없습니다.

본 명세서에 제시된 프로토콜은 우유 및 간 샘플의 Neu5Gc의 상대적인 양을 분석하고 정량화함으로써 동형 접합성 Cmah 녹아웃 마우스의 표현형 평가를 가능하게한다. 형광 검출을 이용한 표준 HPLC 설정을 사용하여 분석을 수행 하였다. 이 절차의 가장 중요한 단계는 음이온 교환 컬럼을 준비하고 음이온 교환 크로마토 그래피를 수행하는 것입니다. 수지를 적절하게 침전시키고 적절한 세척 및 용출 분획을 수집하는 것은 약간의 연습을 필요로한다. 다르게는, 본원에서 사용 된 유도체 화제 OPD는보다 고가의 유도체 화제 DMB (1,2- 디아 미노 -4,5- 메틸렌 디 옥시 벤젠)로 쉽게 대체 될 수있다. 또한, 수득 된 시알 산 유도체를 단계 6.5로부터 분석 하였다. 또한 수 질량 분광 검출 대신 형광 검출 (MS-2020 검출기와 결합 즉 시마즈 Nexera UPLC 시스템)을 사용하여 분석 할 수있다. 에이단계 7.2-7.6을 적용 할 때, 시알 산 유도체는 382.0 및 398.0의 m / z 비율 (이들은 각각 Neu5Ac-OPD 및 Neu5Gc-OPD의 H + - 아형)에 대한 양이온 모드 스캐닝을 사용하여 직접 검출된다. 이 방법의 한 가지 한계는 Neu5Gc 함량이 Neu5Ac 양에 비례하여 정량화 될 수 있지만 절대적으로는 정량화 될 수 없다는 것입니다. 그렇게하기 위해 샘플 준비의 초기 단계에서 내부 표준으로서 뚜렷하고 정량 할 수있는 시알 산을 첨가 할 필요가있다. 또 다른 단점은 Neu5Gc heterozygous knock-out 마우스의 상대적 양은 개별 마우스의 표본 유형 ( 즉, 조직)과 나이에 따라 크게 달라질 수 있기 때문에 동형 접합체이지만 이형 접합체 인 Cmah knock-out mice 만 명확하게 식별 할 수 있다는 것입니다. 이 방법의 향후 개발에는 내부 표준의 추가 및 생쥐에서의 시알 산의 절대 정량화가 포함될 수 있습니다.

N- 아세틸 뉴 라민 산 (Neu5Ac)과 N- 글리콜 릴 뉴 라민 산 (Neu5Gc)은 대부분의 포유류에서 가장 흔한 시알 산입니다 1 . Neu5Ac를 내생 적으로 합성 할 수는 있지만, 인간은 CMP-Neu5Ac hydroxylase 2 , 3을 암호화하는 CMAH 유전자에서 1 차 엑손 결실로 인해 Neu5Gc를 생산할 수 없습니다. 그러나 동물성 식품은 Neu5Gc 4 , 5 , 6 의식이 공급원 일 수있어 Neu5Gc 항체 생산을 유도하여 Neu5Gc 7에 대한 면역 반응을 유발합니다. Neu5Gc의식이 효과는 만성 염증 및 여러 가지 다른 질병에 기여하는 것으로 의심됩니다 ( 8 , 9 , 10) . Neu5Gc의 효과를 종합적으로 이해하기 위해식용 시알 산의 효과에 대한 체계적인 연구를위한 동물 모델은 매우 바람직하다. 녹아웃 마우스를 분석하기위한 중합 효소 연쇄 반응 (polymerase chain reaction, PCR)을 기반으로 한 프로토콜이 잘 확립되어 있고 유전형 평가를위한 편리한 방법이지만, 대사 수준에서 표현형의 기능 분석에는보다 구체적인 분석 방법이 필요합니다. Cmah knock-out 마우스 모델의 표현형은 간 또는 우유 샘플에서 시알 산의 조성을 분리하고 분석하여 평가할 수 있습니다. 동물 조직에서 시알 산을 검출하는 몇 가지 방법이 이전에보고되었습니다 : 시알 산을 레조 르시 놀 11 또는 티오 바르 비 투산 12 와 반응 시키면 발색 생성물이 형성되고 플레이트 판독기를 사용하여 간단하게 분석 할 수 있지만 시알 산 산 함량이 결정될 수있다. 대안으로, 시알 산의 분석은 가스 크로마토 그래피13 , MALDI-ToF 질량 분광 분석법 14 또는 전류 법 15 . 그러나, 가장 일반적으로 적용되는 시알 산 분석 방법은 가수 분해 릴리스, 형광 유도체 화 및 후속 고성능 액체 크로마토 그래피 16 , 17 , 18에 근거합니다.

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (cytidine monophosphate-N- 아세틸 뉴 라민 산 hydroxylase)는 포유류에서 cytidine monophosphate-N- acetylneuraminic acids의 산화를 담당합니다. 그러나, 인간은 CMAH 유전자의 일차 엑손 결실로 인해 시티 딘 모노 포스페이트 -N- 아세틸 뉴 라민 산을 시티 딘 모노 포스페이트 -N- 글리콜 릴 뉴 라민 산으로 산화시킬 수 없다. CMAH 활동의 결핍의 영향과 함축적 의미를보다 자세히 이해하기 위해 마우스에서의 Cmah 녹아웃 모델은 기초 및 응용 연구에 관심이 많습니다 . 이 마우스 모델의 표현형을 결정하기위한 분석 방법은 본원에 상세히 기재되어 있으며, 야생형 및 Cmah 녹아웃 마우스의 간 및 우유에서의 N- 아세틸 뉴 라민 산 및 N- 글리콜로 누 라민 산의 검출에 기초한다. 내인성 시알 산은 방출되고 o- 페닐 렌 디아민으로 유도체 화되어 형광 생성물을 생성하며, 이후에 HPLC로 분석 될 수있다. 제시된 프로토콜은또한 다양한 다른 기원의 우유 및 조직 샘플 분석에 사용되며 N-glycolylneuraminic acid의 영양 및 건강 효과를 조사하는 데 유용 할 수 있습니다.

설명 된 분석 방법의 개략적 인 개요는 그림 1에 표시되어 있으며 야생 형 및 Cmah 녹아웃 돌연변이 마우스의 우유 및 간 샘플에서 시알 산을 분리하고 형광 유도체 화 및 이러한 구성 요소의 HPLC 분석을 포함합니다. 그림 2 와 그림 3 은 homo- 과 heterozygous knock-out Cmah 마우스 (- / -와 +/-)와 야생형 마우스의 우유와 간 샘플 유도체 화 시알 산의 대표적인 HPLC 크로마토 그램을 보여줍니다. 도 4 는 HPLC 피크 면적으로부터 계산 된 분석 마우스 샘플의 N- 글리콜 릴 뉴 라민 산 (Neu5Gc)의 얻어진 상대량을 나타낸다. <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/56030/56030fig1.jpg" /> 그림 <stro<html> ng class = &quot;xfig&quot;&gt; 1 : 마우스 유래 우유 및 간 샘플로부터의 시알 산에 대한 기술 된 분석 방법의 도식 개요. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56030/56030fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" class="xfigimg" src="/files/ftp_upload/56030/56030fig2.jpg" /> 그림 2 : Homo- 및 Heterozygous Knock-out Cmah 마우스 (- / - 및 +/-) 및 야생형 마우스로부터 유래 된 우유 샘플로부터의 형광 표지 된 시알 산의 HPLC 크로마토 그램. 상단 크로마토 그램은 혼합 된 시알 산 표준입니다. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56030/56030fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> &quot;src =&quot;/ files / ftp_upload / 56030 / 56030fig3.jpg &quot;/&gt; 그림 3 : Homo- 및 Heterozygous Knock-out Cmah 마우스 (- / - 및 +/-) 및 야생형 마우스에서 추출한 간 샘플의 형광 표지 된 시알 산의 HPLC 크로마토 그램. 상단 크로마토 그램은 혼합 된 시알 산 표준입니다. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56030/56030fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" class="xfigimg" src="/files/ftp_upload/56030/56030fig4.jpg" /> 그림 4 : HPLC 피크 영역에서 계산 된 분석 된 마우스 샘플의 N- 글리콜 릴 뉴 라민 산 (Neu5Gc)의 상대적인 양. <a href="https://ecsource-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56030/56030fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

우리는 마우스 간의 간과 우유에서 N- 아세틸 뉴 라민 산 (N-acetylneuraminic acid)과 N- 글리콜로 누 라민 산 (N-glycolylenuraminic acid)을 측정하기위한 HPLC 기반 방법을 설명합니다.

야생형과 간암의 시알 산의 결정<em&gt; CMAH</em&gt; 넉 아웃 마우스.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Universidad San Sebastian

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K 조회수.  Nanjing Agricultural University.  우리는 마우스 간의 간과 우유에서 N- 아세틸 뉴 라민 산 (N-acetylneuraminic acid)과 N- 글리콜로 누 라민 산 (N-glycolylenuraminic acid)을 측정하기위한 HPLC 기반 방법을 설명합니다. 

비디오: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

마우스 간에서 담관 밀도 결정

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

연구

발생학

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

N을 사용 하 여 Sialic Acid의 대사 Glycoengineering-acyl-Mannosamines를 수정

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

생체공학

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

의학

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

쥐에 있는 침 샘 기능의 측정 하는 방법

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

면역학 및 감염병학

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

셀룰러 및 Organismic 수준 호스트 응답 세균성 병원 체 프로브를 사용 하 여

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

자연 점액 배포를 공부하기 위해 떼어 낸, 냉동 조직을 사용하여

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

생물학

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

인트스타스타스테어링 전달을 통해 마우스에서 수막구균 수막염 혈청계S C유도

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

마우스 유선의 냉동 섹션에 간접 면역 형광

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>마우스의 수유 연구에서 우유 수집을 위한 최적화된 Single-Person Method

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>실험용 마우스에서 우유 샘플링을 위한 효율적인 단일 인물 기법

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

야생형과 간암의 시알 산의 결정

요약

더 많은 비디오 탐색

이 비디오의 챕터

마우스 간에서 담관 밀도 결정

N을 사용 하 여 Sialic Acid의 대사 Glycoengineering-acyl-Mannosamines를 수정

C57BL / 6 마우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

쥐에 있는 침 샘 기능의 측정 하는 방법

셀룰러 및 Organismic 수준 호스트 응답 세균성 병원 체 프로브를 사용 하 여

자연 점액 배포를 공부하기 위해 떼어 낸, 냉동 조직을 사용하여

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

인트스타스타스테어링 전달을 통해 마우스에서 수막구균 수막염 혈청계S C유도

마우스 유선의 냉동 섹션에 간접 면역 형광

실험용 쥐의 우유 샘플링을 위한 효율적인 1인 기법

야생형과 간암의 시알 산의 결정

요약

더 많은 비디오 탐색

이 비디오의 챕터

마우스 간에서 담관 밀도 결정

N을 사용 하 여 Sialic Acid의 대사 Glycoengineering-acyl-Mannosamines를 수정

C57BL / 6 마​​우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)

쥐에 있는 침 샘 기능의 측정 하는 방법

셀룰러 및 Organismic 수준 호스트 응답 세균성 병원 체 프로브를 사용 하 여

자연 점액 배포를 공부하기 위해 떼어 낸, 냉동 조직을 사용하여

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

인트스타스타스테어링 전달을 통해 마우스에서 수막구균 수막염 혈청계S C유도

마우스 유선의 냉동 섹션에 간접 면역 형광

실험용 쥐의 우유 샘플링을 위한 효율적인 1인 기법

C57BL / 6 마우스의 전신 홍 반성 루푸스의 BM12 유도 성 모델 (SLE)