JAS는 듀크 암 연구소, 듀크 대학 비뇨 생식기 종양학 연구소 및 정형 외과의 듀크 대학교의 지원을 인정합니다. HL은 이론 생물 물리학에 대한 국립 과학 재단 (National Science Foundation, NSF) 센터에 의해 지원되었다 (NSF PHY-1427654)와 NSF DMS-1361411, 텍사스 주 암 연구에 CPRIT로 (암 예방 및 텍사스 연구소) 학술 라이스 대학 (Rice University)에서. KEW는 NIH F32 CA192630 MKJ 지원하고 HL 메리 C. Farach-카슨 JN Onuchic 사미르 M. Hanash, 케네스 J 피엔타, 도널드 S. 코피 유용한 논의 혜택.

시약의 제조 1. <ol><li> 소 태아 혈청 (FBS) 및 페니실린 - 스트렙토 마이신 (5,000 U / ㎖) 500 ㎖의 DMEM에 5 mL의 50 ㎖를 첨가하여 세포를 DMEM 배양을 준비한다. 이 매체는 최대 6 개월 동안 4 ° C에 저장할 수 있습니다. </li><li> 10 μM의 최종 농도 핵산 분해 효소가없는 물에 동결 건조 된 프라이머를 재현 탁. 저장 -20 ° C에서 프라이머를 재 - 중단. </li><li> radioimmunoprecipitation 분석 (RIPA) 완충액 (150 mM의 염화나트륨, 0.5 % 나트륨 데 옥시 콜레이트, 0.1 % SDS, 50 개 mM 트리스, pH를 8.0)을 준비한다. 사용하기 전에 프로테아제 억제제 칵테일 보충 및 사용시 얼음에 버퍼를 유지한다. 4 ℃에서 보관하십시오. </li><li> 0.45 ㎛의 폴리 필터를 이용하여 멸균 물 및 주사기 필터에 10 ㎎ / ㎖의 폴리 브렌 (hexadimethrine 브로마이드)를 준비한다. 솔루션은 최대 6 개월 동안 4 ° C에 저장할 수 있습니다. </li><li> PBS 10 ㎖의 10 ㎎을 용해시켜 니트로 블루 테트라 졸륨 클로라이드의 1 ㎎ / ㎖ 작업 용액을 제조 하였다. 4 ℃에서 보관하십시오.</li></ol> GRHL2 2. 렌티 바이러스 형질 도입 1 일 <ol><li> 접시 보충 DMEM 2 ㎖로 6 웰 플레이트에 웰당 3 × 105 HEK293T 세포. 자동 세포 계수기를 사용하여 세포를 정량화. 5 % CO 2, 37 ℃에서 밤새 배양 한 후 60 % 융합 - 셀 40이어야한다. </li></ol> 제 2 일 <ol start="2"><li> 1.8 pΔ8.9의 μg의 및을 pCMV-VSV의 0.2 μg의와 함께 혈청이없는 미디어의 200 μL에 2 빈 벡터의 μg의 (을 pCMV-UBC-EGFP) 또는 둘을 pCMV-GRHL2-UBC-EGFP 24 μg의 25 희석 -G 도우미 플라스미드. 별도의 튜브에, 형질 당 혈청이없는 배지 (두 샘플 400 μL 8 μL)을 200 μL의 지질 계 형질 감염 시약 4 μL 희석. 각 플라스미드 용액으로 형질 전환 시약 혼합물을 200 μL를 첨가하고 실온에서 20 분 동안 배양한다. </li><li> incuba 동안능은, 진공 흡인에 의해 배지를 제거하고 PBS 1 ㎖로 세포를 세척함으로써 HEK293T 세포를 세척한다. 혈청이없는 미디어의 800 μL와 PBS를 교체합니다. 5 % CO 2, 37 ℃에서 2 시간 동안 세포를 각 웰에 적하 단계 2.2에서 플라스미드 혼합물을 배양하고 20 분 후에, 트랜 스펙 션 시약 200 μL를 추가한다. </li><li> 조심스럽게 진공 흡인 형질 감염 배지를 제거하고 보충 된 DMEM 2 mL로 교체한다. 하룻밤 문화 인큐베이터로 세포를 반환합니다. 참고 : HEK293T 세포는 느슨하게 부착합니다. 미디어 교체 접시 또는 플라스크의 바닥으로부터 세포를 제거하기 위해주의를 제한하여 수행되어야한다. </li></ol> 3 일 <ol start="5"><li> 보충 된 DMEM 2 ㎖로 형질 HEK293T 세포 플레이트에 6 웰 플레이트의 웰 당 3 × 105 RD 세포를 새로 고침 매체. 하룻밤 문화 전지. RD 세포는 시판 인간 횡문근 육종 세포주이다. </li></ol> 4 일 </P&gt; <ol start="6"><li> HEK293T 세포에서 바이러스 성 미디어를 수집합니다. 새로운 15ml의 원뿔형으로 HEK293T 세포 장소로부터 DMEM 배지 피펫. 조심스럽게 다시 다음 날을위한 인큐베이터에서 새로운 DMEM 매체와 장소 HEK293T 세포로 대체합니다. </li><li> 두 개의 새로운 50ml의 원뿔형 튜브 (GRHL2 형질 대한 빈 벡터 형질 다른 하나)로 10 밀리그램 / 바이러스 미디어 1 ㎖ 당 용액의 폴리 브렌 2 μL를 추가한다. 3 ml 주사기의 플런저를 제거하고 선단에 0.45 ㎛의 폴리 필터를 부착하여 주사기 필터 바이러스 매체. <ol><li> 주사기 배럴로 단계 260에서 수집 된 바이러스 미디어를 추가하고, 폴리 브렌을 함유하는 새로운 50 개 ㎖ 원뿔형 튜브에 미디어를 뛰어. 진공 흡인 RD 세포로부터 용지를 분리 RD 세포 바이러스 여과 매체를 추가한다. </li></ol></li></ol> 5 일 <ol start="8"><li> 바이러스 미디어가 수집 한 후 반복 일 4. HEK293T 세포는 폐기 될 수있다. </li></ol> 7 일 </강한&gt; <ol start="9"><li> 워시 RD의 PBS 1 ㎖로 세포를 200 0.05 % 트립신 μL 웰 당을 추가한다. 5 분 동안 37 ℃에서 인큐베이션 보충 미디어 2 ㎖를 추가하고, 새로운 15ml의 원뿔에 세포 현탁액을 이동. 실온 대기음 매체에서 5 분 동안 원심 분리기 (250) XG 세포. DMEM 1 ㎖에 재현 탁은 (5 % FBS 및 1 %의 페니실린 스트렙토 마이신이 보충). 참고 : FBS의 높은 비율을 사용하여 유동 세포 계측법 동안 막힘이 발생할 수 있습니다 <ol><li> 유동 세포 계측법에 대한 필터 세포. 얼음 튜브 대신 파이프를 유세포 분석기로 30 μm의 필터를 사용하여 1 ㎖의 RD 세포 현탁액을 적용하기 위해 피펫을 사용한다. </li><li> 0.5ml의 DMEM을 함유하는 1.5 mL의의 마이크로 원심 튜브에 놓아 + EGFP 셀 26 얼음에 10 % FBS와 1 % 페니실린 - 스트렙토 마이신으로 보충 장소. 플레이트는 EGFP + 배양 인큐베이터에서 12 웰 플레이트와 장소의 단일 웰에 첨가 DMEM 1 ㎖의 총 세포를 분류. ; 참고 : 흐름 계측법이 전달 후 EGFP + 세포의 수율은 일반적으로 저 (50000 개 세포)이다. 3 단계로 진행하기 14 일 전 - 세포는 10 배양해야 할 수도 있습니다. </li></ol></li></ol> 미르 200S 3. 역방향 형질 <ol><li> 반복 된 동결 / 해동 사이클을 피하기 위하여 -20 ° C에서 클레아없는 H 2 O. 나누어 축적량 및 저장소를 사용하여 결과 miR-200 모방 50 개 μM 주식을 준비한다. </li><li> 혈청이없는 배지 300 μL 300 μL의 혈청이없는 배지에서 50 μM 음성 대조군 miRNA를 9 μL 각 50 μM은 miR-200 모방 (미르 200A 미르-200B, 미르-200C) 3 μL를 추가한다. </li><li> 혈청이없는 배지 600 μL에 siRNA를 형질 특정 시약 6 μL를 첨가하고 두 튜브, 단계 3.2에서 두 미르 혼합물의 각 하나에이 혼합물을 300 μL를 나눈다. 형질 전환 시약 300 μL를 혼합하여, 각 단계에서 3.2 미르 혼합물의 300 μL를 결합. 방 TE에서 20 분 동안 인큐베이션mperature. </li><li> 배양하는 동안, 2.4 ㎖의 생성 된 제 2 또는 EV GRHL2 EGFP 발현 600000 개 + RD 세포의 세포 현탁액 처리 당 혈청 매체 (250 세포 / μL)을 준비한다. </li><li> 24- 웰 플레이트에서, 여섯 개 웰로은 miR-200 혼합 또는 단계 3.3 대조군 혼합물의 웰 당 100 μL를 추가 한 다음 각 미르 믹스 세 웰에 각각의 세포 현탁액을 400 μL를 추가한다. </li><li> 5 % CO 2에서 37 ℃에서 세포를 밤새 인큐베이션 미디어 변경 완전히 다음날 DMEM을 첨가한다. 적절한 완충액 (하기 참조)을 이용하여 분석을 2 일 후, 세포를 수집한다. MET를 겪고 RD 육종 세포의 시간 경과 영상은 보충 자료로 사용할 수 있습니다. 이미지 자동 라이브 셀 이미 저 (27)를 사용하여 10 배 목적으로 각 웰마다 2 시간. </li></ol> 4. RNA 추출, 역전사 및 qPCR에 <ol><li> 표준 RNA를 사용하여 제조업체의 지침에 따라 RNA를 추출추출 키트 (24). 추출 된 RNA는 -80 ° C에 저장할 수 있습니다. </li><li> RNA 농도를 정량화. 해동 얼음에 RNA와 함께 작동합니다. , RNA 농도를 정량화 제조사의 프로토콜에 따라 플레이트 리더 분광 광도계로 260 nm에서 UV 흡광도를 측정한다. 핵산 분해 효소가없는 물을 낮은 농도의 모든 샘플을 희석. </li><li> 상보 적 DNA (cDNA의) 총 RNA로 역전사를 수행한다. 20 μL의 반응 부피 24 효소 및 뉴 클레아없는 물을 역 PCR 완충액의 dNTP 믹스 (100 mM)을 랜덤 헥사 머 프라이머와 총 RNA의 덜 100 NG를 결합하지 않는다. 제조의 프로토콜에 따라 RT주기를 실행합니다. cDNA를 -20 ° C에서 장기 저장할 수 있습니다. </li><li> 뉴 클레아 제 무 H 2 O 80 μL에 100 μL에 20 μL 반응 희석 </li><li> 형광 기반 인터 염료 배 qPCR의 마스터 믹스를 5 μL, 각각 10 μM의 프라이머 0.06 μL를 섞어샘플 당 희석 RT 반응 ND 2 μL. </li><li> 형광 기반의 마스터 믹스 제조 업체의 프로토콜에 따라 실행 qPCR에. </li><li> 델타 CT 법에 의해 mRNA의 상대적인 양을 정량화 GAPDH로 정상화. 각 치료 그룹에 대한 표준 편차 ± 생물 복제의 평균 mRNA 발현을 그린다. 참고 : 등의 RNase없는 플라스틱 및 시약을 사용하는 등 RNases과 접촉을 피하기 위해 RNA로 작업 할 때 특별한 예방 조치가 취해 져야한다. 비 일회용 장비는 RNases을 제거하기 위해 사용하기 전에 처리해야합니다. </li></ol> 5. 면역 형광 염색 <ol><li> 24- 웰 포맷에서 RD 세포로부터 진공 흡인 단계 3.6 대기음 미디어 다음. </li><li> 웰당 4 % 파라 포름 알데히드 (PFA) 500 μL를 첨가하여 세포를 고정하고, 실온에서 15 분 (RT) 동안 배양. 정착 이후, 인산 장소 세포 밤새 필요한 경우 39 ° C에서 생리 식염수 (PBS) 및 스토어 버퍼. </li><li> Permeabilize 하시려면PBS + 0.2 % 트리톤 X100 500 μL를 첨가하고, RT에서 30 분 동안 배양하여 세포. 진공 흡인, permeabilization 버퍼를 제거하고 PBS로 3 회 세척 하였다. </li><li> 5 % 소 혈청 알부민 500 μL (BSA) / PBS에서 차단하고 RT에서 30 분 동안 세포를 배양한다. 세포를 밤새 필요한 경우 4 ℃에서 저장 될 수있다. </li><li> 차 항체 희석을 준비한다. 15 ML 원뿔로 5 % BSA 피펫 200 μL / 웰 당 PBS (12 웰 = 2.4 mL) 및 5 % BSA 1 ㎖ 당 1 차 항체 μL를 추가 / PBS를 필요로했다. 진공 흡인 차단 완충액을 제거하고, 각 웰에 희석 된 일차 항체의 200 μL 분주. <ol><li> 1 세포를 인큐베이션 : 5 % BSA에서 희석 된 1000 개 차 항체 / PBS 실온에서 1 시간 동안 또는 밤새 4 ℃에서. 부화 후, PBS로 세포를 두 번 씻는다. </li></ol></li><li> 상기와 같이, 5 % BSA / PBS 동량의 차 항체 희석을 준비한다. 2,000 희석 : 1을 사용하여 원적외선 염료 복합 이차 항체를 추가합니다. 또한 추가믹스 훽스트 염료 1 ㎍ / mL로. PBS를 제거하고 각 웰에 믹스 200 μL를 추가합니다. <ol><li> 어둠 속에서 실온에서 1 시간 동안 인큐베이션. PBS로 3 회 세척, PBS에서 셀을두고 호일을 사용하여 빛으로부터 세포를 보호합니다. 필요한 경우 세포를 4 ℃에서 저장 될 수있다. </li></ol></li><li> 650 나노 미터 - 여기 파장 (594)와 반전 된 표면 형광 현미경의 400 배의 총 배율에서 이미지 셀. </li></ol> 6. 웨스턴 블로 팅 <ol><li> 얼음처럼 차가운 PBS로 두 번 3.6에서 세포를 씻으십시오. 얼음, 1X RIPA 50 μL와 세포를 Lyse 1X 프로테아제 억제제 칵테일 보충 버퍼입니다. </li><li> 15 분 동안 4 ℃에서 락 해물을 5 분 샘플을 명확히하기위한 고속 (20,000 XG)에 1.5 ㎖의 튜브에 해물을 원심 분리 수집. 필요한 경우 세포 용 해물은 -80 ° C에서 장기 저장할 수 있습니다. </li><li> 브래드 포드 분석을 이용하여 총 단백질을 정량화 된 새로운 1.5 ㎖의 마이크로 원심 튜브에 단백질의 동일한 양 나누어지는. 브린2- 머 캅토 에탄올이 보충 된 RIPA 완충액과 3X 램리 로딩 완충액을 사용하여 동일한 부피 샘플 g. </li><li> 95 ° C에서 5 분 동안 1X 램 믈리 시료 완충액 로딩 샘플을 인큐베이션하고 45 분 동안 200 V에서 4-12 % 트리스 - 글리신 겔을 사용하여 SDS-PAGE를 실행. 세포주에 따라 단백질 적재 범위의 양. 어떤 경우에는, 총 단백질의 50 ~ 100 μg의는 중간 엽 세포 라인에서 E-cadherin의를 감지하기 위해 필요합니다. </li><li> 1X 트리스 - 글리신 전송 버퍼에서 50 V에서 2 시간 동안 니트로 셀룰로오스 막 상으로 전달 단백질. </li><li> 실온에서 밤새 또는 BSA 기반 차단 완충액 4 ° C에서 1 시간 동안 차단 막. </li><li> 차단 완충액 5 mL 중에 1000 농도로 희석 멤브레인을 추가하고 부드러운 실온에서 또는 밤새 4 ℃에서 1 시간 동안 흔들 함께 배양 1 주에서 항체를 희석. 0.05 % 트윈 20과 함께 PBS에서 세척 막을 3 회. </li><li> 적외선 형광 결합 secondar 함께 RT에서 1 시간 동안 막을 인큐베이션예 1에서 항체 : 위와 블로킹 완충액에 희석 20,000. </li><li> 0.05 % 트윈 20과 함께 PBS로 막 두 번 세척하고 PBS에 다음 한 시간. </li><li> 표준 적외선 형광 검출을 이용하여, 화상을 막. </li></ol> 7. 앵커리지 독립적 인 성장 분석 참고 : 자세한 부드러운 한천 분석 프로토콜의 28을 참조하십시오. <ol><li> 온수욕에서 42 ° C로 예열 멸균 배 DMEM 배지. 이 시간 동안, 열은 3 분 동안 전자 레인지에서 1 % 아가로 미리 멸균. 필요하거나 완전히 용해 될 때까지로 한 번에 추가로 30 초 동안 전자 레인지. 42 ° C의 물을 욕조에 아가로 이동합니다. </li><li> 무균 후드에서 42 ° C의 물과 함께 비이커에 50ml의 원뿔형 튜브를 배치하고, 1을 1 % 아가 로즈 및 배 DMEM 배지를 혼합 : 6 웰 플레이트에 웰 당 혼합물을 1.5 mL의 1 비율 회계. 항상 DMEM 아가로 오스 피펫 오류에 대해 설명 할 / 추가로 준비하고 거품을 피하기 위해. </li><li> 받는 사람 혼합물을 추가기포를 확보하지 웰의 측면, 형태 및 RT에서 30 분 동안 방치하자. </li><li> 하부 층이 고화되는 동안 미디어를 흡입하고 1 ㎖의 PBS로 한번 세척 3 단계에서 형질 RD 세포의 각 그룹을 준비한다. 대기음 PBS 및 0.05 % 트립신, 0.2 mL를 첨가하고 5 분 동안 37 ℃에서 배양한다. </li><li> 단일 세포 현탁액을 형성하기 위하여 미디어 씹다 세포를 0.8 mL의 트립신을 중화. 15 mL의 원뿔형 튜브에 세포 현탁액을 전송. </li><li> 세포를 세어 웰 당 10,000 세포에 필요한 세포 현탁액의 양을 계산한다. </li><li> 완전히 용해 될 때까지 한 번에 30 초 다음 3 분 동안 전자 레인지에서 0.6 % 아가로 가열한다. 42 ° C의 물을 욕조에 아가로 이동합니다. </li><li> 무균 후드에서 42 ° C의 물과 함께 비이커에 50ml의 원뿔형 튜브를 놓는다. 6 웰 플레이트에 웰 당 1.5 ㎖의 혼합물을 제조 한 비 : 1의 0.6 % 아가로 희석 세포 현탁액을 혼합한다. 항상 피펫 오류를 설명하는 혼합 아가로 오스 / 여분의 세포 현탁액을 준비하고거품을 방지한다. 참고 : 여기에 42 ° C에서 작동하는 것이 중요합니다. 온도가 너무 낮 으면, 혼합물 도금 전에 고체화되고, 42 ° C 이상의 온도가 세포 생존에 영향을 미칠 것이다. </li><li> 세포를 여러 번으로 분쇄하여 잘 혼합 및 기포 형태를 보장하지 웰에 세포 혼합액을 추가하고, 실온에서 20 분 동안 응고하자. </li><li> 각 보충 미디어 2 용액을 웰에 첨가하고 플레이트를 인큐베이터를 이동. <ol><li> 3~4주 또는 다세포 식민지 형성 할 때까지 일주일에 한 번 미디어를 변경합니다. 진공 흡인에 의해 용지를 제거 할 때 한천을 만지지 않도록주의하십시오. 대안 적으로, 액체 매질의 상층을 제거하는 P1000을 사용한다. </li><li> 200 μL 니트로 블루 테트라 졸륨 클로라이드 용액을 첨가하여 (1 밀리그램 / PBS 용액에서) 소프트 한천 플레이트 얼룩과 37 ℃에서 밤새 배양 접시. 영상 PBS로 다음날 매체를 교체합니다. </li><li> 거꾸로 현미경에 40X 총 배율에서 이미지 우물. </li><li> 식민지 지역 및 번호 ImageJ에에 분석을 수행합니다. 플롯은 생물 복제의 콜로니 수는 표준 편차를 ± 의미한다. </li></ol></li></ol>

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

저자가 공개하는 게 없다.

육종은 중간 엽 계보의 희귀하지만, 매우 공격적인 암이다. 자신의 중간 엽 혈통에도 불구하고, 육종의 부분 집합은 더 상피와 같은 상태로 형질 전환을 겪을 것으로 보인다. 더 상피와 같은 종양을 가진 환자가 24 덜 공격적으로이 MET-같은 스위치는, 예후 관련이있다. 임상 관련성에도 불구하고, 육종 이러한 형질 전환을 운전하는 분자 메커니즘을 해결 몇몇 연구가있다. <p cla...

An erratum was issued for: <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

표현형 가소성 세포 표현형 사이의 가역적 인 변화를 의미하고, 일반적으로 두 가지 유형, 상피 간 간엽 (EMT) 전환 및 중간 엽 간 상피 천이 (MET)로 분할된다. 이 표현형의 가소성은 개발 및 상처 치유 1과 다세포 생물의 정상적인 과정에서 중요한 역할을한다; 그러나,이 같은 경로 유전자 발현 프로그램 또한 섬유증, 질병을 초래할 수있다 (검토를 2, 3, 4), 암 전이 (참고 문헌 5, 6, 7의 평가 8). 전이 동안, 예를 들어, EMT 세포 극성, 세포 - 세포 상호 작용을 방해하고, 침략 9, 10 추진하고 있습니다. 함께, EMT 기여암 세포의 보급을 촉진하는 표현형 상태로의. 또한 EMT는 암 세포 대사 (6)의 규제 완화 약물 저항 (11), (12)의 개발을 포함 공격적인 표현형을 유도 다른 표현형 변화, 증가 된 종양 개시 능력 (13), (14)와 면역 회피 15 호스트의 호스트로 이끈다. 표현형 소성 잘 암의 진행에서 연구되고있다; 그러나, 육종은 표현형의 가소성을 나타낸다. 암의 표현형 가소성 같은 드라이버 중 일부는 또한 육종 소성 및 공격성에 기여하는 것처럼 흥미롭게도,이 나타납니다. 예를 들어, 육종 환자의 순환 성 종양 세포 (CTCS은)는 EpCAM, 일반적으로 상피 세포 (16)에서 발견되는 세포 표면 단백질을 발현하는 것으로 나타났다. ADDI전통적으로, 250 개 연조직 육종 샘플 상피 형상 또는 간엽 같은 유전자 발현에 기초로 분류 하였다. 상피와 같은 바이오 마커의 서명이있는 환자는 중간 엽 같은 바이오 마커의 서명 (17)을 가진 환자보다 더 나은 예후를했다. 이것은 더 상피와 같은 암 환자보다 중간 엽 같은 종양 18 환자에 비해 더 나은 결과를 보유하고있는 많은 암과 일치한다. 일부 육종이 생체와 MET와 일치 유전자 발현 경로를 표시하지만,이 표현형 가소성의 분자 토대는 잘 이해되지 유지. 육종 MET의 메커니즘과 드라이버를 연구하기 위해 우리는 두 가지 상피 특정 요소를 사용하여 MET 유도의 모델을 개발, 마이크로 RNA (은 miR) -200 가족과 grainyhead 같은 2 (GRHL2). 미르-200S는 messen의 3 &#39;의 UTRs에 결합함으로써 유전자 발현을 조절하는 작은 비 RNA를 코딩하는 가족게르 RNA와 단백질에 방지 번역. 미르 141, 미르 (200A)를 포함 하나, 미르-200B, 200C 미르, 미르-429을 포함한 타 - 미르-200 가족 개의 서브 그룹들로 구성된다. 미르-200 계열의 구성원은 상피 조직에 충실 미르-200S 손실은 암 (19)의 전이와 관련된다. 미르-200 계열은 정상 조직에 비해 20 연조직 육종에서 하향 조절된다. 미르-200S 유사하게, GRHL2 상피 개발 (21)에 대한 중요 핵심 레귤레이터이다. GRHL2 전사 인자는 E-cadherin의 상피 유전자를 상향 조절하는 방법은 두 가지 작용 1) 상피 세포에서 GRHL2 직접 EMT 마스터 레귤레이터 억압을 ZEB1 22; 2) GRHL2 직접 상피 유전자 (23)의 전사를 활성화합니다. 우리의 이전 연구는 것으로 나타났습니다 육종 세포 미르-200S와 GRHL2의 결합 된 표현MET-같은 표현형 (24)를 유도한다. 여기서는은 miR-200S 및 GRHL2의 이소성 발현하여 육종 세포에서 MET 유도 시험 관내 모델을 작성하는 구체적인 프로토콜을 제안한다.

<table><tbody><tr><td>Countess automated counter</td><td>Life technologies</td><td>AMQAX1000</td><td></td></tr><tr><td>Countess cell counting chamber slides</td><td>Invitrogen</td><td>C10283</td><td></td></tr><tr><td>SimpliAmp Thermal Cycler</td><td>Thermo Fisher</td><td>A24811</td><td></td></tr><tr><td>Odyssey Fc</td><td>LI-COR Inc</td><td></td><td></td></tr><tr><td>ViiA7 Real Time PCR System</td><td>Thermo Fisher</td><td>4453536</td><td></td></tr><tr><td>PCR microplate</td><td>Corning</td><td>321-29-051</td><td></td></tr><tr><td>KAPA SYBR Fast Universal qPCR Kit</td><td>KAPA Biosystems</td><td>KK4602</td><td></td></tr><tr><td>Starting Block (PBS) Blocking Buffer</td><td>Thermo Fisher</td><td>37538</td><td>BSA-based blocking buffer</td></tr><tr><td>Agarose General Purpose LE</td><td>Genesee Scientific</td><td>20-102</td><td></td></tr><tr><td>10x Tris/Glycine/SDS Buffer</td><td>Bio-Rad Laboratories Inc</td><td>161-0732</td><td>Running buffer</td></tr><tr><td>10x Tris/Glycine Buffer</td><td>Bio-Rad Laboratories Inc</td><td>161-0734</td><td>Transfer buffer</td></tr><tr><td>RIPA Buffer</td><td>Sigma Life Sciences</td><td>SLBG8489</td><td></td></tr><tr><td>Amersham Protran 0.45 &amp;mu;m nitrocellulose</td><td>GE Healthcare Lifesciences</td><td>10600012</td><td></td></tr><tr><td>Quick-RNA MiniPrep Kit</td><td>Genesee Scientific</td><td>11-358</td><td></td></tr><tr><td>Laemmli Sample Buffer (4X)</td><td>Bio-Rad Laboratories Inc</td><td>1610747</td><td></td></tr><tr><td>Mini Trans-Blot Cell</td><td>Bio-Rad Laboratories Inc</td><td>1703930</td><td></td></tr><tr><td>Mini-Protean Tetra Cell</td><td>Bio-Rad Laboratories Inc</td><td>1658005EDU</td><td></td></tr><tr><td>DPBS</td><td>Life technologies</td><td>14190-144</td><td></td></tr><tr><td>0.05% Trypsin-EDTA</td><td>Life technologies</td><td>11995-065</td><td></td></tr><tr><td>DMEM</td><td>Life technologies</td><td>11995-065</td><td></td></tr><tr><td>Lipofectamine RNAi Max</td><td>Thermo Fisher</td><td>13778150</td><td></td></tr><tr><td>Lipofectamine 2000 Ragents</td><td>Thermo Fisher</td><td>11668019</td><td></td></tr><tr><td>Penicillin Streptomycin</td><td>Life technologies</td><td>15140-122</td><td></td></tr><tr><td>miRVana miRNA mimic negative control #1</td><td>Thermo Fisher</td><td>4464058</td><td>neg miRNA</td></tr><tr><td>hsa-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4464066</td><td>miR200A</td></tr><tr><td>has-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4404066</td><td>miR200B</td></tr><tr><td>has-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4404066</td><td>miR200C</td></tr><tr><td>Opti-MEM</td><td>Life technologies</td><td>11088-021</td><td>serum-free media</td></tr><tr><td>anti-Ecadherin antibody</td><td>BD Bioscience</td><td>610182</td><td></td></tr><tr><td>anti-beta actin</td><td>Santa Cruz Biotechnology</td><td>sc-69879</td><td></td></tr><tr><td>anti-EpCam</td><td>Ab Serotec</td><td>MCA18706</td><td></td></tr><tr><td>anti-ZO1</td><td>Invitrogen</td><td>402200</td><td></td></tr><tr><td>IRDye 800W</td><td>LI-COR Inc</td><td>925-32210</td><td></td></tr><tr><td>IRDye 680</td><td>LI-COR Inc</td><td>926-32223</td><td></td></tr><tr><td>anti-mouse AlexaFluor 647</td><td>Thermo Fisher</td><td>A211241</td><td></td></tr><tr><td>anti-rabbit AlexaFluor 647</td><td>Thermo Fisher</td><td>ab150075</td><td></td></tr><tr><td>Halt Protease and Phosphatesse Inhibitor</td><td>Thermo Fisher</td><td>1861281</td><td></td></tr><tr><td>Precision Plus Protein Dual Color</td><td>Bio-Rad Laboratories Inc</td><td>161-0374</td><td></td></tr><tr><td>Partec CellTrics</td><td>Sysmex</td><td>04-004-2326</td><td>30 &amp;mu;m filter for flow</td></tr><tr><td>GAPDH-F</td><td>IDT</td><td></td><td>AGCCACATCGCTCAGACAC</td></tr><tr><td>GAPDH-R</td><td>IDT</td><td></td><td>GCCCAATACGACCAAATCC</td></tr><tr><td>Ecadherin-F</td><td>IDT</td><td></td><td>TGGAGGAATTCTTGCTTTGC</td></tr><tr><td>Ecadherin-R</td><td>IDT</td><td></td><td>CGCTCTCCTCCGAAGAAAC</td></tr><tr><td>ZEB1-F</td><td>IDT</td><td></td><td>GCATACAGAACCCAACTTGAACGTC</td></tr><tr><td>ZEB1-R</td><td>IDT</td><td></td><td>CGATTACACCCAGACTGC</td></tr><tr><td>NOTCH-F</td><td>IDT</td><td></td><td>GGCAATCCGAGGACTATGAG</td></tr><tr><td>NOTCH-R</td><td>IDT</td><td></td><td>CTCAGAACGCACTCGTTGAT</td></tr><tr><td>nitro blue tetrazolium&amp;nbsp;</td><td>Sigma</td><td>N5514</td><td></td></tr><tr><td>hexadimethrine bromide</td><td>Sigma</td><td>H9268</td><td>polybrene</td></tr><tr><td>3 mL syringe</td><td>BD Bioscience</td><td>309657</td><td></td></tr><tr><td>Sterile syringe filter</td><td>VWR</td><td>28145-505</td><td></td></tr><tr><td>5mL polypropylene round-bottom tube</td><td>352063</td><td></td><td>flow cytometry tubes</td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Fisher</td><td>4368814</td><td>reverse transcription kit</td></tr><tr><td>4% paraformaldyhyde</td><td>Santa Cruz Biotechnology</td><td>sc-281612</td><td></td></tr><tr><td>Triton-X100</td><td>Sigma</td><td>93443</td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A7906</td><td></td></tr></tbody></table>

induction of mesenchymal-epithelial transitions in sarcoma cells

표현형 소성은 세포가 일시적으로 다른 혈통의 특성을 얻을하는 현상을 말한다. 암 진행하는 동안, 표현형의 가소성은 침공, 보급 및 전이를 구동한다. 표현형 가소성 연구의 대부분은 상피 유래 암의 맥락에서되었지만 실제로, 그것은 mesenchymal- 유사한 현상을 겪고 육종의 부분 집합으로, 또한 표현형의 가소성을 전시, 기원 중간 엽 있습니다 육종을 밝혀 상피 성 전이 (MET). 여기서는 각각 순차적 GRHL2 및 미르 200 패밀리는 세포 형질 도입 및 형질 전환을 이용하여 표현 육종 환자 samples.We 관찰이 메티오닌과 같은 현상을 모방 미르-200 가족 grainyhead 같은 2 (GRHL2)를 포함하는 방법을 개발 더 나은 육종 세포에서 이러한 형질 전환의 분자 토대를 이해합니다. 미르 200S 및 GRHL2 표현 육종 세포는 상피 향상된 characterist 입증세포 형태와 상피와 중간 엽 바이오 마커의 변화에 ​​ICS. 이러한 방법을 사용하여 앞으로의 연구는 더 나은 등의 이동, 침윤, 전이 성향 및 치료 저항 등의 육종 세포에 대한 MET-같은 프로세스의 표현형의 결과를 이해하는 데 사용할 수 있습니다.

육종 세포에서 MET 유도를위한 스키마 육종 세포에서 MET와 같은 변화의 도입을위한 일반적인 타임 라인은도 1에 도시되어있다. 프로토콜은 미르-200 계열 (도 1b)의 형질 GRHL2 하였다 (도 1a)을 열 변환하는 것으로 시작한다. GRHL2 또는은 miR-200 가족만으로는 표현할 때 RD 세포의 모양에 영향을 ?...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

우리는 여기에서 마이크로 RNA-200의 가족과 같은 grainyhead 2 (GRHL2)의 결합에 기초 이소성 발현 육종 세포에서 중간 엽 상피 전환 (MET)을 유도하는 세포 배양 방법을 제시한다. 이 방법은 암의 공격성과 치료에 대한 표현형 가소성의 생물학적 영향을 이해하기 더 적합합니다.

육종 세포의 중간 엽 상피 전환 유도

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

9.3K 조회수.  Duke University.  우리는 여기에서 마이크로 RNA-200의 가족과 같은 grainyhead 2 (GRHL2)의 결합에 기초 이소성 발현 육종 세포에서 중간 엽 상피 전환 (MET)을 유도하는 세포 배양 방법을 제시한다. 이 방법은 암의 공격성과 치료에 대한 표현형 가소성의 생물학적 영향을 이해하기 더 적합합니다. 

비디오: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

A Real-time Electrical Impedance Based Technique to Measure Invasion of Endothelial Cell Monolayer by Cancer Cells

Metastatic dissemination of malignant cells requires degradation of basement membrane, attachment of tumor cells to vascular endothelium, retraction of endothelial junctions and finally invasion and migration of tumor cells through the endothelial layer to enter the bloodstream as a means of transport to distant sites in the host1-3. Once in the circulatory system, cancer cells adhere to capillary walls and extravasate to the surrounding tissue to form metastatic tumors4,5. The various components of tumor cell-endothelial cell interaction can be replicated in vitro by challenging a monolayer of human umbilical vein endothelial cells (HUVEC) with cancer cells. Studies performed with electron and phase-contrast microscopy suggest that the in vitro sequence of events fairly represent the in vivo metastatic process6. Here, we describe an electrical-impedance based technique that monitors and quantifies in real-time the invasion of endothelial cells by malignant tumor cells.
Giaever and Keese first described a technique for measuring fluctuations in impedance when a population of cells grow on the surface of electrodes7,8. The xCELLigence instrument, manufactured by Roche, utilizes a similar technique to measure changes in electrical impedance as cells attach and spread in a culture dish covered with a gold microelectrode array that covers approximately 80% of the area on the bottom of a well. As cells attach and spread on the electrode surface, it leads to an increase in electrical impedance9-12. The impedance is displayed as a dimensionless parameter termed cell-index, which is directly proportional to the total area of tissue-culture well that is covered by cells. Hence, the cell-index can be used to monitor cell adhesion, spreading, morphology and cell density.
The invasion assay described in this article is based on changes in electrical impedance at the electrode/cell interphase, as a population of malignant cells invade through a HUVEC monolayer (Figure 1). The disruption of endothelial junctions, retraction of endothelial monolayer and replacement by tumor cells lead to large changes in impedance. These changes directly correlate with the invasive capacity of tumor cells, i.e., invasion by highly aggressive cells lead to large changes in cell impedance and vice versa. This technique provides a two-fold advantage over existing methods of measuring invasion, such as boyden chamber and matrigel assays: 1) the endothelial cell-tumor cell interaction more closely mimics the in vivo process, and 2) the data is obtained in real-time and is more easily quantifiable, as opposed to end-point analysis for other methods.

This article describes an in vitro technique for monitoring cancer cells invading through a monolayer of endothelial cells. The data is acquired in real-time as a function of changes in impedance on the surface of electrodes at the well bottom.

암 세포에 의해 내피 세포 단층의 침략을 측정하는 실시간 전기 임피던스 기반 기술

Metastatic dissemination of malignant cells requires degradation of basement membrane, attachment of tumor cells to vascular endothelium, retraction of ...

연구

의학

A Preclinical Mouse Model of Osteosarcoma to Define the Extracellular Vesicle-mediated Communication Between Tumor and Mesenchymal Stem Cells

Within the tumor microenvironment, resident or recruited mesenchymal stem cells (MSCs) contribute to malignant progression in multiple cancer types. Under the influence of specific environmental signals, these adult stem cells can release paracrine mediators leading to accelerated tumor growth and metastasis. Defining the crosstalk between tumor and MSCs is of primary importance to understand the mechanisms underlying cancer progression and identify novel targets for therapeutic intervention. 
Cancer cells produce high amounts of extracellular vesicles (EVs), which can profoundly affect the behavior of target cells in the tumor microenvironment or at distant sites. Tumor EVs enclose functional biomolecules, including inflammatory RNAs and (onco)proteins, that can educate stromal cells to enhance the metastatic behavior of cancer cells or to participate in the pre-metastatic niche formation. In this article, we describe the development of a preclinical cancer mouse model that enables specific evaluation of the EV-mediated crosstalk between tumor and mesenchymal stem cells. First, we describe the purification and characterization of tumor-secreted EVs and the assessment of the EV internalization by MSCs. We then make use of a multiplex bead-based immunoassay to evaluate the alteration of the MSC cytokine expression profile induced by cancer EVs. Finally, we illustrate the generation of a bioluminescent orthotopic xenograft mouse model of osteosarcoma that recapitulates the tumor-MSC interaction, and show the contribution of EV-educated MSCs to tumor growth and metastasis formation. 
Our model provides the opportunity to define how cancer EVs shape a tumor-supporting environment, and to evaluate whether blockade of the EV-mediated communication between tumor and MSCs prevents cancer progression.

Direct injection of cancer-derived extracellular vesicles (EVs) leads to reprogramming of bone marrow supporting tumor progression; however, which cells mediate this effect is unclear. Herein, we describe a step-by-step protocol to investigate EV-mediated tumor-mesenchymal stem cell (MSC) interactions in vivo, revealing a crucial role for EV-educated MSCs in metastasis.

종양 및 중간 엽 줄기 세포 사이의 세포 외 기 중재 통신을 정의 하는 다리의 전 임상 마우스 모델

Within the tumor microenvironment, resident or recruited mesenchymal stem cells (MSCs) contribute to malignant progression in multiple cancer types. Under ...

암 연구학

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

개발<em&gt; 체외</em&gt; 분석은 중간 엽 세포를 시행 한 상피 - 중간 엽 전환의 수축 기능을 평가하는

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

발생학

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

약 발견에 적합 EMT 조사를위한 효소 - 및 혈청이없는 신경 줄기 세포 배양 모델

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

Three-Dimensional Bone Extracellular Matrix Model for Osteosarcoma

Osteosarcoma (OS) is the most common and a highly aggressive primary bone tumor. It is characterized with anatomic and histologic variations along with diagnostic or prognostic difficulties. OS comprises genotypically and phenotypically heterogeneous cancer cells. Bone microenvironment elements are proved to account for tumor heterogeneity and disease progression. Bone extracellular matrix (BEM) retains the microstructural matrices and biochemical components of native extracellular matrix. This tissue-specific niche provides a favorable and long-term scaffold for OS cell seeding and proliferation. This article provides a protocol for the preparation of BEM model and its further experimental application. OS cells can grow and differentiate into multiple phenotypes consistent with the histopathological complexity of OS clinical specimens. The model also allows visualization of diverse morphologies and their association with genetic alterations and underlying regulatory mechanisms. As homologous to human OS, this BEM-OS model can be developed and applied to the pathology and clinical research of OS.

The bone extracellular matrix (BEM) model for osteosarcoma (OS) is well established and shown here. It can be used as a suitable scaffold for mimicking primary tumor growth in vitro and providing an ideal model for studying the histologic and cytogenic heterogeneity of OS.

다리에 대 한 3 차원 뼈 세포 외 매트릭스 모델

Osteosarcoma (OS) is the most common and a highly aggressive primary bone tumor. It is characterized with anatomic and histologic variations along with ...

Tissue Engineering of Tumor Stromal Microenvironment with Application to Cancer Cell Invasion

3D organotypic cultures of epithelial cells on a matrix embedded with mesenchymal cells are widely used to study epithelial cell differentiation and invasion. Rat tail type I collagen and/or matrix derived from Engelbreth-Holm-Swarm mouse sarcoma cells have been traditionally employed as the substrates to model the matrix or stromal microenvironment into which mesenchymal cells (usually fibroblasts) are populated. Although experiments using such matrices are very informative, it can be argued that due to an overriding presence of a single protein (such as in type I Collagen) or a high content of basement membrane components and growth factors (such as in matrix derived from mouse sarcoma cells), these substrates do not best reflect the contribution to matrix composition made by the stromal cells themselves. To study native matrices produced by primary dermal fibroblasts isolated from patients with a tumor prone, genetic blistering disorder (recessive dystrophic epidermolysis bullosa), we have adapted an existing native matrix protocol to study tumor cell invasion. Fibroblasts are induced to produce their own matrix over a prolonged period in culture. This native matrix is then detached from the culture dish and epithelial cells are seeded onto it before the entire coculture is raised to the air-liquid interface. Cellular differentiation and/or invasion can then be assessed over time. This technique provides the ability to assess epithelial-mesenchymal cell interactions in a 3D setting without the need for a synthetic or foreign matrix with the only disadvantage being the prolonged period of time required to produce the native matrix. Here we describe the application of this technique to assess the ability of a single molecule expressed by fibroblasts, type VII collagen, to inhibit tumor cell invasion.

Tissue engineered fibroblast-derived native matrix is an emerging tool to generate a stromal substrate which supports epithelial cell proliferation and differentiation. Here a protocol applying this methodology to assess the impact of different stromal cell types on tumor cell biology is presented.

암 세포의 침략에 응용 프로그램을 사용하여 종양의 기질 미시의 조직 공학

3D organotypic cultures of epithelial cells on a matrix embedded with mesenchymal cells are widely used to study epithelial cell differentiation and ...

생체공학

Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of TGF-&#946; signaling can lead to breast cancer. TGF-&#946; elicits its effects on proliferation and differentiation via specific cell surface TGF-&#946; type I and type II receptors (i.e., T&#946;RI and T&#946;RII) that contain an intrinsic serine/threonine kinase domain. Upon TGF-&#946;-induced heteromeric complex formation, activated T&#946;RI elicits intracellular signaling by phosphorylating SMAD2 and SMAD3. These activated SMADs form heteromeric complexes with SMAD4 to regulate specific target genes, including plasminogen activation inhibitor 1 (PAI-1, encoded by the SERPINE1 gene). The induction of epithelial-to-mesenchymal transition (EMT) allows epithelial cancer cells at the primary site or during colonization at distant sites to gain an invasive phenotype and drive tumor progression. TGF-&#946; acts as a potent inducer of breast cancer invasion by driving EMT. Here, we describe systematic methods to investigate TGF-&#946; signaling and EMT responses using premalignant human MCF10A-RAS (M2) cells and mouse NMuMG epithelial cells as examples. We describe methods to determine TGF-&#946;-induced SMAD2 phosphorylation by Western blotting, SMAD3/SMAD4-dependent transcriptional activity using luciferase reporter activity and SERPINE1 target gene expression by quantitative real-time-polymerase chain reaction (qRT-PCR). In addition, methods are described to examine TGF-&#946;-induced EMT by measuring changes in morphology, epithelial and mesenchymal marker expression, filamentous actin staining and immunofluorescence staining of E-cadherin. Two selective small molecule TGF-&#946; receptor kinase inhibitors, GW788388 and SB431542, were used to block TGF-&#946;-induced SMAD2 phosphorylation, target genes and changes in EMT marker expression. Moreover, we describe the transdifferentiation of mesenchymal breast Py2T murine epithelial tumor cells into adipocytes. Methods to examine TGF-&#946;-induced signaling and EMT in breast cancer may contribute to new therapeutic approaches for breast cancer.

We describe a systematic workflow to investigate TGF-&#946; signaling and TGF-&#946;-induced EMT by studying the protein and gene expression involved in this signaling pathway. The methods include Western blotting, a luciferase reporter assay, qPCR, and immunofluorescence staining.

유방암과 정상 세포에서 TGF β 신호 및 TGF β 유도 된 상피 - 중간 엽 전환 연구

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of ...

Heteromulticellular Stromal Cells in Scaffold-free 3D Cultures of Epithelial Cancer Cells to Drive Invasion

Breast cancer is the second leading cause of cancer-related death among women in the U.S. Organoid models of solid tumors have been shown to faithfully recapitulate aspects of cancer progression such as proliferation and invasion. Although patient-derived organoids and patient-derived xenograft organoids are pathophysiologically relevant, they are costly to propagate, difficult to manipulate, and comprised primarily of the most proliferative cell types within the tumor microenvironment (TME). These limitations prevent their use for elucidating cellular mechanisms of disease progression that depend upon tumor-associated stromal cells which are found within the TME and known to contribute to metastasis and therapy resistance. 
Here, we report on methods for cultivating epithelial-stromal multicellular 3D cultures. The advantages of these methods include a cost-effective system for rapidly generating organoid-like 3D cultures within scaffold-free environments that can be used to track invasion at single-cell resolution within hydrogel scaffolds. Specifically, we demonstrate how to generate these heteromulticellular 3D cultures using BT-474 breast cancer cells in combination with fibroblasts (BJ-5ta), monocyte-like cells (THP-1), and/or endothelial cells (EA.hy926). Additionally, differential fluorescent labeling of cell populations enables time-lapse microscopy to define 3D culture assembly and invasion dynamics. 
Notably, the addition of any two stromal cell combinations to 3D cultures of BT-474 cells significantly reduces circularity of the 3D cultures, consistent with the presence of organoid-like or secondary spheroid structures. In tracker dye experiments, fibroblasts and endothelial cells co-localize in the peripheral organoid-like protrusions and are spatially segregated from the primary BT-474 spheroid. Finally, heteromulticellular 3D cultures of BT-474 cells have increased hydrogel invasion capacity. Since we observed these protrusive structures in heteromulticellular 3D cultures of both non-tumorigenic and tumorigenic breast epithelial cells, this work provides an efficient and reproducible method for generating organoid-like 3D cultures in a scaffold-free environment for subsequent analyses of phenotypes associated with solid tumor progression.

There is a critical need for 3D cancer models that capture heterocellular crosstalk to study cancer metastasis. Our study presents the generation of heteromulticellular stromal-epithelial in a scaffold and scaffold-free environment that can be used to study invasion and cellular spatial distributions.

상피암 세포의 스캐폴드가 없는 3D 배양에서 이종다세포 기질 세포(Heteromulticellular Stromal Cells in Scaffold-free 3D Cultures of Epithelial Cancer Cells to Drive Invasion)

Breast cancer is the second leading cause of cancer-related death among women in the U.S. Organoid models of solid tumors have been shown to faithfully ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

간엽 전환을 유도하고 상피의 분석

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

생물학

Detection of Alternative Splicing During Epithelial-Mesenchymal Transition

Alternative splicing plays a critical role in the epithelial-mesenchymal transition (EMT), an essential cellular program that occurs in various physiological and pathological processes. Here we describe a strategy to detect alternative splicing during EMT using an inducible EMT model by expressing the transcription repressor Twist. EMT is monitored by changes in cell morphology, loss of E-cadherin localization at cell-cell junctions, and the switched expression of EMT markers, such as loss of epithelial markers E-cadherin and &#947;-catenin and gain of mesenchymal markers N-cadherin and vimentin. Using isoform-specific primer sets, the alternative splicing of interested mRNAs are analyzed by quantitative RT-PCR. The production of corresponding protein isoforms is validated by immunoblotting assays. The method of detecting splice isoforms described here is also suitable for the study of alternative splicing in other biological processes.

Alternative splicing regulation has been shown to contribute to the epithelial-mesenchymal transition (EMT), an essential cellular program in various physiological and pathological processes. Here we describe a method utilizing an inducible EMT model for the detection of alternative splicing during EMT.