Name: mapping rna-rna interactions globally using biotinylated psoralen
Uploaded: 2017-05-24T13:00:00.000+00:00
Duration: 11 min 32 s
Description: Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Wan 연구원과 Nagarajan 연구원에게 유익한 토론에 감사드립니다. N.Nagarajan은 A * STAR의 자금 지원을받습니다. Y.Wan은 A * STAR 및 Society in Science-Branco Weiss Fellowship의 지원을받습니다.

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

저자는 경쟁적인 금전적 이해 관계가 없습니다.

여기서 우리는 게놈 전체에서 pair-wise RNA 상호 작용을 확인하는 방법 인 SPLASH의 실험 및 계산 워크 플로우에 대해 자세히 설명합니다. 우리는 박테리아, 효모 및 인간 문화에서 SPLASH를 성공적으로 활용했으며 전략이 다양한 세포 상태에서 다양한 유기체에 광범위하게 적용될 수있을 것으로 기대합니다. 프로토콜의 중요한 단계 중 하나는 하류 공정에 적합한 물질을 가지기 위해 적어도 20 μg의 가?...

거대 분자들이 서로 어떻게 접히고 상호 작용하는지 연구하는 것은 세포에서의 유전자 조절을 이해하는 열쇠입니다. 지난 수십 년간 DNA와 단백질이 유전자 조절에 어떻게 기여하는지에 대한 많은 노력이 집중되어 왔지만, 유전자 발현의 전사 후 조절에 관해서는 알려진 바가 상대적으로 적다. RNA는 선형 서열과 2 차 및 3 차 구조 모두에서 정보를 전달한다. 생체 내에서 자신과 다른 사람과 쌍을 이루는 능력이 중요합니다. 고 처리량 RNA 2 차 구조 탐색에서의 최근의 진보는 트랜스 크립 풋 2 , 3 , 4 , 5 , 6 , 7 , 8 , howe에서 이중 및 단일 가닥 영역의 위치에 대한 가치있는 통찰을 제공했다페어링 상호 작용 파트너에 대한 ver 정보가 아직 많이 누락되었습니다. transcriptome에서 어떤 RNA 서열이 다른 RNA 영역과 상호 작용 하는지를 결정하기 위해, 우리는 전구 쌍방향 정보가 필요합니다. 쌍방향의 RNA 상호 작용을 전지구하고 공평하지 않은 방식으로 매핑하는 것은 전통적으로 중요한 과제였습니다. CLASH 9 , hiCLIP 10 및 RAP 11 과 같은 이전의 접근법은 대규모 방식으로 RNA 상호 작용을 확인하는 데 사용되지만 이러한 기술은 일반적으로 특정 단백질 또는 RNA 종과 상호 작용하는 RNA의 하위 집합에 대해 RNA 염기쌍을 매핑합니다. 세계적 RNA 상호 작용을 연구하는 최근의 연구에는 생체 내에서 RNA 상호 작용 을 안정화시키지 않는 생체 내 상호 작용의 부분 집합 만 포착 할 수있는 RPL 12 방법이 포함된다. 이러한 어려움을 극복하기 위해 우리와 다른 사람들은 게놈 전반에 걸친 공평한 전략을 개발하여p RNA interactomes 를 in vivo 에서 사용하여 crosslinker psoralen 13 , 14 , 15 의 변형 된 버전을 사용했습니다. 이 프로토콜에서는 생체 내에서 염기쌍 결합 RNA를 가교 결합시킨 비 오티 닐화 된 소 랄렌을 사용하여 근접 결합 및 높은 처리량 시퀀싱을 수행 한 P soralen crosslinked, Ligated 및 Sided H ybrids (SPLASH)의 S equencing을 수행하기위한 세부 사항을 설명합니다. 게놈 전체 RNA base-pairing 파트너를 확인하십시오 ( 그림 1 ). 이 원고에서 배양 된 접착 세포,이 경우에는 HeLa 세포를 사용하여 SPLASH를 수행하는 단계를 설명합니다. 동일한 프로토콜은 포유 동물 현탁액 및 효모 및 박테리아 세포에 쉽게 적용될 수 있습니다. 간략하게, HeLa 세포를 바이오 티 닐화 된 소 랄렌으로 처리하고 생체 내에서 상호 작용하는 RNA 염기 쌍을 가교 결합시키기 위해 365 nm에서 조사 하였다. 그런 다음 RNA를 세포에서 추출하고 스트렙 트 아비딘 (streptavidin) 구슬을 사용하여 가교 결합 영역을 강화하고 단편화합니다. 인터랙 팅 RNA 단편은 근접 결합을 사용하여 함께 결찰되고 심층 시퀀싱을위한 cDNA 라이브러리로 만들어진다. 시퀀싱시 키메라 RNA는 transcriptome / genome에 매핑되어 서로 쌍을 이루는 RNA 상호 작용 영역을 식별합니다. 우리는 SPLASH를 이용하여 snoRNA, lncRNA 및 mRNA와 같은 RNA의 다양한 부류에서 분자 내 및 분자간 RNA 염기 쌍 형성을 비롯하여 구조 조직 및 상호 작용 패턴을 엿볼 수있는 효모 및 다른 인간 세포 에서 생체 내 에서 수천 건의 RNA 상호 작용을 확인했습니다 세포에서 RNA의.

<table><tbody><tr><td>1 kb Plus DNA Ladder</td><td>Life Technologies Holdings Pte Ltd</td><td>10787026</td><td>DNA ladder</td></tr><tr><td>10 bp DNA ladder</td><td>Life Technologies Holdings Pte Ltd</td><td>10821-015</td><td>DNA ladder</td></tr><tr><td>20% SDS solution</td><td>First BASE</td><td>BUF-2052-1L&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>20x SSC</td><td>First BASE</td><td>BUF-3050-20X1L</td><td></td></tr><tr><td>3.0 M Sodium Acetate Solution</td><td>First BASE</td><td>BUF-1151-1L-pH5.2&amp;nbsp;&amp;nbsp;</td><td>Required for nucleic acid precipitation</td></tr><tr><td>40% Acrylamide/Bis Solution, 19:1</td><td>Bio-Rad</td><td>1610145</td><td>TBE Urea gel component</td></tr><tr><td>Ambion Buffer Kit</td><td>Life Technologies Holdings Pte Ltd</td><td>AM9010</td><td></td></tr><tr><td>Ammonium Persulfate, Molecular Grade&amp;nbsp;&amp;nbsp;</td><td>Promega</td><td>V3131&amp;nbsp;</td><td>TBE Urea gel component</td></tr><tr><td>Bromophenol Blue</td><td>Sigma-Aldrich</td><td>B0126-25G</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>1.02445.1000</td><td>RNA extraction</td></tr><tr><td>Single strand DNA ligase</td><td>Epicentre</td><td>CL9025K</td><td>CircLigase II ssDNA Ligase</td></tr><tr><td>Centrifuge tube filters</td><td>Sigma-Aldrich</td><td>CLS8160-96EA</td><td>Costar Spin-X centrifuge tube filters</td></tr><tr><td>D5628-1G DIGITONIN CRYSTALLINE</td><td>Sigma-Aldrich</td><td>D5628-1G</td><td>For cell treatment</td></tr><tr><td>Dark Reader Transilluminator&amp;nbsp;</td><td>Clare Chemical Research</td><td>Dark Reader DR89X Transilluminator</td><td>Blue light transilluminator</td></tr><tr><td>DNA Gel Loading Dye (6x)</td><td>Life Technologies Holdings Pte Ltd</td><td>R0611</td><td>Required for agarose gel electroporation</td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium</td><td>Pan BioTech</td><td>P04-03500</td><td>For Hela cell culture</td></tr><tr><td>Streptavidin magnetic beads</td><td>Life Technologies Holdings Pte Ltd</td><td>65002</td><td>Dynabeads MyOne Streptavidin C1&amp;nbsp;</td></tr><tr><td>Magnetic stand for 15&amp;nbsp;mL tubes</td><td>Life Technologies Holdings Pte Ltd</td><td>12301D</td><td>DynaMag-15</td></tr><tr><td>Magnetic stand for 15&amp;nbsp;mL tubes</td><td>Life Technologies Holdings Pte Ltd</td><td>12321D</td><td>DynaMag-2</td></tr><tr><td>ThermoMixer</td><td>Eppendorf</td><td>5382 000.015</td><td>Eppendorf ThermoMixer&amp;nbsp;C</td></tr><tr><td>Biotinylated psoralen</td><td>Life Technologies Holdings Pte Ltd</td><td>29986</td><td>EZ-Link Psoralen-PEG3-Biotin</td></tr><tr><td>F8T5/BL&amp;nbsp;</td><td>Hitachi</td><td>F8T5/BL&amp;nbsp;</td><td>365 nm UV bulb</td></tr><tr><td>Fetal Bovine Serum</td><td>Life Technologies Holdings Pte Ltd</td><td>10270106&amp;nbsp;&amp;nbsp;</td><td>Components of Hela medium</td></tr><tr><td>Formamide</td><td>Promega</td><td>H5052&amp;nbsp;&amp;nbsp;</td><td>Component in hybridization buffer</td></tr><tr><td>G8T5</td><td>Sankyo-Denki</td><td>G8T5</td><td>254 nm UV bulb</td></tr><tr><td>Glycogen</td><td>Life Technologies Holdings Pte Ltd</td><td>10814010</td><td>Required for nucleic acid precipitation</td></tr><tr><td>Nanodrop</td><td>Life Technologies Holdings Pte Ltd</td><td>Nanodrop 2000</td><td>Spectrophotometer for nucleic acidquantification</td></tr><tr><td>Nuclease free water&amp;nbsp;</td><td>First BASE</td><td>BUF-1180-500ml&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>Penicillin Streptomycin&amp;nbsp;&amp;nbsp;</td><td>Life Technologies Holdings Pte Ltd</td><td>15140122&amp;nbsp;&amp;nbsp;</td><td>Components of Hela medium</td></tr><tr><td>High-Fidelity DNA polymerase (2x)</td><td>Life Technologies Holdings Pte Ltd</td><td>F531L&amp;nbsp;</td><td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td></tr><tr><td>Primers Set 1</td><td>New England Biolabs</td><td>E7335L&amp;nbsp;</td><td>PCR primers</td></tr><tr><td>DNA Gel Extraction Kit</td><td>QIAgen</td><td>28106</td><td>QIAquick Gel Extraction Kit</td></tr><tr><td>Fluorometric Quantification kit</td><td>Life Technologies Holdings Pte Ltd</td><td>Q32854</td><td>Qubit dsDNA HS Assay Kit</td></tr><tr><td>RNA clean up kit</td><td>Qiagen</td><td>74106</td><td>RNeasy Mini Kit Silica-membrane column</td></tr><tr><td>Rnase Inhibitor</td><td>Life Technologies Holdings Pte Ltd</td><td>AM2696</td><td>SUPERase In</td></tr><tr><td>Reverse transcriptase</td><td>Life Technologies Holdings Pte Ltd</td><td>18080400</td><td>SuperScript III First-Strand Synthesis SuperMix</td></tr><tr><td>Nucleic Acid Gel Stain</td><td>Life Technologies Holdings Pte Ltd</td><td>S11494</td><td>SYBR GOLD NUCLEIC ACID 500 UL</td></tr><tr><td>T4 Polynucleotide Kinase</td><td>New England Biolabs</td><td>M0201L</td><td>End repair enzyme</td></tr><tr><td>T4 RNA Ligase 1</td><td>New England Biolabs</td><td>M0204L</td><td>Enzyme for proximity ligation</td></tr><tr><td>T4 RNA Ligase 2, truncated KQ</td><td>New England Biolabs</td><td>M0373L</td><td>Enzyme for adaptor ligation</td></tr><tr><td>Temed</td><td>Bio-Rad</td><td>1610801</td><td>TBE Urea gel component</td></tr><tr><td>Guanidinium thiocyanate-phenol-chloroform</td><td>Life Technologies Holdings Pte Ltd</td><td>15596018</td><td>TRIzol&amp;reg; Reagent for RNA extraction</td></tr><tr><td>Urea</td><td>First BASE</td><td>BIO-2070-5kg&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>UV crosslinker</td><td>Stratagene</td><td>400072</td><td>UV Stratalinker 1800</td></tr><tr><td>UV Transilluminator</td><td>UVP</td><td>95-0417-01</td><td>For visualizing of bands</td></tr><tr><td>Xylene Cyanol FF</td><td>Sigma-Aldrich</td><td>X4126-10G</td><td></td></tr><tr><td>DNA cleanup it</td><td>Zymo Research&amp;nbsp;</td><td>D4004</td><td>Zymo DNA concentrator-5&amp;nbsp;</td></tr><tr><td>&lt;strong&gt;List of software required&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>FastQC software</td><td>0.11.4</td><td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td><td></td></tr><tr><td>SeqPrep software</td><td>1.0.7</td><td>https://github.com/jstjohn/SeqPrep</td><td></td></tr><tr><td>BWA software</td><td>0.7.12</td><td>http://bio-bwa.sourceforge.net/</td><td></td></tr><tr><td>SAMTOOLS software</td><td>1.2.1</td><td>http://www.htslib.org/</td><td></td></tr><tr><td>PULLSEQ software</td><td>1.0.2</td><td>https://github.com/bcthomas/pullseq</td><td></td></tr><tr><td>STAR software</td><td>2.5.0c</td><td>https://github.com/alexdobin/STAR</td><td></td></tr><tr><td>rem_dups.py PYTHON script</td><td>PYTHON 2.7.11</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>find_chimeras.py PYTHON script</td><td>PYTHON 2.7.11</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>pickJunctionReads.awk AWK script</td><td>AWK GNU 4.1.2</td><td>https://github.com/CSB5/splash/tree/master/src</td><td></td></tr><tr><td>&lt;strong&gt;Buffer composition&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Elution buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.3 M sodium acetate</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>50 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>10 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>1% SDS</td><td></td><td></td><td></td></tr><tr><td>Always add Superase-in fresh before use except when washing beads</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Proteinase K Buffer&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>100 mM NaCl</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Hybridization Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>750 mM NaCl</td><td></td><td></td><td></td></tr><tr><td>1% SDS</td><td></td><td></td><td></td></tr><tr><td>50 mM Tris-Cl pH 7.0</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td>15% formamide (store in the dark at 4 &amp;deg;C)</td><td></td><td></td><td></td></tr><tr><td>Always add Superase-in fresh before use</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x SSC Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x RNA fragmentation buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>18 mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td></td><td></td><td></td></tr><tr><td>450 mM KCl</td><td></td><td></td><td></td></tr><tr><td>300 mM Tris-Cl pH 8.3</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;2x RNA loading Dye&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>95% Formamide</td><td></td><td></td><td></td></tr><tr><td>0.02% SDS</td><td></td><td></td><td></td></tr><tr><td>0.02% bromophenol blue</td><td></td><td></td><td></td></tr><tr><td>0.01% Xylene Cyanol</td><td></td><td></td><td></td></tr><tr><td>1 mM EDTA</td><td></td><td></td><td></td></tr><tr><td colspan="4">3&#039; RNA adapter sequence:&lt;br /&gt;
5rAppCTGTAGGCACCATCAAT/3ddC</td></tr><tr><td colspan="4">RT primer sequence:&lt;br /&gt;
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td></tr></tbody></table>

mapping rna-rna interactions globally using biotinylated psoralen

RNA가 어떻게 상호 작용 하는지를 아는 것은 세포에서 RNA 기반의 유전자 조절을 이해하는 데 중요합니다. microRNA-mRNA 상호 작용과 같은 RNA-RNA 상호 작용의 예가 유전자 발현을 조절하는 것으로 나타 났지만 RNA 상호 작용이 세포에서 일어나는 전체 범위는 아직 알려지지 않았습니다. RNA 상호 작용을 연구하기위한 이전의 방법은 주로 특정 단백질 또는 RNA 종과 상호 작용하는 RNA의 부분 집합에 초점을 맞추었다. 여기에서는 P soralen crosslinked, Ligated 및 S elected H ybrids (SPLASH)라는 이름의 방법을 상세히 설명합니다.이 방법을 사용하면 생체 내 에서 RNA 상호 작용 을 편파적으로 캡처 할 수 있습니다. SPLASH는 생체 내 교차 결합, 근접 결합 및 높은 처리량 시퀀싱을 사용하여 분자 내 및 분자간 RNA 염기쌍 파트너를 세계적으로 확인합니다. SPLASH는 박테리아, 효모 및 인간 세포를 포함한 다른 유기체에 적용 할 수 있습니다.다양한 세포 환경에서 RNA 조직의 역 동성을 이해하는 데 도움이되는 다양한 세포 조건을 제공합니다. 전체 실험 SPLASH 프로토콜은 완료하는 데 약 5 일이 걸리고 계산 워크 플로는 완료하는 데 약 7 일이 걸립니다.

그림 1 은 SPLASH 워크 플로우의 개략도입니다. 0.01 % digitonin 존재 하에서 biotinylated psoralen을 첨가하고 UV 가교 결합시 total RNA를 세포에서 추출하고 dot blot을 수행하여 RNA에 대한 biotinylated crosslinking이 효율적으로 일어 났는지 확인합니다 ( 그림 2 ). 우리는 biotinylated 20 base oligos를 양성 대조군으로 사용하여 biotinylated psoralen의 양을 ?...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

여기에서는 생체 내에서 분자 내 및 분자간 RNA-RNA 상호 작용의 게놈 전체 매핑을 가능하게하는 P soralen crosslinked, Ligated 및 S - selected Hysbrids (SL)의 S equencing 방법을 자세히 설명합니다. SPLASH는 효모, 박테리아 및 인간을 포함한 유기체의 RNA 상호 작용을 연구하는 데 적용 할 수 있습니다.

Biotinylated Psoralen을 사용하여 RNA-RNA 상호 작용을 세계적으로 매핑

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

mapping-rna-rna-interactions-globally-using-biotinylated-psoralen

Universidad San Sebastian

Research

JoVE Journal

Genetics

11.9K 조회수.  A*STAR.  여기에서는 생체 내에서 분자 내 및 분자간 RNA-RNA 상호 작용의 게놈 전체 매핑을 가능하게하는 P soralen crosslinked, Ligated 및 S - selected Hysbrids (SL)의 S equencing 방법을 자세히 설명합니다. SPLASH는 효모, 박테리아 및 인간을 포함한 유기체의 RNA 상호 작용을 연구하는 데 적용 할 수 있습니다. 

비디오: Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

연구

유전학

Sample Preparation for Mass Spectrometry-based Identification of RNA-binding Regions

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most cases, the action of noncoding RNAs is mediated by proteins whose functions are in turn regulated by these interactions with noncoding RNAs. Consistent with this, a growing number of proteins involved in nuclear functions have been reported to bind RNA and in a few cases the RNA-binding regions of these proteins have been mapped, often through laborious, candidate-based methods.
Here, we report a detailed protocol to perform a high-throughput, proteome-wide unbiased identification of RNA-binding proteins and their RNA-binding regions. The methodology relies on the incorporation of a photoreactive uridine analog in the cellular RNA, followed by UV-mediated protein-RNA crosslinking, and mass spectrometry analyses to reveal RNA-crosslinked peptides within the proteome. Although we describe the procedure for mouse embryonic stem cells, the protocol should be easily adapted to a variety of cultured cells.

We describe a protocol to identify RNA-binding proteins and map their RNA-binding regions in live cells using UV-mediated photocrosslinking and mass spectrometry.

질량 분석 기반 식별 RNA 바인딩 영역에 대 한 샘플 준비

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most ...

생화학

mRNA Interactome Capture from Plant Protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

식물 원형질에서 mRNA Interactome 캡처

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

캡처 클릭 화학 기반 RNA 위하여를 사용 하 여 RNA 의무적인 단백질의 포착 (CARIC) 전략

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

비오틴 라벨을 사용하여 단백질-핵산 상호 작용을 연구하는 생체외 생화학 적 분석을 통해

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

단일 단계 정화 RNA Biotin 및 사진 쪼갤 링커를 사용 하 여 고분자 복합물의

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological ...

Identification of RNAs Engaged in Direct RNA-RNA Interaction with a Long Non-Coding RNA

The growing role attributed nowadays to long non-coding RNAs (lncRNA) in physiology and pathophysiology makes it crucial to characterize their interactome by identifying their molecular partners, DNA, proteins and/or RNAs. The latter can interact with lncRNA through networks involving proteins, but they can also be engaged in direct RNA/RNA interactions. We, therefore, developed an easy-to-use RNA pull-down procedure that allowed identification of RNAs engaged in direct RNA/RNA interaction with a lncRNA using psoralen, a molecule that cross-links only RNA/RNA interactions. Bioinformatics modeling of the lncRNA secondary structure allowed the selection of several specific antisense DNA oligonucleotide probes with a strong affinity for regions displaying a low probability of internal base pairing. Since the specific probes that were designed targeted accessible regions throughout the length of the lncRNA, the RNA-interaction zones could be delineated in the sequence of the lncRNA. When coupled with a high throughput RNA sequencing, this protocol can be used for the whole direct RNA interactome studies of a lncRNA of interest.

An easy-to-use RNA pull-down protocol is designed for the identification of RNAs engaged in direct RNA/RNA interaction with a long non-coding RNA. The protocol uses psoralen as a fixative to cross-link only RNA/RNA interactions and provides the whole direct RNA interactome of a long non-coding RNA when coupled with RNA sequencing.

The growing role attributed nowadays to long non-coding RNAs (lncRNA) in physiology and pathophysiology makes it crucial to characterize their interactome ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

인간 사전 mRNA에 매핑 Ribonucleoproteins에 대한 신속한 하이 스루풋 방법 (RNPs)

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

생물학

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR - 클립 - RNA 단백질의 바인딩 Transcriptome 전체 바인딩 사이트를 식별하는 방법

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...