Name: generation of marked and markerless mutants in model cyanobacterial species
Uploaded: 2016-05-29T15:00:00.000+00:00
Duration: 11 min 45 s
Description: Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

우리는 환경 서비스 협회 교육 신뢰, 금융 지원을위한 캠브리지 오피씨 기금에서 합성 생물학 및 사회 정의 및 능력을 키우고, 인도 정부의 교육부에 감사하고 있습니다.

<ol>
	<li>Zwirglmaier, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+phylogeography+of+marine+Synechococcus+and+Prochlorococcus+reveals+a+distinct+partitioning+of+lineages+among+oceanic+biomes.">Global phylogeography of marine Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among oceanic biomes.</a> Environ Microbiol. 10, 147-161 (2008).</li><li>Galloway, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nitrogen+cycles:+past,+present,+and+future.">Nitrogen cycles: past, present, and future.</a> Biogeochemistry. 70, 153-226 (2004).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+cyanobacterial+alkane+production+to+the+ocean+hydrocarbon+cycle.">Contribution of cyanobacterial alkane production to the ocean hydrocarbon cycle.</a> Proc Natl Acad Sci U S A. , (2015).</li><li>Howe, C. J., Barbrook, A. C., Nisbet, R. E. R., Lockhart, P. J., Larkum, A. W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+origin+of+plastids.">The origin of plastids.</a> Philos Trans R Soc Lond B Biol Sci. 363, 2675-2685 (2008).</li><li>Lea-Smith, D. J., Bombelli, P., Vasudevan, R., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photosynthetic,+respiratory+and+extracellular+electron+transport+pathways+in+cyanobacteria.">Photosynthetic, respiratory and extracellular electron transport pathways in cyanobacteria.</a> Biochim Biophys Acta. , (2015).</li><li>McCormick, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydrogen+production+through+oxygenic+photosynthesis+using+the+cyanobacterium+Synechocystis+sp+PCC+6803+in+a+bio-photoelectrolysis+cell+(BPE)+system.">Hydrogen production through oxygenic photosynthesis using the cyanobacterium Synechocystis sp PCC 6803 in a bio-photoelectrolysis cell (BPE) system.</a> Energy Environ. Sci. 6, 2682-2690 (2013).</li><li>Bradley, R. W., Bombelli, P., Lea-Smith, D. J., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+oxidase+mutants+of+the+cyanobacterium+Synechocystis+sp.+PCC+6803+show+increased+electrogenic+activity+in+biological+photo-voltaic+systems.">Terminal oxidase mutants of the cyanobacterium Synechocystis sp. PCC 6803 show increased electrogenic activity in biological photo-voltaic systems.</a> Phys Chem Chem Phys. 15, 13611-13618 (2013).</li><li>Ducat, D. C., Way, J. C., Silver, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+cyanobacteria+to+generate+high-value+products.">Engineering cyanobacteria to generate high-value products.</a> Trends Biotechnol. 29, 95-103 (2011).</li><li>Dismukes, G. C., Carrieri, D., Bennette, N., Ananyev, G. M., Posewitz, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquatic+phototrophs:+efficient+alternatives+to+land-based+crops+for+biofuels.">Aquatic phototrophs: efficient alternatives to land-based crops for biofuels.</a> Curr Opin Biotechnol. 19, 235-240 (2008).</li><li>Tan, L. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioactive+natural+products+from+marine+cyanobacteria+for+drug+discovery.">Bioactive natural products from marine cyanobacteria for drug discovery.</a> Phytochemistry. 68, 954-979 (2007).</li><li>Volk, R. B., Furkert, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antialgal,+antibacterial+and+antifungal+activity+of+two+metabolites+produced+and+excreted+by+cyanobacteria+during+growth.">Antialgal, antibacterial and antifungal activity of two metabolites produced and excreted by cyanobacteria during growth.</a> Microbiol Res. 161, 180-186 (2006).</li><li>Scott, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodiesel+from+algae:+challenges+and+prospects.">Biodiesel from algae: challenges and prospects.</a> Curr Opin Biotechnol. 21, 277-286 (2010).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phycobilisome-deficient+strains+of+Synechocystis+sp.+PCC+6803+have+reduced+size+and+require+carbon-limiting+conditions+to+exhibit+enhanced+productivity.">Phycobilisome-deficient strains of Synechocystis sp. PCC 6803 have reduced size and require carbon-limiting conditions to exhibit enhanced productivity.</a> Plant Physiol. 165, 705-714 (2014).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thylakoid+terminal+oxidases+are+essential+for+the+cyanobacterium+Synechocystis+sp.+PCC+6803+to+survive+rapidly+changing+light+intensities.">Thylakoid terminal oxidases are essential for the cyanobacterium Synechocystis sp. PCC 6803 to survive rapidly changing light intensities.</a> Plant Physiol. 162, 484-495 (2013).</li><li>Liu, X., Sheng, J., Curtiss, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatty+acid+production+in+genetically+modified+cyanobacteria.">Fatty acid production in genetically modified cyanobacteria.</a> Proc Natl Acad Sci U S A. 108, 6899-6904 (2011).</li><li>Xu, H., Vavilin, D., Funk, C., Vermaas, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+deletions+of+small+cab-like+proteins+in+the+cyanobacterium+Synechocystis+sp+PCC+6803+-+Consequences+for+pigment+biosynthesis+and+accumulation.">Multiple deletions of small cab-like proteins in the cyanobacterium Synechocystis sp PCC 6803 - Consequences for pigment biosynthesis and accumulation.</a> J Biol Chem. 279, 27971-27979 (2004).</li><li>Castenholz, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culturing+methods+for+Cyanobacteria.">Culturing methods for Cyanobacteria.</a> Method Enzymol. 167, 68-93 (1988).</li><li>Mitschke, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimentally+anchored+map+of+transcriptional+start+sites+in+the+model+cyanobacterium+Synechocystis+sp+PCC6803.">An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp PCC6803.</a> Proc Natl Acad Sci U S A. 108, 2124-2129 (2011).</li><li>Ried, J. L., Collmer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+nptI-sacB-sacR+cartridge+for+constructing+directed,+unmarked+mutations+in+gram-negative+bacteria+by+marker+exchange-eviction+mutagenesis.">An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis.</a> Gene. 57, 239-246 (1987).</li><li>Vieira, J., Messing, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pUC+plasmids,+an+M13mp7-derived+system+for+insertion+mutagenesis+and+sequencing+with+synthetic+universal+primers.">The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.</a> Gene. 19, 259-268 (1982).</li><li>Vermaas, W. F. J., Williams, J. G. K., Rutherford, A. W., Mathis, P., Arntzen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+Engineered+Mutant+of+the+Cyanobacterium+Synechocystis+6803+Lacks+the+Photosystem-Ii+Chlorophyll-Binding+Protein+Cp-47.">Genetically Engineered Mutant of the Cyanobacterium Synechocystis 6803 Lacks the Photosystem-Ii Chlorophyll-Binding Protein Cp-47.</a> Proc Natl Acad Sci U S A. 83, 9474-9477 (1986).</li><li>Westphal, S., Heins, L., Soll, J., Vothknecht, U. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+deletion+mutant+of+Synechocystis:+A+connection+between+bacterial+phage+shock+and+thylakoid+biogenesis?.">Vipp1 deletion mutant of Synechocystis: A connection between bacterial phage shock and thylakoid biogenesis?.</a> Proc Natl Acad Sci U S A. 98, 4243-4248 (2001).</li><li>Zhang, S. Y., Shen, G. Z., Li, Z. K., Golbeck, J. H., Bryant, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+Is+Essential+for+the+Biogenesis+of+Photosystem+I+but+Not+Thylakoid+Membranes+in+Synechococcus+sp+PCC+7002.">Vipp1 Is Essential for the Biogenesis of Photosystem I but Not Thylakoid Membranes in Synechococcus sp PCC 7002.</a> J Biol Chem. 289, 15904-15914 (2014).</li><li>Taroncher-Oldenberg, G., Nishina, K., Stephanopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+analysis+of+the+polyhydroxyalkanoate-specific+beta-ketothiolase+and+acetoacetyl+coenzyme+A+reductase+genes+in+the+cyanobacterium+Synechocystis+sp+strain+PCC6803.">Identification and analysis of the polyhydroxyalkanoate-specific beta-ketothiolase and acetoacetyl coenzyme A reductase genes in the cyanobacterium Synechocystis sp strain PCC6803.</a> Appl Environ Microbiol. 66, 4440-4448 (2000).</li><li>Hein, S., Tran, H., Steinbuchel, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synechocystis+sp.+PCC6803+possesses+a+two-component+polyhydroxyalkanoic+acid+synthase+similar+to+that+of+anoxygenic+purple+sulfur+bacteria.">Synechocystis sp. PCC6803 possesses a two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria.</a> Arch Microbiol. 170, 162-170 (1998).</li><li>Ng, A. H., Berla, B. M., Pakrasi, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+tuning+of+photoautotrophic+protein+production+by+combining+promoters+and+neutral+sites+in+Synechocystis+6803,+a+cyanobacterium.">Fine tuning of photoautotrophic protein production by combining promoters and neutral sites in Synechocystis 6803, a cyanobacterium.</a> Appl Environ Microbiol. , (2015).</li></ol>

The authors declare that they have no competing financial interests.

표시되지 않은 돌연변이의 발생에 가장 중요한 단계는 다음과 같습니다 1)주의 플라스미드 디자인은 대상 지역이 변경 될 수 있도록; 2) 샘플 자당에, 특히 배양 무균 유지 보장; 3) 도금 처음에 24 시간 이상 한천 플러스 항생제 첨가하여 항생제, 부족 BG11 아가 플레이트 상에 표시 돌연변이 생성 세포를 형질 전환; 4) 배양은 BG11 플러스 자당 한천 플레이트에 도금하기 전에 4 완전 일 돌연변이 표시 : 5)로 표시 돌연변이가 완전히 분리 된 것을 보장하고 6) 완전히 돌연변이 균주의 유전자형을 확인. 이 마지막 단계에서, 삭제 된 영역의 일부를 증폭하기위한 프라이머의 추가는 그것을 제거되었음을 확인하기 위해 사용될 수있다. 서던 블롯은 힘든 상태도 사용될 수있다. 그러나, 우리의 경험은이 문서에서 설명하는 절차는 돌연변이의 적절한 검증을위한 충분한 것입니다. 이 절차는 또한 Synechococ의 현저한 돌연변이를 생성하기 위해 사용되어왔다기분이야 elongatus PCC7942. 그러나,이 cyanobacterium의 반복 변환은 도전 입증했다. 표시 돌연변이가 다음 다른 환경 조건을 높은 CO 2, 낮은 조명을 분리 할 수없는 경우 (&lt;20 μmol 광자 m -2 초 -1) 또는 추가 영양소 (즉 포도당)를 테스트 할 수 있습니다. 예를 들어, 글루코스 첨가 광계 II 돌연변이 21를 생성하기 위하여 필수적이다. 표시 돌연변이가 완전히 다음 분리하지 않으면 유전자는 아마도 생존을 위해 필수적이다. 그러나 일부 연구 그룹은 유전자 녹아웃 수 없었습니다 문헌에서 사례가 있습니다 (예를 들어, 스티스에서 VIPP) (22)는, 다른 그룹은 나중에 유전자가 23 필수 아님을 보여에만. 이것은 인접하는 필수 유전자에 극성 효과 결과 야생형 균주 또는 잘못된 플라스미드 디자인의 차이에 기인 할 수있다. 돌연변이가 완전히되지 않는 경우우리가 좌우 단편 사이 pUC18K (20)로부터 NPT1 카세트를 함유하는 플라스미드가 형질 전환에 사용되는 것이 권장 분리. 이 단편이 3.8 KB NPT1 / 카세트가 sacB와 비교하여 약 1.2 kb의 때문에, PCR에 의해 야생형 및 돌연변이에 대응하는 밴드의 존재를 확인하기 쉽다. 이 결과는 유전자가 본질적인 것으로 입증 증거의 중요한 부분이다. 삽입 발현 카세트에 표시되지 않은 돌연변이의 발생 녹아웃 균주의 개발보다 일반적으로 더 도전이다. 우리는 일반적으로 강한 cpcBAC1C2D 프로모터 (13)의 제어하에 유전자를 표현한다. 일부 경우에는이 유전자 카세트를 성공적으로 삽입의 가능성을 감소시킬 수 있으며, 과다 발현되는 단백질의 경우, 셀은 유해하다. 약한 발기인은 테스트해야합니다. 일반적으로 우리가 큰 유전자 카세트가 있음을 관찰 더 어려운 것이에서이다게놈 내로 그것을 르트. 우리는 5킬로바이트보다 큰 유전자 카세트를 삽입 할 수 없었다. 케어는 게놈에 발현 카세트를 삽입 할 위치 선택에주의해야한다. 세포 생존 또는 성장에 영향을 미치지 않는 중립 위치를 사용한다. 스티스의 예로는 폴리 하이드 록시 생합성 경로 (24, 25)을 코딩하는 단백질을 암호화하고 phaAB phaCE을 포함한다. 최근에 스티스에서 중립 사이트의 광범위한 목록 (26)가 발견되었습니다. 시아 노 박테리아에 표시되지 않은 돌연변이의 생성은 모든 단계가 제대로 수행하는 경우 약 5-7주을 고려 느린 과정이다. 이 박테리아를 조사 연구 집단의 대부분에 의해 이용 녹아웃 마크를 생성하는 표준 방법보다 느리다. 그러나 부분적으로 표시되지 않은 돌연변이에 더 돌연변이를 소개 할 수있는 유연성은 계속 추가 플라스미드 때문에,이 보상다른 항생제에 저항성을 카세트의 범위 aining, 구성 될 필요는 없다. 연구 목적으로 여러 유전자 돌연변이 능력 완전 단백질의 기능적 역할을 특성화하기 위해 종종 필요하다. 하나의 이러한 복합체의 손실이 다른 (14)의 활성에 의해 보상 될 수 있기 때문에 예를 들어, 우리는 단지 틸라코이드 막에 국부 두 단자 다제 전자 싱크의 삭제에 해로운 표현형을 확인 하였다. 산업용 애플리케이션을위한 균주의 개발뿐만 아니라 외래 유전자의 도입뿐만 아니라, 원하는 기판에 대한 광합성 효율, 빛 수확 최적화 및 경쟁 경로의 삭제를 증가시키는, 변형에 여러 수정도 필요합니다. 도장이 돌연변이 발생의 속도를 제한하는 주요 인자는 조명 조건에 따라 8-20 시간 사이 모델 시아 노 박테리아 종의 느린 분할 시간이다. 취소높은 광도 및 CO 2 농도를 데르, 성장이 빠르다. 그러나, 높은 광 또는 CO 2를 용인 할 수있는 돌연변이 균주에 대하여 선택되며, 또는 돌연변이 균주 표현형 특성 전에 바람직하지 않은 변화를 겪게 될 우려가있다. 따라서이 권장되지 않습니다. 도장이 돌연변이 체를 생성하기 위해 더 빠른 프로토콜이 개발 된 경우, 이는 매우 유익 할 것이다. 전반적으로, 이러한 기초 연구 및 응용 프로그램 모두 균주의 개발을 용이하게한다. 이러한 균주는 바이오 연료, 바이오 매스 물질 또는 화학 물질 생산을 위해 또는 시아 노 박테리아 생화학, 유전학과 생리학의 여러 측면을 이해하는데 사용될 수있다.

시아 노 박테리아는 지구상의 거의 모든 자연 환경에서 발견되는 박테리아의 진화 고대하고 다양한 문이다. 해양 생태계에서 그들은 특히 풍부 탄소 고정 (1)의 약 절반, 바다에서의 질소 고정 2와 탄화수소 생산 3 톤의 수억의 대부분이 매년 회계, 많은 영양주기에 중요한 역할을한다. 엽록체, 진핵 조류와 식물의 광합성을 담당하는 세포 기관은 숙주 생물체 (4)에 의해 침몰 된 cyanobacterium에서 진화 한 것으로 보인다. 시아 노 박테리아는 식물에 보존되어 많은의 광합성, 전자 수송층 (5) 및 생화학 적 경로의 연구에 유용한 모델 생물을 증명했다. 추가 시아 노 박테리아에서 점점 그들의 안녕에 전기 7 및 산업용 화합물을, 6 바이오 연료, 식량 생산을 위해 8을 사용하고 있습니다물과 CO 2의 ghly 효율적으로 변환 태양 에너지 (9)를 사용하여 바이오 매스합니다. 많은 종은 잠재적으로 농업 생산에 영향을주지 않고 큰 규모로 성장시킬 수있는 시아 노 박테리아를 제안, 최소한의 영양분과 해수와 비 경작지에 재배 할 수있다. 어떤 종은 항진균, 항균 및 항암 화합물 10, 11를 포함하는 천연 제품의 소스입니다. 돌연변이 체를 생성 할 수있는 능력은 산업 목적을 위해 균주의 개발을위한 시아 노 박테리아 광합성, 생화학 및 생리학을 이해하는 키 필수적이다. 발표 된 연구의 대부분은 유전 적 관심 부위에 항생 물질 내성 카세트의 삽입에 의해 변형 균주 생성한다. 이것은 몇 항생제 내성 카세트 박테리아에서 사용할 수있는 등의 균주에 도입 할 수있는 돌연변이의 수를 제한한다. 항생제 재를 부여하는 유전자를 포함하는 균주sistance 바이오 연료 및 다른 낮은 값 (12)의 제품을 생산하는 유일한 비용 효과적인 수단이 될 가능성이 개방 연못 산업 생산을 위해 사용될 수 없다. 도장이 돌연변이 체의 생성은 이러한 한계를 극복한다. 표시없는 돌연변이 의도적으로 포함하지 않는 한, 외래 DNA를 함유하지 않고, 여러 번 조작 할 수있다. 따라서, 원하는대로 변형에 많은 변화를 생성 할 수있다. 또한, 수정 위치의 하류 유전자에 극성 효과는 유기체 (13)의보다 정확한 수정 있도록 최소화 될 수있다. 삭제할 유전자 측부 시아 노 박테리아 염색체에 지역에 두 개의 DNA 단편 동일한 포함하는 돌연변이 균주, 자살 플라스미드를 생성하려면 먼저 구성된다 (5 &#39;및 3&#39;측면 영역을 지칭). 두 유전자는 이러한 측면 영역 사이에 삽입된다. 이들 중 하나는 항생제 내성 단백질을 코딩; 둘째가 sacB, 어떤 자극 인코딩levansucrase uces, 화합물은 자당에 대한 민감성을 부여. 공정의 제 1 단계에서 표시 돌연변이 일부 외래 DNA를 함유 한 균주가 생성된다. 플라스미드 구조체는 시아 노 박테리아 세포와 혼합하고, DNA를 유기체에 의해 자연적으로 수행된다. 형질 전환은 적절한 항생제와 PCR에 의해 확인 돌연변이 유전자형을 포함하는 한천 플레이트에 성장에 의해 선택된다. 자살 플라스미드 관심 균주 내에서 복제 할 수 없습니다. 따라서 어떤 항생제 내성 콜로니는 관심있는 유전자의 염색체에 삽입함으로써 재조합 사건에 기인 할 것이다. 도장이 돌연변이 체를 생성하기 위해, 돌연변이 표시된 후 바로 5 &#39;및 3&#39;플 랭킹 영역을 포함하는 제 자살 플라스미드와 혼합된다. 외래 DNA의 삽입이 필요할 경우, 이러한 DNA 단편 사이에 삽입 관심의 유전자를 포함하는 카세트 영역 측면 5 &#39;및 3&#39;이루어지는 플라스미드를 사용할 수있다. 실리ction은 자당을 포함하는 한천 플레이트에 성장을 통해입니다. 가 sacB 유전자 산물이 발현되는 경우 수크로오스가 세포에 치명적이기 때문에, 생존 세포 만이 크로스 민감성 유전자, 항생제 내성 유전자 이외에에서 재결합되어있다 두번째 재조합 이벤트가 발생하는 것과이있다 염색체와 플라스미드. 재조합 교환 결과적으로, 측면 영역들과 이들 사이의 DNA가 염색체에 삽입되어있다. 우리는 성공적으로 스티스 특검팀의 동일한 균주에 여러 염색체 돌연변이를 생성하기 위해 이러한 방법을 사용했다. (이하 스티스라고 함) PCC6803 13, 14는 관심 (13)의 유전자로 유전자 카세트의 발현에 대한 하나의 점 돌연변이를 소개합니다. 도장이 녹아웃의 생성 스티스 15,16 상세한 방법에서 우리의 작업에 앞서 입증되었지만, 힘 입어중요한 단계의 시각적 표현은 공개적으로 사용할 수 없습니다. 우리는 또한 다른 모델 cyanobacterium, 인 Synechococcus 특검팀에 표시된 녹아웃의 생성을 위해 동일한 방법을 적용했습니다. PCC7002 (이하 인 Synechococcus 함). 이 프로토콜은 돌연변이 검증 이들 균주를 저장하기위한 신속한 프로토콜을 생성하기위한 명확하고 간단한 방법을 제공한다.

<table><tbody><tr><td>NaNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>S5506</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>230391</td><td></td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>C1016</td><td></td></tr><tr><td>citric acid</td><td>Sigma</td><td>C0759</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;EDTA</td><td>Fisher</td><td>EDT002</td><td></td></tr><tr><td>H&lt;sub&gt;3&lt;/sub&gt;BO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>339067</td><td></td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt;.4H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>M3634</td><td></td></tr><tr><td>ZnSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>Z4750</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;MoO&lt;sub&gt;4&lt;/sub&gt;.2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>331058</td><td></td></tr><tr><td>CuSO&lt;sub&gt;4&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>209198</td><td></td></tr><tr><td>Co(NO&lt;sub&gt;3&lt;/sub&gt;)&lt;sub&gt;2&lt;/sub&gt;.6H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>239267</td><td></td></tr><tr><td>Ferric ammonium citrate</td><td>Sigma</td><td>F5879</td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma</td><td>P3786</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODC001</td><td></td></tr><tr><td>TES</td><td>Sigma</td><td>T1375</td><td></td></tr><tr><td>NaHCO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODH001</td><td></td></tr><tr><td>HEPES</td><td>Sigma</td><td>H3375</td><td></td></tr><tr><td>cyanocobalamin</td><td>Sigma</td><td>47869</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;S&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>72049</td><td></td></tr><tr><td>Bacto agar</td><td>BD</td><td>214010</td><td></td></tr><tr><td>Sucrose</td><td>Fisher</td><td>SUC001</td><td></td></tr><tr><td>Petri dish 90 mm triple vented</td><td>Greiner</td><td>633185</td><td></td></tr><tr><td>0.2 &amp;micro;m filters</td><td>Sartorius</td><td>16534</td><td></td></tr><tr><td>100 ml conical flasks</td><td>Pyrex</td><td>CON004</td><td></td></tr><tr><td>Parafilm M 100 mm x 38&amp;nbsp;m</td><td>Bemis</td><td>FIL003</td><td></td></tr><tr><td>Phusion high fidelity DNA polymerase&amp;nbsp;</td><td>Phusion</td><td>F-530</td><td></td></tr><tr><td>Agarose</td><td>Melford</td><td>MB1200</td><td></td></tr><tr><td>DNA purification kit&amp;nbsp;</td><td>MoBio</td><td>12100-300</td><td></td></tr><tr><td>Restriction endonucleases</td><td>NEB</td><td></td><td></td></tr><tr><td>T4 ligase</td><td>Thermo Scientific</td><td>EL0011</td><td></td></tr><tr><td>Luria Bertani broth</td><td>Invitrogen</td><td>12795-027</td><td></td></tr><tr><td>MES</td><td>Sigma</td><td>M8250</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma</td><td>60615</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td></td></tr><tr><td>GeneJET plasmid miniprep kit</td><td>Thermo Scientific</td><td>K0503</td><td></td></tr><tr><td>14 ml round-bottom tube</td><td>BD falcon</td><td>352059</td><td></td></tr><tr><td>GoTaq G2 Flexi DNA polymerase</td><td>Promega</td><td>M7805</td><td></td></tr><tr><td>425-600 &amp;micro;m glass beads</td><td>Sigma</td><td>G8772</td><td></td></tr><tr><td>Glycerol</td><td>Sigma</td><td>G5516</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418</td><td></td></tr><tr><td>Fluorescent bulbs</td><td>Gro-Lux</td><td>69</td><td></td></tr><tr><td>HT multitron photobioreactor</td><td>Infors</td><td></td><td></td></tr></tbody></table>

generation of marked and markerless mutants in model cyanobacterial species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

플라스미드 설계는 모두 표시되고 표시되지 않은 돌연변이 체의 생성에 성공에 중요하다.도 1 플라스미드 (A)의 일례를 제공하고 B는 스티스 유전자 cpcC1 및 cpcC2 13 결실 돌연변이 체의 생성에 사용. 각 경우에 5 &#39;및 3&#39;플 랭킹 영역은 약 900-1,000 염기쌍이다. 우리가 성공적으로 상용화에 박차를 가하고있는 최소 약 500 bp의 하였지만 감소 측면 영역을 사용할 수있다. B 플라스미드는 5 &#39;및 3&#39;~ 1킬로바이트 측면 영역 또는 천연 유전자 서열의 변형 된 버전 사이의 유전자 카세트를 포함 할 수있다. <img alt="그림 2" src="/files/ftp_upload/54001/54001fig2highres.jpg" width="600" /> 그림 2 : 표시 및 표시되지 않은 돌연변이의 확인, 예를 들어 cpcC1 / cpcC2 <s인 Synechococcus에 스티스 및 SYNPCC7002_A1173에 trong&gt;. (A) 야생형 스티스 (위), 표시되지 않은 (가운데) 및 표시 녹아웃 (아래) 프라이머 cpcC1C2for 및 cpcC1C2rev을 사용하여 생성 증폭의 예상 크기의 양쪽에 약 200 bp의 염색체 영역은 삭제합니다. (B) 야생형 인 Synechococcus (위)의 예상 크기와 표시 녹아웃 (아래)와 A1173for A1173rev가 염색체 영역의 양쪽에 약 200 bp의 삭제 될 프라이머를 사용하여 생성 된 증폭. (C) 야생형 스티스 (레인 2), 표시되지 않은 (레인 3)에서 생성 된 아가 로스 젤 보여주는 증폭은 cpcC1 / cpcC2 녹아웃 (레인 4)로 표시하고, (D) 야생형 인 Synechococcus (레인 6)와 마크 SYNPCC7002_A1173 녹아웃 (레인 7). 마커 나타낸다레인 1과 5에 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 세포에 플라스미드 A의 변환되면, 백 일반적으로 여러 식민지 후 약 7~10일 접시에 표시됩니다. 식민지는 &lt;이다 직경 1mm, 다음 몇 주 동안 크기가 증가하지 않습니다. 따라서 신선한 BG11 + 카나마이신 한천 접시에 식민지와 행진을 제거하기 위해 뭉툭한 끝 이쑤시개를 사용하는 것이 중요합니다. 약 절반 재 줄무늬 식민지 4-6 일 후에 성장할 것입니다. 유전자가 비 - 필수 및 돌연변이 20-40 μmol 광자 m -2 초 -1 지속광 하에서 야생형 균주와 유사한 성장을 보여주는 경우 (예 레아 스미스 외., 2013 (14) 내의 단말 옥시다아제 변이체) (도 3) 모든 염색체 t의 복사본을 포함한다<html> 그는 PCR을 통해 결정 /가 sacB 카세트, 시퀀스를 삽입 NPT1. 유전자는 비 필수이며, 돌연변이는 20 ~ 40 μmol 광자 m의 연속 빛 아래 느린 성장 표현형 -2 초 -1 (레아 스미스 외.의 예 phycobilisome 결핍 된 돌연변이 2014 13) (그림 3), 다음을 증명하는 경우 카나마이신 점차 증가 BG11 양의 아가 플레이트 상에 재 - 줄무늬 몇 차례는 분리 표시된 변이체를 얻기 위해 필수적이다. 분리 된 돌연변이가 획득되면이 그 분리가 완료 보장하기 위해 신선한 BG11 플러스 카나마이신 한천 접시에 다시 줄무늬가되어야한다. 줄무늬의 반복 라운드 돌연변이 표시된 분리 기준에 포함되지 않는 경우 유전자는 생존 가능성이 필수적이다. 4 차 올린 돌연변이 생성에 관련된 실험 단계의 개요를 제공합니다 그림. /54001/54001fig3highres.jpg &quot;폭 =&quot;700 &quot;/&gt; 도 3. 스티스 돌연변이 성장 돌연변이의 예들은 야생형 및 (B) 야생형보다 느린 성장 (A)와 유사한 성장을 보여준다. ΔCOX 돌연변이 때문에 CtaC1D1E1 유전자의 결실로 시토크롬 옥시 다제 없다. ΔCyd 돌연변이 때문에 CydAB 유전자의 결실로 퀴놀 옥시 다제 없다. 올리브 돌연변이 때문에 CpcABC1C2D 유전자의 결실로 phycobilisome의 일부가 결여되어있다. (B)의 샘플은 성장을 촉진하기 위하여 공기로 버블 링 하였다. . 레아 스미스 등의 게시 된 데이터에서 재현 2013 14 2014 13 (www.plantphysiol.org, 식물 생물학의 저작권 미국 사회). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig3highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <p class="jove_content" fo:keEP-together.within 페이지는 = &quot;1&quot;&gt; 표시되지 않은 돌연변이의 생성은 매우 효율적입니다. BG11 플러스 자당 한천 플레이트에 표시된 돌연변이에 플라스미드 B의 변형, 네 일의 잠복기 이후의 도금시, 식민지 수백 형질 전환 된 세포 현탁액의 1-10 μL 당 얻을 수있다. 과량 마크없이 변이주 불량한 선택 결과 셀당 크로즈의 농도 감소에 이르게하지만 희석 시리즈는 0.1 내지 100 ㎕의 범위, 상용화에 박차를 가하고한다. 세포의 잔디 전체 판을 통해 볼 경우 낮은 농도 시도해야합니다. 개별 식민지 BG11 플러스 자당과 BG11 플러스 카나마이신 아가 플레이트 상에 패치, 접시에 얻어지면 필수 단계입니다. 일반적으로 염색체의 영역이 삭제되는 도장이 돌연변이 체에 대해 콜로니의 대부분 민감 저항성 크로스 카나마이신이 될 것이다. 이러한 식민지에서 대상 영역의 PCR 증폭은 거의 100 %가 UNM을 보여 보여돌연변이 프로필, 예를 들어 그림 2 arked. 유전자 카세트 후 일반적으로 염색체 방지 및 자당 저항하는 식민지가 관찰 카나마이신의 높은 비율에 삽입됩니다. 이러한 돌연변이 인해가 sacB 유전자의 돌연변이에 자당에 증가 할 수 있습니다. 더 민감한 카나마이신 내성 콜로니 수크로오스 후 생성되지 않으면 유전자 카세트는 세포에 유해하다. <img alt="그림 4" src="/files/ftp_upload/54001/54001fig4highres.jpg" width="700" /> 그림 4 : 스티스의 표시 및 표시되지 않은 돌연변이의 생성 도식 디테일 (A) 재조합 및 (B) 돌연변이 생성에 관여 실험 단계.. 플라스미드 A를 먼저 세포와 혼합된다. 재결합 이벤트가 5 &#39;이 사이에 발생되는 카나마이신을 함유하는 아가 플레이트에서 콜로니를 배양 한 다음D 3 &#39;측면 지역 (각각 파란색과 빨간색으로 표시)와 염색체의 상동 서열은, 절연입니다. 또한, 5 &#39;및 3&#39;플 랭킹 영역 사이 NPT1 /가 sacB 카세트가 염색체에 삽입된다. 분리에 따라 현저한 돌연변이가 생성됩니다. 표시됨 돌연변이 세포를 중 (C) 하나 포함 할 수있는 플라스미드 B와 혼합한다 : 5 &#39;및 3&#39;플 랭킹 영역; 2 :이 서열 사이에 삽입 관심 유전자를 포함하는 발현 카세트 영역 측면 5 &#39;3&#39;; 3 :이 서열 사이에 삽입 된 목적하는 염기 변화와 야생형 서열과 플 랭킹 영역을 5 &#39;및 3&#39;. 두 번째 상 동성 재조합 이벤트는 NPT1 /가 sacB 카세트의 제거 및 도장이 녹아웃 또는 삽입을 가진 돌연변이 또는 변경 야생 일반 중 하나의 결과로, 5 &#39;및 3&#39;플 랭킹 영역 및 염색체의 상동 영역 사이에 발생염색체에 도입 전자 영역입니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig4highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 원액 레시피 </td><td></td></tr><tr><td> 화학 </td><td> 양 (g) </td></tr><tr><td> 100 배 BG11 (L 당) </td><td></td></tr><tr><td> 에 NaNO 3 </td><td> 149.6 </td></tr><tr><td> 황산 4 · 7H 2 O </td><td> 7.49 </td></tr><tr><td> 염화칼슘 2 · 2H 2 O </td><td> 3.6 </td></tr><tr><td> 구연산 </td><td> 0.6 </td></tr><tr><td> 추가 1.12 ml의 0.25 M 나 2 EDTA, pH가 8.0 </td><td></td></tr><tr><td> 0.25 M 나 2 EDTA, pH가 8.0 (100 ㎖ 당) </td><td></td></tr><tr><td> 나 2 </sub&gt; EDTA </td><td> 9.3 </td></tr><tr><td> 미량 원소 (100 ㎖ 당) </td><td></td></tr><tr><td> H 3 BO 3 </td><td> 0.286 </td></tr><tr><td> MnCl 2 · 4H 2 O </td><td> 0.181 </td></tr><tr><td> ZnSO 4 · 7H 2 O </td><td> 0.022 </td></tr><tr><td> 나 2을 MoO 4 · 2H 2 O </td><td> 0.039 </td></tr><tr><td> CuSO 4 .5H 2 O </td><td> 0.008 </td></tr><tr><td> 공동 (NO 3) 2 · 6H 2 O </td><td> 0.005 </td></tr><tr><td> 철 재고 (100 ㎖ 당) </td><td></td></tr><tr><td> 철 암모늄 시트르산 </td><td> 1.11 </td></tr><tr><td> 인산 재고 (100 ㎖ 당) </td><td></td></tr><tr><td> K 2 HPO 4 </td><td> 3.05 </td></tr><tr><td> 나 2 CO 3 재고 (100 ㎖ 당) </td&gt; <td></td></tr><tr><td> 나 2 CO 3 </td><td> 이 </td></tr><tr><td> TES 완충액, pH가 8.2 (100 ㎖ 당) </td><td></td></tr><tr><td> TES </td><td> 22.9 </td></tr><tr><td> NaHCO3을 재고 (100 ㎖ 당) </td><td></td></tr><tr><td> 의 NaHCO3 </td><td> 8.4 </td></tr><tr><td> HEPES, pH가 8.2 (500 ㎖ 당) </td><td></td></tr><tr><td> HEPES </td><td> 119.15 </td></tr><tr><td> 비타민 B 12 (50 ㎖ 당) </td><td></td></tr><tr><td> 시아 노 코발라민 </td><td> 0.02 </td></tr><tr><td> 루리아 베르 타니 미디어 (500 ㎖ 당) </td><td></td></tr><tr><td> 루리아 베르 타니 국물 </td><td> 12.5 </td></tr><tr><td> 1 M의 MgCl 2 (100 ㎖ 당) </td><td></td></tr><tr><td> 의 MgCl 2 · 6H 2 O </td><td> 20.33 </td></tr><tr&gt; <td> 용액 A (200 ㎖ 당) </td><td></td></tr><tr><td> MnCl 2 · 4H 2 O </td><td> 0.395 </td></tr><tr><td> 염화칼슘 2 · 2H 2 O </td><td> 1.47 </td></tr><tr><td> 2- (N -Morpholino) 에탄 술폰산 수화물, 4- Morpholineethanesulfonic 폰산 (MES) </td><td> 0.4265 </td></tr><tr><td> 용액 A + 글리세롤 </td><td></td></tr><tr><td> 10 ㎖ 용액 A </td><td></td></tr><tr><td> 1.5 ml의 글리세롤 </td><td></td></tr></tbody></table> 표 1 : 본 연구에 사용 된 솔루션. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 뇌관 </td><td> 순서 </td></tr><tr><td> cpcC1C2leftfor </td><td> GTAC TCTAGA GCGGCTAAATGCTACGAC </td></tr><tr><td> CPCC1C2leftrev </td><td> GATC GGATCC GCGGTAATTGTTCCCTTTGA </td></tr><tr><td> cpcC1C2rightfor </td><td> GATC GAGCTC TGCACTGGTCAGTCGTTC </td></tr><tr><td> cpcC1C2rightrev </td><td> GACT GAATTC ATCGTTGCTTGAACGGTCTC </td></tr><tr><td> M13의 앞으로 </td><td> TGTAAAACGACGGCCAGT </td></tr><tr><td> M13 역 </td><td> CAGGAAACAGCTATGAC </td></tr><tr><td> cpcC1C2for </td><td> GTTTTCATTGGCATCGGTCT </td></tr><tr><td> cpcC1C2rev </td><td> ATGTCCCAGGAACGACTGAC </td></tr><tr><td> A1173for </td><td> AGCAAACCGTTTTTGTGACC </td></tr><tr><td> A1173rev </td><td> TGCAAGGTGGCGAACTGTAT </td></tr></tbody></table> 표 2 :.이 연구 제한 엔도 뉴 클레아 제 사이트에 사용 된 프라이머 밑줄된다.

Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

모델 시아 노 박테리아 종의 표시 및 Markerless 돌연변이의 생성

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

generation-marked-markerless-mutants-model-cyanobacterial

Universidad San Sebastian

Research

JoVE Journal

Biology

11.9K 조회수.  University of Cambridge. Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

비디오: Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

히스톤 - miniSOG에서 사용 Optogenetic 무작위 돌연변이 유발<em&gt; C. 엘레</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

연구

유전학

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

온도에 민감한 치명적인 돌연변이의 높은 처리량 로봇 보조 절연에<em&gt; 클라 미도 모나스의 reinhardtii에서</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Identifying Amino Acid Overproducers Using Rare-Codon-Rich Markers

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally identified by harnessing the competitions between amino acids and their analogs. However, this analog-based method is of low accuracy, and proper analogs for specific amino acids are limited. Here, we present an alternative strategy that enables an accurate, sensitive, and high-throughput screening of amino acid overproducers using rare-codon-rich markers. This strategy is inspired by the phenomenon of codon usage bias in protein translation, for which codons are categorized into common or rare ones based on their frequencies of occurrence in the coding DNA. The translation of rare codons depends on their corresponding rare transfer RNAs (tRNAs), which cannot be fully charged by the cognate amino acids under starvation. Theoretically, the rare tRNAs can be charged if there is a surplus of the amino acids after charging the synonymous common isoacceptors. Therefore, retarded translations caused by rare codons could be restored by feeding or intracellular overproductions of the corresponding amino acids. Under this assumption, a selection or screening system for identifying amino acid overproducers is established by replacing the common codons of the targeted amino acids with their synonymous rare alternatives in the antibiotic resistance genes or the genes encoding fluorescent or chromogenic proteins. We show that the protein expressions can be greatly hindered by the incorporation of rare codons and that the levels of proteins correlate positively with the amino acid concentrations. Using this system, overproducers of multiple amino acids can be readily screened out from mutation libraries. This rare-codon-based strategy only requires a single modified gene, and the host is less likely to escape the selection than in other methods. It offers an alternative approach for obtaining amino acid overproducers.

This study presents an alternative strategy to the conventional toxic analog-based method in identifying amino acid overproducers by using rare-codon-rich markers to achieve accuracy, sensitivity, and high-throughput simultaneously.

희귀 코돈이 풍부한 마커를 사용하여 아미노산 과잉 생산자 식별

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally ...

생화학

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of antibiotics and other secondary metabolites. Streptomyces coelicolor is a well-characterized, non-pathogenic species that is amenable to a variety of analyses in the lab. The phenotyping methods described here use S. coelicolor as a model streptomycete; however, the methods are applicable to all members of this large genus as well as some closely related actinomycetes. Phenotyping is necessary to characterize new species of Streptomyces identified in the environment, and it is also a vital first step in characterizing newly isolated mutant strains of Streptomyces. Proficiency in phenotyping is important for the many new researchers who are entering the field of Streptomyces research, which includes the study of bacterial development, cell division, chromosome segregation, and second messenger signaling. The recent crowdsourcing of antibiotic discovery through the isolation of new soil microbes has resulted in an increased need for training in phenotyping for instructors new to the field of Streptomyces research and their college or high school students. This manuscript describes methods for bacterial strain propagation, storage, and characterization through visual and microscopic examination. After reading this article, new researchers (microbiology education laboratories and citizen scientists) should be able to manipulate Streptomyces strains and begin visual characterization experiments.

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Here we present protocols for novice researchers to initiate phenotyping for the pharmacologically important bacterial genus Streptomyces.

Streptomyces 발달 돌연변이의 영상 및 현미경 평가

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of ...

면역학 및 감염병학

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. The non-replicative elementary body (EB) initiates infection of the host. Once inside, the EB differentiates into the reticulate body (RB). The RB then undergoes multiple rounds of replication, before differentiating back to the infectious EB form. This cycle is essential for chlamydial survival as failure to switch between cell types prevents either host invasion or replication.
Limitations in genetic techniques due to the obligate intracellular nature of Chlamydia have hampered identification of the molecular mechanisms involved in the cell-type development. We designed a novel dual promoter-reporter plasmid system that, in conjunction with live-cell microscopy, allows for the visualization of cell type switching in real time. To identify genes involved in the regulation of cell-type development, the live-cell promoter-reporter system was leveraged for the development of a forward genetic approach by combining chemical mutagenesis of the dual reporter strain, imaging and tracking of Chlamydia with altered developmental kinetics, followed by clonal isolation of mutants. This forward genetic workflow is a flexible tool that can be modified for directed interrogation into a wide range of genetic pathways.

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

This protocol utilizes fluorescent promoter-reporters, live-cell microscopy, and individual inclusion extraction in a directed forward genetic approach to identify and isolate developmental mutants of Chlamydia trachomatis.

클라미디아 트라코마티스에서 발달 돌연변이를 식별하고 격리하는 살아있는 세포 앞으로 유전 적 접근

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. ...

Agrobacterium tumefaciens를 사용한 Chlorella vulgaris의 안정적인 유전자 통합

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

저자 스포트라이트: Agrobacterium tumefaciens를 사용한 Chlorella vulgaris에 대한 최적화된 변환 프로토콜 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Agrobacterium tumefaciens-Medited Genetic Engineering of Green Microalgae, Chlorella vulgaris (녹색 미세 조류, 클로렐라 심가리스의 Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris)

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

생체공학

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

박테리아 운동성에서 박테리아 글리코실트랜스퍼라제의 역할을 밝히기 위한 Null 돌연변이체의 생성

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Monitoring Intraspecies Competition in a Bacterial Cell Population by Cocultivation of Fluorescently Labelled Strains

Many microorganisms such as bacteria proliferate extremely fast and the populations may reach high cell densities. Small fractions of cells in a population always have accumulated mutations that are either detrimental or beneficial for the cell. If the fitness effect of a mutation provides the subpopulation with a strong selective growth advantage, the individuals of this subpopulation may rapidly outcompete and even completely eliminate their immediate fellows. Thus, small genetic changes and selection-driven accumulation of cells that have acquired beneficial mutations may lead to a complete shift of the genotype of a cell population. Here we present a procedure to monitor the rapid clonal expansion and elimination of beneficial and detrimental mutations, respectively, in a bacterial cell population over time by cocultivation of fluorescently labeled individuals of the Gram-positive model bacterium Bacillus subtilis. The method is easy to perform and very illustrative to display intraspecies competition among the individuals in a bacterial cell population.

Bacteria may accumulate either detrimental or beneficial mutations during their lifetime. In a population of cells individuals that have accumulated beneficial mutations may rapidly outcompete their fellows. Here we present a simple procedure to visualize intraspecies competition in a bacterial cell population over time using fluorescently labeled individuals.&#160;

모델 시아 노 박테리아 종의 표시 및 Markerless 돌연변이의 생성

요약

더 많은 비디오 탐색

이 비디오의 챕터

히스톤 - miniSOG에서 사용 Optogenetic 무작위 돌연변이 유발

온도에 민감한 치명적인 돌연변이의 높은 처리량 로봇 보조 절연에

희귀 코돈이 풍부한 마커를 사용하여 아미노산 과잉 생산자 식별

Streptomyces 발달 돌연변이의 영상 및 현미경 평가

클라미디아 트라코마티스에서 발달 돌연변이를 식별하고 격리하는 살아있는 세포 앞으로 유전 적 접근

Agrobacterium tumefaciens-Medited Genetic Engineering of Green Microalgae, Chlorella vulgaris (녹색 미세 조류, 클로렐라 심가리스의 Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris)

Agrobacterium tumefaciens-Medited Genetic Engineering of Green Microalgae, Chlorella vulgaris (녹색 미세 조류, 클로렐라 심가리스의 Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris)

Agrobacterium tumefaciens-Medited Genetic Engineering of Green Microalgae, Chlorella vulgaris (녹색 미세 조류, 클로렐라 심가리스의 Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris)

박테리아 운동성에서 박테리아 글리코실트랜스퍼라제의 역할을 밝히기 위한 Null 돌연변이체의 생성

형광표균의 세균세포 인구에 대한 종 내 경쟁 모니터링